ID: 1178073327

View in Genome Browser
Species Human (GRCh38)
Location 21:28992951-28992973
Sequence CGGGAGGCGGGAGCGGAAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178073327_1178073335 3 Left 1178073327 21:28992951-28992973 CCCACTTCCGCTCCCGCCTCCCG 0: 1
1: 0
2: 2
3: 24
4: 427
Right 1178073335 21:28992977-28992999 TGTCCCTGACCATCCGCCACCGG 0: 1
1: 0
2: 0
3: 14
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178073327 Original CRISPR CGGGAGGCGGGAGCGGAAGT GGG (reversed) Exonic
900072235 1:779890-779912 TGGGAGGCGGAGGCGGAAGTGGG + Intergenic
900092322 1:925772-925794 CGGGAAGCGGGCTGGGAAGTCGG + Exonic
900109428 1:999305-999327 CAGCAGGCGGGAGCGCACGTCGG + Exonic
900622448 1:3593571-3593593 CGGGGGCGGGGAGAGGAAGTGGG - Intronic
901066630 1:6497424-6497446 CGGGAGGCGGGCGGGGCAGGTGG + Intronic
901469951 1:9449355-9449377 CGGGTGGCGGGGGCGGGAGGGGG + Intergenic
901496083 1:9622887-9622909 CGGGAGGCGGAAGTTGCAGTGGG - Intergenic
901632894 1:10656558-10656580 CGGCAGGCGGGGACGGCAGTGGG - Intronic
902398260 1:16144031-16144053 CGGTAGGCGGGGGCTGAGGTGGG - Intronic
902737245 1:18409237-18409259 CTGCAGGTGGGAGGGGAAGTAGG - Intergenic
903664515 1:24998057-24998079 GGGGAGGCAGGAGCAGAGGTGGG + Intergenic
903669530 1:25027289-25027311 TGGGAGGTGGGAGCGGAACAGGG + Intergenic
903974462 1:27140155-27140177 CGGGAGGGAGGAGTGGAGGTGGG - Intronic
904807472 1:33142104-33142126 TGGGAGGTGGGAGAGGAAGGTGG - Intergenic
905105584 1:35561770-35561792 GGGGAGGCAGGAGGGGATGTAGG - Intronic
905868219 1:41387852-41387874 AGGGAGCCGGGAGGGGAAGGAGG - Intergenic
906805661 1:48776872-48776894 CGCGGGGCGGGCGCGGAGGTGGG + Exonic
907689686 1:56650019-56650041 CGGGAGGCGGAAGTTGCAGTGGG + Intronic
909637269 1:77830571-77830593 GGGGAGGGGGGTGCGGAAGAGGG - Intronic
914391399 1:147226224-147226246 GGTGAGCCGGGGGCGGAAGTGGG - Intronic
915555845 1:156660237-156660259 GAGGAGGCGGGAGGGGAAGGGGG + Intergenic
916571365 1:166030742-166030764 TGTGAGGCTGGAGAGGAAGTAGG - Intergenic
916671850 1:167029242-167029264 CGGGAGACGGGAGAGGGAGAGGG - Intergenic
919075520 1:192808686-192808708 CGGAGGGAGGGAGCCGAAGTTGG - Intergenic
919915785 1:202138250-202138272 TGGGAGGAGCGAGCTGAAGTGGG - Intronic
920377845 1:205518908-205518930 AGGGAGGTGGGAGGGGAGGTTGG + Intronic
920379587 1:205527886-205527908 CGAGAGGGGGGAGCTGAAGCTGG + Exonic
920669334 1:207991205-207991227 GGGGAGGTGGGAGCGCATGTGGG + Intergenic
921207024 1:212858108-212858130 CGGGAGGCGGGGGAGGAAAGCGG - Intergenic
922208916 1:223472202-223472224 CTGGAGGCTGGGGCAGAAGTGGG - Intergenic
922267173 1:223993848-223993870 TGGGAGGCGGAGGCGGAAGCGGG + Intergenic
922799842 1:228360165-228360187 GAGGAGGCGGGAGAGGAAGAGGG + Intronic
923126777 1:231040296-231040318 CGTGGCGCGGGAGGGGAAGTGGG - Intergenic
923506784 1:234611151-234611173 CGGGAGGCGAGGGCGCGAGTGGG + Intergenic
924005261 1:239602238-239602260 CGGGAGGCTGAGGCGGAAGACGG - Intronic
1063576537 10:7266619-7266641 AGGGAGGCAGGAGCAAAAGTGGG + Intronic
1064560469 10:16590339-16590361 CGGGAGGCGGAGGTGGCAGTAGG + Intergenic
1066199008 10:33128049-33128071 AGGGAGGGGGGAAGGGAAGTGGG - Intergenic
