ID: 1178062972

View in Genome Browser
Species Human (GRCh38)
Location 21:28872529-28872551
Sequence CTATGAAAGAGAAAGGTGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178062972_1178062974 -3 Left 1178062972 21:28872529-28872551 CCTGTCACCTTTCTCTTTCATAG 0: 1
1: 1
2: 1
3: 19
4: 302
Right 1178062974 21:28872549-28872571 TAGCTAGCTGTTTTATAGATTGG 0: 1
1: 0
2: 2
3: 7
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178062972 Original CRISPR CTATGAAAGAGAAAGGTGAC AGG (reversed) Exonic
905366771 1:37456005-37456027 CTCTGAAATAGAATGGAGACCGG - Intergenic
906799856 1:48727287-48727309 CCTTGAGTGAGAAAGGTGACTGG + Intronic
907489061 1:54797364-54797386 TTAAGAAAGAGAAATGTGGCTGG + Intronic
907542605 1:55229780-55229802 CAAAAAAAGAGAAAGGTGAAAGG + Intergenic
907856824 1:58311747-58311769 TTATGAAAGATAAAGGGGCCAGG - Intronic
909185674 1:72482243-72482265 TTATGAAAGAGACAGAAGACAGG - Intergenic
909990439 1:82216897-82216919 CAATGAAAGAGAAAGTGGAAAGG - Intergenic
910608758 1:89116396-89116418 CTATGAAAGAGTAAAGGGAGAGG - Intronic
911512456 1:98824287-98824309 TTAAGAAAAAGAAGGGTGACAGG - Intergenic
912484004 1:110009524-110009546 GAAAGAAAGAGATAGGTGACAGG - Intronic
912993966 1:114514884-114514906 CTAGGAAAGAGAAAGGGCATTGG + Intergenic
914222100 1:145690307-145690329 CTATGAAATGGAAAGGTGTAGGG - Intronic
914839705 1:151238313-151238335 ATCTAAAAGAGAAACGTGACTGG - Intronic
916963945 1:169916091-169916113 CTATGCAAGAGACAGGAGATGGG - Intergenic
917581597 1:176384075-176384097 TTATGAACTTGAAAGGTGACAGG - Intergenic
919796483 1:201324313-201324335 ATATGAAAGAGAAAGGGTTCTGG + Intronic
920715605 1:208337479-208337501 GGAGGAAAGAGAAAGATGACTGG - Intergenic
921395282 1:214662638-214662660 CTTTCAAAGAGAAAGGAGAAGGG - Intronic
921896168 1:220403806-220403828 CGATGTAAGAGAAAAGTGAGGGG - Intergenic
923784561 1:237054845-237054867 AGATGAAAGAGGAAGGTGAGTGG + Intronic
1063692934 10:8304343-8304365 CAGAGAAAGAGAGAGGTGACAGG + Intergenic
1065263776 10:23954266-23954288 CAATGAAAGGGAAAGGGGGCCGG + Intronic
1065514803 10:26514651-26514673 CTGTAAAAGGGAAAGGTGTCTGG - Intronic
1065974595 10:30831102-30831124 CTGTGAAAGAGAAAGAAAACTGG - Intronic
1066290955 10:34014041-34014063 CTAAGCAGGAGAAAGGTGATTGG - Intergenic
1068644858 10:59454873-59454895 CTATGAAATAGAAAGGACACAGG - Intergenic
1069403179 10:68071056-68071078 CTGTGGAAGAGAAAAGTGACAGG - Intronic
1070074511 10:73122152-73122174 CTAAGAAACAGAAAGGGGAAGGG - Intronic
1071011444 10:80944891-80944913 CTATGATACAGACAGGAGACAGG - Intergenic
1071287160 10:84159450-84159472 TTTTGACAGAGAAAGGTGAGAGG - Intergenic
1071732918 10:88267085-88267107 CTATGAAAGATAAAGGGTACAGG - Intergenic
1073180539 10:101580417-101580439 CTGGGAAAGAGAGCGGTGACAGG + Intronic
1073219701 10:101860530-101860552 CTATCAAAGAGAAGGGAGACAGG + Intronic
1073935943 10:108632075-108632097 CTAAGCAAGAGAAAGGGGATGGG - Intergenic
