ID: 1178057666

View in Genome Browser
Species Human (GRCh38)
Location 21:28817670-28817692
Sequence AACTGCTAATAAATGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178057664_1178057666 3 Left 1178057664 21:28817644-28817666 CCTTGAGAGTAGTAATTATACCA No data
Right 1178057666 21:28817670-28817692 AACTGCTAATAAATGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178057666 Original CRISPR AACTGCTAATAAATGTCTGA TGG Intergenic
No off target data available for this crispr