ID: 1178073192

View in Genome Browser
Species Human (GRCh38)
Location 21:28992176-28992198
Sequence AACTGAAGAGCGTTGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178073186_1178073192 15 Left 1178073186 21:28992138-28992160 CCTCACTGAGGTGTCGAGAGCAA 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1178073192 21:28992176-28992198 AACTGAAGAGCGTTGGGAGCCGG 0: 1
1: 0
2: 1
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178073192 Original CRISPR AACTGAAGAGCGTTGGGAGC CGG Intronic
900911093 1:5597552-5597574 AATTGAAGAGTGTTGCTAGCTGG - Intergenic
901201159 1:7468160-7468182 AACTGAGGCGCCTTGGAAGCTGG - Intronic
905969422 1:42130092-42130114 CACTGGAGAGTGTTGGCAGCAGG - Intergenic
907574683 1:55515457-55515479 AAATGAAGGGGGTTGGGAGAAGG - Intergenic
910506875 1:87959413-87959435 AACTGAAGGGAGGAGGGAGCAGG + Intergenic
911157960 1:94655177-94655199 AGCTGACTAGCGATGGGAGCTGG - Intergenic
913387911 1:118279830-118279852 AGCTGAAAAGAGTTGGGAGAGGG + Intergenic
917170756 1:172171175-172171197 AACAGAAGAGGGTTTGTAGCTGG + Intronic
919457971 1:197842462-197842484 AATTGAAGAGCTTTGGAAGGAGG - Intergenic
920311610 1:205052078-205052100 AACTTAAGAGCAGTGGGAGGGGG - Intronic
922565904 1:226601664-226601686 CAGTGCAGAGCCTTGGGAGCAGG - Intronic
1063451320 10:6152212-6152234 CACTGCAGAGCCTGGGGAGCCGG + Intronic
1063525946 10:6785557-6785579 AACTGAAGAGAGATGTGTGCAGG + Intergenic
1065678610 10:28205847-28205869 AATGCAAGAGCGTTGGGAGGTGG + Intronic
1067877496 10:50018885-50018907 CACTGCAGAGGGTTGGGTGCTGG - Intergenic
1076569000 10:131420130-131420152 AACGGAAGAGCGTTTGATGCAGG + Intergenic
1078128798 11:8594522-8594544 AACTGCAGTGAGTGGGGAGCTGG + Intergenic
1078456366 11:11478837-11478859 CACTGAAGAGAGATGGGGGCGGG + Intronic
1079582709 11:22086322-22086344 AACTGAAGAGAGCTGGGAAGTGG + Intergenic
1085391285 11:76183586-76183608 AACCGAAGGGCAGTGGGAGCTGG - Intergenic
1085643082 11:78205664-78205686 AACTGAAGGGGTTTGGAAGCAGG + Intronic
1088035419 11:105306439-105306461 ATCTGAAGAGGGTTGGGAGCAGG + Intergenic
1088118822 11:106343586-106343608 AACTGAAAAGAGTCAGGAGCAGG - Intergenic
1088551453 11:111017506-111017528 AACTGAAGAAGTTTGGGAGACGG + Intergenic
1089773408 11:120819246-120819268 CACTGAAGTTTGTTGGGAGCTGG + Intronic
1090225309 11:125068096-125068118 AAGTGAAGAGTGTTGGAGGCTGG - Intronic
1092039127 12:5368026-5368048 AACTGACCAGTGTTGGGGGCTGG - Intergenic
1092317457 12:7433061-7433083 AAATGAAGAAGTTTGGGAGCAGG - Intronic
1095601283 12:44016085-44016107 AACTGAAGGGAGTTGGGAGGAGG - Intronic
1096531500 12:52245441-52245463 GGCTGAGGAGCGTGGGGAGCTGG + Exonic