1074561669 10:114540671-114540693 TTGAGAAAGAGAAAGGTCACTGG - Intronic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1078038246 11:7831747-7831769 CTATGAAAGAGTAATGTGAGGGG - Intergenic
1078047120 11:7925084-7925106 CTATTAAAGAAAAAGGAGAATGG + Intergenic
1078269350 11:9780594-9780616 GTATGGAAAAGAAAGGTCACAGG - Intronic
1078350353 11:10587767-10587789 TTTTGAAAGAGCATGGTGACCGG - Intronic
1079093445 11:17496106-17496128 CAGTGAGAGAGAAAGGGGACCGG + Intronic
1080332382 11:31154153-31154175 CTATCATGGAGAAAGGTGAAGGG - Intronic
1080397101 11:31900147-31900169 CCATGCACTAGAAAGGTGACAGG - Intronic
1082749676 11:57002627-57002649 GTAGGAAAGAGAGAGGTGGCAGG + Intergenic
1086827916 11:91522426-91522448 CTATGATGGAGAAAGGTGGATGG - Intergenic
1087368247 11:97248714-97248736 CAAGGAAGGAGAAAGGAGACTGG - Intergenic
1088924143 11:114283483-114283505 CTATGAAAGGGAAATGAGAGTGG + Intronic
1089634522 11:119803800-119803822 CTTTGAAGGAGGAAGGTGACAGG - Intergenic
1089769039 11:120789475-120789497 CCAGGAAAGAGAAATGAGACAGG - Intronic
1090534099 11:127621540-127621562 TAATGAAAGAGAAAGGAGAAAGG - Intergenic
1090795534 11:130132545-130132567 GGATGGAAGTGAAAGGTGACGGG - Intronic
1091112762 11:132985519-132985541 CTTTGAAAGAGAGAGGTGTGAGG - Intronic
1091670679 12:2450015-2450037 CTATGAAAGGCGAAGATGACAGG + Intronic
1094310433 12:29074748-29074770 GTATGAAAGAGAAAGAAGTCCGG + Intergenic
1094624282 12:32107553-32107575 CCAGGAAAGGGAGAGGTGACAGG - Intronic
1094774434 12:33707954-33707976 CTATAAAAGAGTTAGGTGAAAGG - Intergenic
1095484634 12:42672424-42672446 GTATGAAAGAGAAAAGGGAAGGG + Intergenic
1096151888 12:49319208-49319230 CTATGAAAGAGATAACTGTCTGG + Intergenic
1096394166 12:51253005-51253027 CTGAGAAAGAGAAAGGGGTCGGG + Intronic
1097340515 12:58432200-58432222 CTATGATAGAAAAAGTTGTCTGG - Intergenic
1097907615 12:64936558-64936580 TTCTGAAAGAGAAAGGTAAGAGG + Intergenic
1099058919 12:77881137-77881159 CTAAGTAAAGGAAAGGTGACAGG - Intronic
1100036411 12:90257828-90257850 ATAAGAGAGAGAATGGTGACTGG + Intergenic
1100484682 12:95013780-95013802 CTATGAAAAAGAAGAGAGACTGG - Intergenic
1100876615 12:98968621-98968643 TTAGGAGAGAGAAAGGTGAAGGG - Intronic
1101466719 12:104957675-104957697 GAATGAAAGAAAAGGGTGACGGG + Intronic
1101514274 12:105419978-105420000 CTATGAAAGATAAAGGAGGAGGG + Intergenic
1102007977 12:109600764-109600786 TATTGACAGAGAAAGGTGACTGG - Intergenic
1103259102 12:119570594-119570616 CTAACAAGGAGAAAGGTCACAGG + Intergenic
1103562338 12:121799363-121799385 CTTTCATAGAGAAAGGTGGCCGG + Intronic
1105468730 13:20672469-20672491 CTAGGGAAGAGCAAGGAGACAGG - Intronic
1105539199 13:21299966-21299988 CAATGAAAGAAACAAGTGACCGG - Intergenic
1105645097 13:22309316-22309338 ATAAGAAGCAGAAAGGTGACTGG - Intergenic
1105799044 13:23887656-23887678 CAATGAAAGAAACAAGTGACCGG + Intronic
1106289230 13:28345097-28345119 CTAAGAAATAAAAAGGAGACTGG - Intronic
1106459293 13:29954743-29954765 GTATGAAAGAGAAAGCTCGCTGG + Intergenic
1109282196 13:60369874-60369896 TTTTGAAAGAGAAAGGTAGCTGG - Intergenic
1109799842 13:67362480-67362502 CAATCACAGAGAAAGGTGAATGG + Intergenic
1110873120 13:80475877-80475899 CTAGGAAGGAGCAAGATGACGGG - Intergenic
1111121247 13:83853565-83853587 CTATGAAAGAGAAATATAAGAGG + Intergenic
1111171817 13:84536524-84536546 CTAAAAAAAAGAAAGTTGACAGG + Intergenic
1112621545 13:101058602-101058624 TTAGGAAAGGGAGAGGTGACAGG - Intronic
1112798921 13:103089160-103089182 CTATGAAAGAAATAGGGGCCAGG + Intergenic
1113292054 13:108918166-108918188 ATATGAAAAAGAAAGGAGAAGGG - Intronic
1113307146 13:109090853-109090875 ATAAGAAAGAGAAATGGGACGGG - Intronic
1113586891 13:111472002-111472024 CCTGGAAGGAGAAAGGTGACAGG + Intergenic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1114850909 14:26381435-26381457 CTATGAGAAAGAGAGGGGACAGG + Intergenic
1114933939 14:27509268-27509290 CTGTGAAAAATAAAGGAGACAGG - Intergenic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115966789 14:38899149-38899171 CTATCTAAAACAAAGGTGACGGG - Intergenic
1116803524 14:49467829-49467851 GCAAGAAAGAGAAAAGTGACTGG - Intergenic
1116955895 14:50922842-50922864 CTATGAAAGACAAAGGGGAGAGG - Intronic
1117592972 14:57294478-57294500 GTATGAAAGAGAAAAATCACAGG - Exonic
1117952923 14:61100807-61100829 CAAGGAAAGAGAAAGGGAACTGG - Intergenic
1118768599 14:68926898-68926920 CTATGAACAAGAAAGGGAACAGG + Intronic
1118805359 14:69231792-69231814 CTATGAAAGAGAAAGGTGAAGGG - Intronic
1119192265 14:72691030-72691052 TTTTGAAAGACAAGGGTGACTGG + Intronic
1119226628 14:72949456-72949478 TTAAAAAAGAGAAAAGTGACTGG + Intronic
1120139996 14:80918956-80918978 ATATGAAAGAGACAGATGCCAGG - Intronic
1120508709 14:85385789-85385811 CTCCGAAAGAGAAAGAAGACTGG - Intergenic
1121962532 14:98274617-98274639 AAAAGAAAGAGAAAGGAGACAGG + Intergenic
1123778902 15:23606153-23606175 CTTTGAAAGTGAAAGCAGACAGG - Intronic
1124865348 15:33485325-33485347 CTCTGAAAGAGAATGATGGCAGG + Intronic
1125128173 15:36249278-36249300 CTTTGAAAGAGAAATATGTCGGG + Intergenic
1125597440 15:40895886-40895908 CTGTGGAAGAGACAGGTGAAGGG - Intronic
1125821945 15:42639369-42639391 CAATGGCAGAGAAAGGGGACTGG - Intronic
1126509481 15:49452372-49452394 ATATGAAATAGTAAGGTAACTGG - Intronic
1127034295 15:54897812-54897834 CTATGAAAGAAAAATGATACTGG - Intergenic
1129009250 15:72400122-72400144 TTATGAAAGATAAAGGTTAATGG + Intronic
1129813726 15:78533136-78533158 CTATGAAAGAGAAATGGAAGGGG + Intronic
1133856208 16:9551465-9551487 CTATGAAGGATAAAGGAGAAGGG - Intergenic
1134343049 16:13362812-13362834 CAATGAAAGAGAAAGCTAAATGG - Intergenic
1134567116 16:15261326-15261348 CCATGAAAGAGAAAGATTCCTGG + Intergenic
1134735377 16:16495374-16495396 CCATGAAAGAGAAAGATTCCTGG - Intergenic
1134932149 16:18216843-18216865 CCATGAAAGAGAAAGATTCCTGG + Intergenic
