ID: 1178041139

View in Genome Browser
Species Human (GRCh38)
Location 21:28642294-28642316
Sequence CCCCCTTCATGGGCAGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178041130_1178041139 13 Left 1178041130 21:28642258-28642280 CCCAAAAGTGATCTTGAGGTGGG No data
Right 1178041139 21:28642294-28642316 CCCCCTTCATGGGCAGGAACTGG No data
1178041126_1178041139 19 Left 1178041126 21:28642252-28642274 CCTAACCCCAAAAGTGATCTTGA No data
Right 1178041139 21:28642294-28642316 CCCCCTTCATGGGCAGGAACTGG No data
1178041128_1178041139 14 Left 1178041128 21:28642257-28642279 CCCCAAAAGTGATCTTGAGGTGG No data
Right 1178041139 21:28642294-28642316 CCCCCTTCATGGGCAGGAACTGG No data
1178041132_1178041139 12 Left 1178041132 21:28642259-28642281 CCAAAAGTGATCTTGAGGTGGGA No data
Right 1178041139 21:28642294-28642316 CCCCCTTCATGGGCAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178041139 Original CRISPR CCCCCTTCATGGGCAGGAAC TGG Intergenic
No off target data available for this crispr