ID: 1178064503

View in Genome Browser
Species Human (GRCh38)
Location 21:28889094-28889116
Sequence TCCCTTTGGCCCCATTGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178064500_1178064503 5 Left 1178064500 21:28889066-28889088 CCCAGTTCTGCTCAGTAATCACT 0: 1
1: 0
2: 3
3: 13
4: 142
Right 1178064503 21:28889094-28889116 TCCCTTTGGCCCCATTGTAATGG No data
1178064501_1178064503 4 Left 1178064501 21:28889067-28889089 CCAGTTCTGCTCAGTAATCACTG 0: 1
1: 0
2: 3
3: 22
4: 121
Right 1178064503 21:28889094-28889116 TCCCTTTGGCCCCATTGTAATGG No data
1178064499_1178064503 6 Left 1178064499 21:28889065-28889087 CCCCAGTTCTGCTCAGTAATCAC 0: 1
1: 0
2: 5
3: 18
4: 144
Right 1178064503 21:28889094-28889116 TCCCTTTGGCCCCATTGTAATGG No data
1178064498_1178064503 30 Left 1178064498 21:28889041-28889063 CCATCTTTTGTTACTTTGGGACT No data
Right 1178064503 21:28889094-28889116 TCCCTTTGGCCCCATTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178064503 Original CRISPR TCCCTTTGGCCCCATTGTAA TGG Intergenic
No off target data available for this crispr