1137851453 16:51749415-51749437 CTATGAAAGTGAAATATGAGTGG + Intergenic
1142142660 16:88479488-88479510 CTATGGGAGCGCAAGGTGACTGG - Intronic
1142221836 16:88858939-88858961 CAATGAAAGAGAAGAGTTACAGG - Intronic
1143359180 17:6353789-6353811 CTAAAAAAGAAAAAGGTTACAGG + Intergenic
1143944953 17:10582999-10583021 CTATGAGAGTGAATGGTGATTGG + Intergenic
1144105349 17:11979658-11979680 ATGTGAAAGAGAAAGGTAAATGG - Intronic
1144262124 17:13531966-13531988 GTAGGAAAGAGAGAGGGGACAGG + Intronic
1144327204 17:14193728-14193750 CTAAGGAAGAGGAACGTGACCGG - Intronic
1144476092 17:15590591-15590613 CTAAGGAAGAGGAACGTGACCGG - Intronic
1145289644 17:21533122-21533144 ATATGAAAGAGAAAGGTGTGGGG + Exonic
1146493925 17:33303625-33303647 CAAGGAAAGAGAAAAGTGAGAGG - Intronic
1146594653 17:34157807-34157829 ATTTGAAAGAGAAAGGCAACTGG + Intronic
1149337433 17:55650416-55650438 CCATCATAGAGGAAGGTGACAGG - Intergenic
1149955773 17:61048024-61048046 ATATACAATAGAAAGGTGACTGG + Intronic
1150060230 17:62061670-62061692 CAATGAAAGAAAAAGGAGGCTGG + Intronic
1150198070 17:63321912-63321934 CTGTGGAAGAGAAGGGTGAAGGG - Intronic
1151130144 17:71888608-71888630 CTCTGAAAGAGAAATGAGAAAGG - Intergenic
1151922312 17:77166426-77166448 CTCTGAAATAGAATGGTAACTGG + Intronic
1155252017 18:23961719-23961741 CCATGAAGGAGAAAGAGGACTGG + Intergenic
1155265041 18:24084075-24084097 TTATGAAGGAGAAAAATGACTGG - Intronic
1155389020 18:25313439-25313461 ATATGAAAGGGAAAGGGGAGGGG + Intronic
1155621180 18:27782223-27782245 CTATGTAAGAGAAAGGTTGTTGG - Intergenic
1155960139 18:31987302-31987324 CTCTGAAAAAGAAAGAAGACTGG + Intergenic
1156737093 18:40273599-40273621 CTTTGACATAAAAAGGTGACTGG - Intergenic
1156988290 18:43375489-43375511 CTATGGAAGAGAAAGGTAATTGG + Intergenic
1157063826 18:44323770-44323792 GTATGAAAGAGAATGATGAGAGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1165215881 19:34272195-34272217 GTGGGAAATAGAAAGGTGACAGG + Intronic
1167055697 19:47110957-47110979 CTGTGAAGGAGAAAGGGGAAAGG + Intronic
1167451566 19:49573296-49573318 CTCTGGAGGAGAAAGGAGACAGG - Intronic
925228340 2:2206319-2206341 CAATAAAAGAAAAAGGTGAATGG - Intronic
927748864 2:25648169-25648191 CAAGAAAAGTGAAAGGTGACAGG - Intronic
927966368 2:27272208-27272230 CCATGATACAGAAAGGTGAGAGG - Intronic
928243900 2:29610687-29610709 CTGTGAAAGGAAAAGGTCACTGG + Intronic
928510193 2:31995657-31995679 CTATGCAAGATATATGTGACTGG + Intronic
930291767 2:49502965-49502987 CTATGAAGGATAAAGAAGACAGG - Intergenic
930819986 2:55636566-55636588 TTATAAAAGAGAAAAGAGACGGG + Intronic
931129305 2:59315719-59315741 CCATGAAAGAGAAAAGTAAAAGG + Intergenic
931707781 2:64961823-64961845 CTAGGAAAGAGAGAGGTGGTGGG - Intergenic
931956395 2:67430673-67430695 CTATCAAAGAGTGAGGTTACAGG - Intergenic
932050274 2:68391281-68391303 CAATGGAAGAGGAAGGTAACAGG - Intronic
933213781 2:79602640-79602662 TAATGAAAGAGAAAGGTTTCTGG + Intronic