1097894042 12:64806680-64806702 TACTGAAAAGAATTGGGAGCAGG + Intronic
1099640701 12:85280201-85280223 AACTGGAGAGCGCTGGGGGAGGG - Exonic
1100082378 12:90868717-90868739 AAATGAACAGCTTTAGGAGCTGG - Intergenic
1100288055 12:93186599-93186621 AAATGAAGAGCCTTGAGAGAAGG - Intergenic
1103053310 12:117799622-117799644 AAATTAAGAGGGTTGGGATCAGG + Intronic
1106166865 13:27255121-27255143 AACTCAAGAGCTTTCAGAGCCGG - Intronic
1108779350 13:53810022-53810044 AACTGCAGAGAGATGGGAGAGGG - Intergenic
1110855404 13:80292033-80292055 AACAGAATAGCGTTGAAAGCTGG + Intergenic
1112527372 13:100164325-100164347 ACTTGAAAAGCTTTGGGAGCTGG + Intronic
1113420402 13:110166827-110166849 AACTGCAGTGCCTGGGGAGCTGG + Intronic
1118526759 14:66653081-66653103 AACTGTTGAGGGCTGGGAGCTGG + Intronic
1121561570 14:94880098-94880120 AAATGAAAAGTGTTGGGGGCAGG + Intergenic
1123673472 15:22684316-22684338 ATATGTAGAGTGTTGGGAGCAGG - Intergenic
1124325474 15:28757301-28757323 ATATGTAGAGTGTTGGGAGCAGG - Intergenic
1126534781 15:49749618-49749640 AACTGAAGGGACTTGGGAGAGGG - Intergenic
1127047074 15:55037265-55037287 AAGTGAGGAGCCCTGGGAGCTGG - Intergenic
1133862659 16:9610819-9610841 AACTGAAGTGGGTTGGGGGCTGG + Intergenic
1134370277 16:13617112-13617134 AGTGGAAGAGCGTTGGTAGCAGG + Intergenic
1135537173 16:23303062-23303084 AACTGCAGGGCGTTCGGATCTGG - Intronic
1135755184 16:25091467-25091489 AACTAAAGAGCATGGGGAGAAGG + Intergenic
1137268181 16:46885336-46885358 AACGGAAGAGGGTTGGGATGGGG + Intronic
1139591566 16:67935961-67935983 ACCTGAAGAGCGTCTGGCGCAGG + Exonic
1140589499 16:76335051-76335073 CACAGAAGAGAGTTGGGAGACGG + Intronic
1140916326 16:79497057-79497079 GACTTAAGAGAGTTGGGAGATGG - Intergenic
1141350647 16:83291961-83291983 AACTCATGACCATTGGGAGCAGG - Intronic
1142479799 17:212055-212077 ATCTGAAGAGCTTTGGAAGCTGG - Intergenic
1143724225 17:8834350-8834372 AAATGAAGAGAGATGGGAACAGG + Intronic
1144877996 17:18412306-18412328 AACTGAACAGTGTTGGCTGCGGG + Intergenic
1145067417 17:19771184-19771206 AGCTGGAAAGCGGTGGGAGCAGG - Intronic
1145154233 17:20532119-20532141 AACTGAACAGTGTTGGCTGCGGG - Intergenic
1147556520 17:41482695-41482717 AACAAAAGAGAGTAGGGAGCGGG + Intergenic
1150285139 17:63950054-63950076 ACCTGATCAGTGTTGGGAGCGGG + Intronic
1152431133 17:80248757-80248779 GACTGGAGAGCGTTGGGGACAGG - Intronic
1154121771 18:11658017-11658039 AACTGAAGTGAGTTGAAAGCAGG - Intergenic
1156788080 18:40939593-40939615 CACTGAAGAGCTATGGGAGCGGG + Intergenic
1159722518 18:71910040-71910062 ATCTGAAAAGGGTTGGAAGCAGG - Intergenic
1160790904 19:923316-923338 ACCTGCAGAGCTGTGGGAGCGGG + Intergenic
1161864374 19:6822614-6822636 AAAGGAAAAGCGATGGGAGCAGG - Intronic
