ID: 1178041341

View in Genome Browser
Species Human (GRCh38)
Location 21:28643562-28643584
Sequence CACCTAAGCCTCCAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178041341_1178041347 7 Left 1178041341 21:28643562-28643584 CCCAGCTACTGGAGGCTTAGGTG No data
Right 1178041347 21:28643592-28643614 CGCTTGAGCCTAGGAGTTCAAGG 0: 54
1: 1001
2: 7245
3: 20260
4: 38815
1178041341_1178041346 -2 Left 1178041341 21:28643562-28643584 CCCAGCTACTGGAGGCTTAGGTG No data
Right 1178041346 21:28643583-28643605 TGGGAGGATCGCTTGAGCCTAGG 0: 1161
1: 11809
2: 39609
3: 72201
4: 131129
1178041341_1178041349 22 Left 1178041341 21:28643562-28643584 CCCAGCTACTGGAGGCTTAGGTG No data
Right 1178041349 21:28643607-28643629 GTTCAAGGCTGCAGTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178041341 Original CRISPR CACCTAAGCCTCCAGTAGCT GGG (reversed) Intergenic
No off target data available for this crispr