933463753 2:82623691-82623713 CTCTGGAAAAGAAAGGTGAAAGG + Intergenic
933536497 2:83582086-83582108 CTATGATAGAGAGAGATCACAGG - Intergenic
933598652 2:84307732-84307754 CTAAGAAGGAGAAAAGTCACTGG + Intergenic
934395967 2:93145234-93145256 CTATGAAAGGGAAAGTTCAACGG - Intergenic
935440330 2:103087008-103087030 CTATGAAAGAAAGAATTGACAGG + Intergenic
936610912 2:114001196-114001218 CTAGGCAAGAAAAAGGTGAAAGG + Intergenic
937770469 2:125714828-125714850 GTATGTAAGAGATAGGTGATAGG - Intergenic
939257952 2:139769309-139769331 CAGTGAAAGAGAAAGGTCACTGG + Intergenic
942130357 2:172872710-172872732 CAATCAAGGAGAAAGGTGAAGGG - Intronic
942145102 2:173019001-173019023 CTCTAAATCAGAAAGGTGACTGG + Intronic
943827148 2:192410294-192410316 CTATGAAATAGAATGGTTACTGG - Intergenic
944084326 2:195827141-195827163 ATACTAAAGAGAAAGGTGAGTGG + Intronic
944094092 2:195946977-195946999 CTCTGAGTGAGAAAGGTCACTGG + Intronic
944800364 2:203232627-203232649 CACTGCAAGAGAAAGGGGACAGG - Intergenic
944827515 2:203500280-203500302 ATATGTAAGAGAAAGGAGAAGGG + Intronic
945852607 2:215027533-215027555 ACATGAAAGAAAAAGGTCACTGG + Intronic
945941501 2:215955827-215955849 CTGTGAAAGACAAACGTGAGAGG - Intronic
1168817926 20:753560-753582 CTATGAAAGAAACAGGAGAATGG + Intergenic
1170293793 20:14801783-14801805 CTATGAAAAAGGAAAGTGAAAGG + Intronic
1173783993 20:45779244-45779266 TAAGTAAAGAGAAAGGTGACAGG + Intronic
1173787554 20:45805496-45805518 TCATGAAAGGGAAAGGTGAATGG - Intronic
1174180629 20:48672188-48672210 CTATGAAAGAGGCAGGTGTGCGG - Intronic
1176995786 21:15553813-15553835 CAATGAGAGAGGAGGGTGACGGG + Intergenic
1177405557 21:20663138-20663160 CTCTCAAAGGGAAAGGGGACTGG - Intergenic
1177513552 21:22120653-22120675 GCATGAAAGAGAGAGGTGGCAGG + Intergenic
1177748079 21:25245535-25245557 CTATGAAAGACAAAGGAGTGTGG + Intergenic
1178062972 21:28872529-28872551 CTATGAAAGAGAAAGGTGACAGG - Exonic
1182420353 22:30245837-30245859 GAAGGAAAGTGAAAGGTGACAGG + Intronic
1185090466 22:48765995-48766017 CAATGAAATAGAAAAGAGACAGG - Intronic
1185161341 22:49231750-49231772 CTAGGAGAGAGGAAGGTGAAAGG - Intergenic
949805147 3:7946645-7946667 CTATGAGAGAGAAATCTGCCCGG - Intergenic
950080698 3:10220018-10220040 CTCAGAAAGACAAATGTGACAGG - Intronic
951054119 3:18127472-18127494 CTAAGAAAGAGGAATGTAACTGG + Intronic
951405846 3:22296475-22296497 CTATGAAAGATAAAAGAGAAGGG + Intronic
951566519 3:24017314-24017336 CTATGAAAGAGAGAGAGGAAAGG - Intergenic
953059638 3:39416584-39416606 TTATGAAAGGGAAAAGTGCCGGG + Intergenic
953266804 3:41397931-41397953 TGATTAAGGAGAAAGGTGACTGG + Intronic
954779880 3:53051164-53051186 CCATGAAATGGAAAGGAGACAGG - Intronic
955924922 3:63995346-63995368 ATTTGAAGGAGAGAGGTGACAGG + Intronic
958688381 3:97428309-97428331 CTTTGAAAGAGGGAGGAGACTGG + Intronic
958774083 3:98460449-98460471 GTAGAAAAGAGAAGGGTGACTGG - Intergenic
958818074 3:98939726-98939748 CTATGAAAGAGAAAGTACAGAGG + Intergenic
959378176 3:105610362-105610384 CTCAGAAAGAAAAAGGTGCCTGG - Intergenic
959634887 3:108554702-108554724 CTATGAAATAGAAATGTGTGGGG + Intronic
959750366 3:109827369-109827391 CTATGAAATAGAAAGATTATAGG - Intergenic
960062739 3:113340434-113340456 ACAGGAAAGAGAAAGGTGGCAGG + Intronic
960971863 3:123145611-123145633 CTTTCAAAGAGAACGGTGAGGGG - Intronic
961546177 3:127635155-127635177 CTGTGAAGGAGAAAGGAGGCTGG - Intronic
962082820 3:132158528-132158550 CTGTGAAAAAGAAAAGTGGCAGG + Intronic
962092582 3:132260849-132260871 GTATGAATGAGAAAAGTCACAGG + Intronic
963398198 3:144760094-144760116 CTATGAAAAAAAAAGGAGGCTGG - Intergenic
965530552 3:169766201-169766223 CTATGAAAGAAAAAGGGGATGGG - Intergenic
965876138 3:173322555-173322577 CTATAAAAGAGTAAGGGGGCTGG - Intergenic
970599268 4:17627983-17628005 CTATGTTAGAGAAAGGGGAGAGG - Exonic
971790165 4:31160086-31160108 ATAGGAAAGAGAATGTTGACTGG - Intergenic
973017706 4:45162242-45162264 CTGTGAAAGAGAAAGCACACAGG - Intergenic
974010451 4:56601756-56601778 CTAAGAAAGAGAAAGGAAAAAGG + Intronic
974080230 4:57204572-57204594 CTCTGAAAGAGGACCGTGACAGG + Intergenic
974317189 4:60297591-60297613 GAAGGAAAGAGAAAGGTGCCAGG + Intergenic
975446454 4:74471317-74471339 CTATATAAGAGAGAGGTGAAGGG + Intergenic
976222651 4:82770343-82770365 CTATCAAAGAGAAGGGAGATGGG - Intronic
980036588 4:127890357-127890379 TTATTAAAGAGAAAAGAGACTGG + Intronic
980434822 4:132757061-132757083 CTATGAAAGAGAGAGATTAAGGG - Intergenic
981293001 4:143098142-143098164 TCAAGAAAGAGAAAGGAGACAGG - Intergenic
981704368 4:147643464-147643486 CAGTGAAAGAGAAAAATGACAGG + Intronic
981754391 4:148125410-148125432 CACAGACAGAGAAAGGTGACAGG - Intronic
983237910 4:165200541-165200563 TTAAGAAAGAGAAAAGTGGCCGG - Intronic
983800849 4:171928564-171928586 ATATGAAAGAGAAAGTTAACAGG - Intronic
984569423 4:181373793-181373815 ATATAATAGAGAGAGGTGACAGG + Intergenic
985075698 4:186211917-186211939 ATATGATATATAAAGGTGACTGG - Intronic
986018916 5:3782694-3782716 CCATGAAAGGGAAAGTTTACTGG + Intergenic
986359712 5:6965263-6965285 CTATGAAATACAAATGAGACAGG + Intergenic
986845407 5:11746302-11746324 CTATGAAAGTGAAAAGAGAAAGG - Intronic
987076165 5:14383693-14383715 CTAAGAAAAGGAAAGGTGAGGGG - Intronic
987083905 5:14450950-14450972 ATATGTAAGAGCAAGGTAACTGG + Intronic
990025018 5:51177207-51177229 AGTTGAAAGAGAAAAGTGACGGG + Intergenic
993128508 5:83865795-83865817 CTATGAATGAGAAGGGAAACTGG - Intergenic
993491951 5:88562573-88562595 CTACCAAAGAGACAGTTGACTGG - Intergenic
994146221 5:96398569-96398591 CTATCTAAGAGAAAAGTGATAGG + Intronic
996653046 5:125904713-125904735 CTATGAAGGAGAAAGGAGAATGG + Intergenic
996658362 5:125968487-125968509 CTAGGAAAGAGATATCTGACAGG - Intergenic
996757976 5:126954858-126954880 CTAGGAAAGAGAAAGAGGAAAGG - Intronic
997061580 5:130511034-130511056 GGATGACAGAGAAAGATGACAGG - Intergenic