1164517111 19:28945816-28945838 AAGTGCAGAGCGTAGGGAGGAGG - Intergenic
1165717624 19:38056505-38056527 AACTGACGAAGGATGGGAGCAGG - Intronic
926834646 2:17004896-17004918 AAATGAAGAGCTTTGGAAGCAGG - Intergenic
926939529 2:18120131-18120153 AACTGAAGGCAGTTGGAAGCTGG + Intronic
927110583 2:19861337-19861359 AACTGAAGAGTTCTGGGAGGAGG - Intergenic
930998817 2:57756851-57756873 AAATGGAGAGTGTTGGGAGGTGG - Intergenic
931451719 2:62372942-62372964 AGCTGGAGAGCGTTGGGAACAGG + Intergenic
932493509 2:72135531-72135553 AACAGCAAAGCCTTGGGAGCTGG + Intronic
935023871 2:99257699-99257721 CACTGAAGAGTCTTAGGAGCAGG - Intronic
940241676 2:151570072-151570094 AACTGCAGAGCGATGTGAGTGGG - Exonic
945135955 2:206627645-206627667 AAAGGAAGAGCTTTTGGAGCTGG - Intergenic
947641295 2:231709116-231709138 AACTCAAGCGCGTTGGGAATCGG + Intronic
1168820986 20:773819-773841 AAGTGAAGAGAATTGGGAGTGGG + Intergenic
1170516552 20:17136211-17136233 CCCTGAAGAGAATTGGGAGCAGG + Intergenic
1171860460 20:30397286-30397308 AAGTGACTAGCTTTGGGAGCTGG - Intronic
1172029162 20:31969174-31969196 AACTGAGGATCTTTGCGAGCAGG - Intronic
1175230620 20:57471249-57471271 AACTGCAGTGGGTTGGGAGCCGG + Intergenic
1175287984 20:57850698-57850720 AACAGGAGAGGGTAGGGAGCTGG - Intergenic
1176144099 20:63557833-63557855 CACTGCAGAGCGCTGGGCGCAGG - Intergenic
1176144121 20:63557906-63557928 CACTGCAGAGCGCTGGGCGCAGG - Intergenic
1176144143 20:63557979-63558001 TACTGCAGAGCGCTGGGCGCAGG - Intergenic
1178073192 21:28992176-28992198 AACTGAAGAGCGTTGGGAGCCGG + Intronic
1178735833 21:35149526-35149548 AACTGGACAGCCTTGGGAGGAGG + Intronic
1178878804 21:36432571-36432593 AAGTGAAGTGGGTGGGGAGCGGG - Intergenic
1179254505 21:39703576-39703598 AACTGCAAAGTGTTGGGAGATGG + Intergenic
1179544616 21:42105922-42105944 CACTGAACAGCGTGGGGAGTGGG - Intronic
1180296448 22:10941329-10941351 GACTGAGTAGCTTTGGGAGCTGG + Intergenic
1181481814 22:23204761-23204783 AAGTGCAGAGCGTGGGCAGCGGG + Intronic
1182437861 22:30342054-30342076 AACTGAAGTCTTTTGGGAGCAGG + Intronic
1182619376 22:31610505-31610527 AACAGAACAGGGTTGAGAGCAGG - Intronic
1184311646 22:43649039-43649061 CAGAGAAGAGCTTTGGGAGCTGG + Intronic
1184581629 22:45421948-45421970 AAAAGAAGTGGGTTGGGAGCAGG - Intronic
953026188 3:39146566-39146588 GACAGAAGAGCTTGGGGAGCAGG + Exonic
953471556 3:43170997-43171019 GACTGAAGAGTGTTGGTGGCTGG - Intergenic
955789231 3:62571441-62571463 AACAGAAGAGCTTTTGGAGAAGG - Intronic
958617593 3:96515263-96515285 AACTGAAGAGCTTTTGGGGCAGG + Intergenic
963506762 3:146195716-146195738 AACTGAAGCTCGTTGGTATCTGG - Intronic
964143715 3:153433541-153433563 AACTGAAAAGTCTTGGGAGAGGG - Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
966921246 3:184613075-184613097 AACTGAAGACATTGGGGAGCTGG - Intronic
968457621 4:707055-707077 ACCTGAAGAGAGTTGGGCTCTGG + Intronic
969066473 4:4485833-4485855 AAAAGGAGAGCTTTGGGAGCAGG - Intronic
979883726 4:125996659-125996681 AACTGCATAGCATTTGGAGCTGG + Intergenic
987287472 5:16471527-16471549 ATCTGAAGCACGTTGGGGGCAGG - Intergenic
987522093 5:18999951-18999973 AACAGGTGAGCTTTGGGAGCGGG + Intergenic
994582735 5:101666905-101666927 AACTGAAGTGCCTTGGGAAATGG - Intergenic
996437095 5:123446507-123446529 AACTGTAGAGGGTAGGGAGACGG + Intergenic
996518642 5:124401461-124401483 GACTGAGCAGGGTTGGGAGCAGG + Intergenic
998262357 5:140641193-140641215 ACCTGAAGAGAGTGGGAAGCTGG + Intronic
1000314197 5:160073075-160073097 AACTGAAGAGCTTGGTGAGATGG + Intronic
1000863364 5:166483641-166483663 AATTGAAGAGCGTTAGGGCCTGG + Intergenic
1005767719 6:29030095-29030117 AACTGAAAAGCTTCAGGAGCAGG + Intergenic
1005986952 6:30881573-30881595 AACTGAGGAGGCTTGAGAGCTGG - Intronic
1006110362 6:31740662-31740684 AATAAAAGAGGGTTGGGAGCCGG + Intronic
1017849351 6:158290575-158290597 AACAGAAGGGAGGTGGGAGCAGG - Intronic
1018717179 6:166542463-166542485 AACTTGAGAGCTTTGGGAGGAGG + Intronic
1022267615 7:28772473-28772495 AATGGAAGAGCGGTGGGAGAAGG + Intronic
1023684763 7:42722990-42723012 AACACAAGAGCACTGGGAGCTGG + Intergenic
1032054684 7:128674942-128674964 AAGTGTAGAGCATTGGGAGAAGG + Intronic
1032194321 7:129780618-129780640 AGGGGAAGTGCGTTGGGAGCTGG + Intergenic
1034283352 7:149868573-149868595 ATCTCAAGAGCCCTGGGAGCAGG - Intergenic
1034451389 7:151138940-151138962 AACGGAAGAGCCCTGGAAGCAGG - Intronic
1035579811 8:732306-732328 AACTGTAGAGTGATGGGCGCGGG + Intronic
1040830719 8:51674311-51674333 AGCTGAATAGCCCTGGGAGCTGG + Intronic
1041883361 8:62778896-62778918 AACTGAAGAGCCTTTGGGCCTGG - Intronic
1042598021 8:70470423-70470445 AACTCAAGAGAATTGGGAGGCGG - Intergenic
1045206514 8:100047509-100047531 AACTCAAAAGCCTTGGAAGCGGG - Exonic
1049133421 8:140870961-140870983 AACTGAAGAGGGTGGGGTGGTGG + Intronic
1057366001 9:94421779-94421801 AACTAGAGAGCTTTGGTAGCTGG + Intronic
1057657334 9:96966286-96966308 AACTAGAGAGCTTTGGTAGCTGG - Intronic
1059636340 9:116174537-116174559 TGCTGAAGAGCATTGGGAGGAGG - Intronic
1060778689 9:126395577-126395599 AACTGAACAGCATGGGGATCTGG + Exonic
1061093618 9:128441277-128441299 ACCTGCAGAGAATTGGGAGCGGG - Intergenic
1062393068 9:136341656-136341678 AACTCAAGACCTTTGGGAGTGGG - Intronic
1189758395 X:44295732-44295754 AACTGATCAGTGTTGGGAGAGGG + Intronic
1192155636 X:68744541-68744563 AAGTGAAGAGCATTAGGAGATGG + Intergenic