ID: 1178056127

View in Genome Browser
Species Human (GRCh38)
Location 21:28800267-28800289
Sequence TCGCACTACACAATCTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178056125_1178056127 17 Left 1178056125 21:28800227-28800249 CCAGACAGACTCATCTCATGCTG No data
Right 1178056127 21:28800267-28800289 TCGCACTACACAATCTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178056127 Original CRISPR TCGCACTACACAATCTTGGA TGG Intergenic
No off target data available for this crispr