ID: 1178056369

View in Genome Browser
Species Human (GRCh38)
Location 21:28803470-28803492
Sequence CTGTAGCAGTAGATTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178056369_1178056371 28 Left 1178056369 21:28803470-28803492 CCAATCTCAATCTACTGCTACAG No data
Right 1178056371 21:28803521-28803543 AGTACTGAAAGAAACTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178056369 Original CRISPR CTGTAGCAGTAGATTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr