ID: 1178042340

View in Genome Browser
Species Human (GRCh38)
Location 21:28653003-28653025
Sequence GGGAGGGTTAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178042340_1178042346 3 Left 1178042340 21:28653003-28653025 CCTCAATTTGCATTAACCCTCCC No data
Right 1178042346 21:28653029-28653051 AATTTGCATGTAATTGAAAGTGG 0: 22
1: 98
2: 205
3: 271
4: 495
1178042340_1178042347 4 Left 1178042340 21:28653003-28653025 CCTCAATTTGCATTAACCCTCCC No data
Right 1178042347 21:28653030-28653052 ATTTGCATGTAATTGAAAGTGGG 0: 26
1: 115
2: 189
3: 287
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178042340 Original CRISPR GGGAGGGTTAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr