ID: 1178055809

View in Genome Browser
Species Human (GRCh38)
Location 21:28797223-28797245
Sequence CTCCTGTTCTGAAGGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178055803_1178055809 12 Left 1178055803 21:28797188-28797210 CCCACAGTCATCCCCACTGTTGA No data
Right 1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG No data
1178055804_1178055809 11 Left 1178055804 21:28797189-28797211 CCACAGTCATCCCCACTGTTGAA No data
Right 1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG No data
1178055806_1178055809 0 Left 1178055806 21:28797200-28797222 CCCACTGTTGAATGCACATTGCA No data
Right 1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG No data
1178055807_1178055809 -1 Left 1178055807 21:28797201-28797223 CCACTGTTGAATGCACATTGCAC No data
Right 1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG No data
1178055805_1178055809 1 Left 1178055805 21:28797199-28797221 CCCCACTGTTGAATGCACATTGC No data
Right 1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178055809 Original CRISPR CTCCTGTTCTGAAGGAACAA AGG Intergenic
No off target data available for this crispr