997256723 5:132434685-132434707 CTATGAAAGATAAAGGAGAAAGG + Intronic
1000514390 5:162221898-162221920 CTATGAAAGAGATACGAGAAGGG - Intergenic
1000606565 5:163333855-163333877 CAAGGAAAGAGAAAGGAGATAGG - Intergenic
1000717897 5:164669409-164669431 CTATTAAAGAATAAGGAGACTGG - Intergenic
1001220048 5:169892848-169892870 CAATAAAAGAGAAAGGAGAGAGG - Intronic
1002201834 5:177533143-177533165 CTTAGAAAGTGAAAGGAGACTGG - Intronic
1002593431 5:180306539-180306561 CCAGGAAAGAGAAAGCTGATGGG - Intronic
1003976784 6:11352094-11352116 CCATGAAAGAGCAGGGAGACTGG - Intronic
1004130134 6:12911900-12911922 CAATCAAAGAGGAAGGTGAAAGG + Intronic
1004863878 6:19835380-19835402 CTAGGAAAGAGAAAGATCAATGG + Intergenic
1005154418 6:22787897-22787919 CTATGAAAGATAAAGATAAGAGG + Intergenic
1005347295 6:24903123-24903145 ATAAGAAAGAGAAAGATGCCTGG - Intronic
1005664828 6:28042011-28042033 ATATGAAAGAGAAAAGGCACAGG + Intergenic
1006047541 6:31309597-31309619 CTATGAAAGGGAAAAATAACAGG + Intronic
1006560010 6:34902883-34902905 ATGTTAAAGAGAAAGGTAACCGG - Intronic
1007166975 6:39835692-39835714 CTATGAAAGAGACAGGGGCATGG + Intronic
1010678790 6:78775258-78775280 CTGTGAAAGACAAAGGGGACAGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1019455080 7:1122774-1122796 CTATGAAACAGGAAGCAGACAGG + Intronic
1020193785 7:6021180-6021202 CTATGAAAGAGAACCCTGGCTGG + Intronic
1020639553 7:10738389-10738411 AAATGAAAGAGAGAGGTCACAGG - Intergenic
1022115058 7:27253634-27253656 CTGTGTAAGAGAAAGGAGATGGG + Intergenic
1024404124 7:48958445-48958467 CTATCAAAGAGAAATGATACTGG + Intergenic
1024526082 7:50350358-50350380 CCGTGAAAGCCAAAGGTGACTGG - Intronic
1024574398 7:50752431-50752453 CTTGGAAAGAGAAAGGTGAAAGG + Intronic
1027141811 7:75662862-75662884 ATATGAAAGAGAATGGGGACAGG + Intronic
1028223025 7:88219362-88219384 CTAGGGAAGAGTAAGGTGTCCGG + Intronic
1030552952 7:110987610-110987632 CTAGGATAGAGAAAGGAGATGGG + Intronic
1030715836 7:112805826-112805848 GAATGAAAGAGAAAGATGAGAGG - Intergenic
1030796793 7:113798714-113798736 CTGTGAAAGATAAAGGGGAAAGG + Intergenic
1030935082 7:115575806-115575828 CTTTGAAAGAGAAATATGGCTGG + Intergenic
1030943784 7:115690571-115690593 CTGTGAAAGAGAAAAGAGATAGG - Intergenic
1030943906 7:115692263-115692285 CTATGAAAGATAAAAGAGATAGG + Intergenic
1031504160 7:122560029-122560051 TTAAAAAAGAGAGAGGTGACTGG + Intronic
1032760221 7:134933678-134933700 CCAAGAAAGAGAAAGGAGAGAGG + Exonic
1032964597 7:137081165-137081187 TTATGGGAGAGAAAGGTGAAGGG - Intergenic
1037033139 8:14134400-14134422 CTATGAAGGCTAAAGATGACAGG + Intronic
1038020632 8:23549596-23549618 CAATCACAGAGAAAGATGACAGG - Intronic
1038966864 8:32583387-32583409 CTATCAAAAAGAATGGAGACAGG - Intronic
1038969332 8:32614493-32614515 CTCTGAAAAAAAAAGGTGATAGG - Exonic
1039900438 8:41748389-41748411 CAATGACAGAGAAAAGTGCCAGG + Intronic
1040816956 8:51518943-51518965 ATATGAAAGACAAAAGGGACAGG + Intronic
1041555413 8:59149074-59149096 TTAAAAAAGAGAAATGTGACTGG - Intergenic
1042252153 8:66767139-66767161 ATATGAAAGACAAACTTGACCGG - Intronic
1043938264 8:86167935-86167957 CTATGAAAAAGAAAGGGGAGGGG + Intergenic
1044098955 8:88105610-88105632 CCATGAATGAGAGAAGTGACAGG - Intronic
1045348385 8:101315689-101315711 TTATGAAGGAGAAAGGAGATGGG - Intergenic
1046070353 8:109245442-109245464 CTATGACAGAGAAAAGGTACTGG + Exonic
1046623951 8:116557778-116557800 CAAAGAAAGAAAAAGATGACAGG - Intergenic
1047036675 8:120947555-120947577 CAATGAAAGAAAAATCTGACAGG + Intergenic
1047242778 8:123108091-123108113 CAATGTAAGAGAAGGGTGAAGGG - Intronic
1047691691 8:127361649-127361671 CTAGGAAAGAGTAAGCTGATGGG - Intergenic
1047711124 8:127553489-127553511 CAATCATGGAGAAAGGTGACAGG - Intergenic
1048447344 8:134501663-134501685 CTTTGAAGGGGAAAGGTGAGTGG + Intronic
1048905001 8:139079265-139079287 ATATGGCAGAGAAAGCTGACTGG + Intergenic
1050428294 9:5535036-5535058 CTCTGAAAGTCAAAGGTGAGTGG + Exonic
1055362883 9:75513108-75513130 ATATGAAGAAGGAAGGTGACTGG - Intergenic
1056716892 9:89038794-89038816 TTTTAAAAGAGAAAGCTGACGGG + Intronic
1056932195 9:90888540-90888562 CTATGTTAGAGAAAGGAGAGCGG + Exonic
1057456065 9:95212423-95212445 CTATGCAAGACAGAGGTGAATGG + Intronic
1058081156 9:100702398-100702420 ATATGAGACAAAAAGGTGACAGG + Intergenic
1058732056 9:107859750-107859772 CTAGGGAAGAGAAAGCAGACAGG - Intergenic
1059505346 9:114793767-114793789 CTAAGAAAGAGGAAGGTCATTGG - Intronic
1059635664 9:116168251-116168273 ATATGAAATAGAAGGGTGAATGG - Intronic
1061670170 9:132184160-132184182 CGATGAAAGAGTAAAGTTACTGG - Intronic
1187276938 X:17824505-17824527 CTAGGTAGGAGAAAGCTGACAGG + Intronic
1187537458 X:20156014-20156036 GGATGAAAGAGAAAGGTGCTGGG + Intronic
1189107614 X:38253903-38253925 CCATAAAAGAGAAATGTGAGGGG - Intronic
1191244160 X:58212790-58212812 CAATGAAAGAGAAACCTGGCTGG + Intergenic
1193102776 X:77634983-77635005 CTCTAAAAGAGAAACGTGGCCGG + Intronic
1193856886 X:86613394-86613416 CATTGAAATAGAAAGGTGCCAGG - Intronic
1194973013 X:100364775-100364797 CTATGAAAGAGACAGGTGAGAGG - Intronic
1195283246 X:103357304-103357326 CCAGAAAAGAGAAAGGTGGCTGG - Intronic
1196153057 X:112395545-112395567 CCCTGAAATAGAAAGCTGACAGG + Intergenic
1196166701 X:112543043-112543065 CTATGAAAGAGAAAAAGGAAGGG + Intergenic
1196578485 X:117350747-117350769 CTATGGAGGAGCAAGGTGGCAGG + Intergenic
1198491626 X:137147178-137147200 CCATGAAAGATAAAGGGGAGAGG + Intergenic
1199170035 X:144725183-144725205 ACATTAAAGAGAAAGGTGATTGG + Intergenic
1199305039 X:146257995-146258017 CATTGAAAGAGAAAGGAGAATGG + Intergenic
1199599223 X:149531875-149531897 CTTTGAAAGAGAAGGGTGGGTGG - Intronic
1201735452 Y:17255866-17255888 CTTTGAAGGAGAAAGTGGACAGG - Intergenic
1202194374 Y:22282663-22282685 CCAAGAAAGAGAAAGAAGACAGG + Intergenic
1202201087 Y:22349547-22349569 CCAAGAAAGAGAAAGAAGACGGG - Intronic