1067509985 10:46886504-46886526 CGAGAGGTGGAAGCTGAAGTTGG + Intergenic
1067652268 10:48165354-48165376 CGAGAGGTGGAAGCTGAAGTTGG - Intronic
1068610642 10:59056565-59056587 CGGGGGGTGGGGGCGGGAGTTGG - Intergenic
1072021861 10:91410409-91410431 CGGGCGGCGGGAGCGCCAGGCGG - Exonic
1073150112 10:101305691-101305713 CGGGAGGGGGATGCAGAAGTGGG - Intergenic
1073889612 10:108084366-108084388 ATGGAGGCGGGAGAGGAAGCTGG - Intergenic
1074837920 10:117316575-117316597 CGGGAGGTGGAAGCTGAGGTGGG + Intronic
1076352927 10:129831263-129831285 TGGGAGGCAGGTGCGGGAGTGGG - Intergenic
1077105988 11:842885-842907 CGGGCGGCGCGAGCGGGAGGCGG + Intronic
1081872917 11:46391464-46391486 CGCGGGCCGGGAGCGGCAGTGGG - Intergenic
1083420094 11:62547477-62547499 CGGGAGTCTGGAGAGGAAGGTGG - Intronic
1083596486 11:63920363-63920385 CGGGAGGAGGGAGCGGCAAGGGG - Intergenic
1083846519 11:65337361-65337383 CGGGAGGCAGAAGCTGCAGTAGG + Intronic
1084163739 11:67365391-67365413 CTGGAGGCTGGTGCAGAAGTGGG + Exonic
1084192276 11:67504595-67504617 CGGAAGGCGGGCCCGGAAGGAGG - Intronic
1084688384 11:70710626-70710648 CGGGTGGCAGAAGGGGAAGTCGG + Intronic
1085754255 11:79190947-79190969 CGGGAGACGGGAGAGGGAGAGGG - Intronic
1086427498 11:86700473-86700495 TGGGAGGTGGGAGGGGAACTGGG + Intergenic
1087076981 11:94134643-94134665 AGGGAGGGGGGAGAGGAAGAGGG - Intronic
1087713525 11:101582535-101582557 TGGGTGGCGGGAGGGGAGGTAGG - Intronic
1088819727 11:113447122-113447144 TTGGAGGCTGGAGCAGAAGTGGG - Intronic
1089496132 11:118909544-118909566 CTGGAGGTGGGAGCTGGAGTAGG - Intronic
1089625595 11:119748894-119748916 GTGGAGGTGGGAGAGGAAGTGGG + Intergenic
1089954434 11:122556809-122556831 TGGGAGGCGCGAGCGGGAGCCGG + Intergenic
1091000982 11:131910736-131910758 CGGGCGGCGGGAGCGGACCGCGG - Intronic
1092784912 12:12018035-12018057 CAGGAGGAAGGAACGGAAGTTGG + Intergenic
1093653974 12:21674411-21674433 CGAGAGGCGCGAGCAGAACTGGG - Intronic
1093685196 12:22046599-22046621 CGGGGGTCGGGAGAGGGAGTCGG + Intronic
1096643955 12:53018063-53018085 CGGGAGGCGGCAGTTGCAGTGGG - Intronic
1096977503 12:55707900-55707922 GAGGAGGCGGGAGCCGGAGTGGG - Intronic
1097223094 12:57461766-57461788 GGGAAGGCGGGACCGGGAGTAGG + Intronic
1098066421 12:66622276-66622298 ATGGAGGAGGGAGAGGAAGTGGG + Intronic
1099904592 12:88757201-88757223 AGGGAGGAGGGAGGGGAAATAGG - Intergenic
1100137706 12:91573972-91573994 CGGGAGGCTGTAGCGGAAAGGGG + Intergenic
1100726254 12:97412154-97412176 CGGGGGGTGGGAGTGGAGGTTGG - Intergenic
1101036943 12:100716202-100716224 AGGCAGGCGGAAGCGGAGGTTGG + Intergenic
1101910566 12:108857654-108857676 CGGGAGGCGGGAGCTGGGGGCGG - Intergenic
1102201280 12:111059600-111059622 GGGGAGGTGGGAGATGAAGTGGG + Intronic
1102379170 12:112448958-112448980 CGGGAGGCGGAAGTTGCAGTCGG - Intronic
1102574167 12:113845324-113845346 TGGGAGCTGGGAGCGGGAGTTGG - Intronic
1102814617 12:115854665-115854687 TGGGAGGCGGGAGGGGATGGGGG - Intergenic
1103348995 12:120270033-120270055 CGGGAGGCGGAAGTTGCAGTGGG + Intergenic
1103373848 12:120439867-120439889 GGGGAGGGGGAAGCGGGAGTGGG - Intronic
1103699054 12:122838781-122838803 AGGGAGGCAGGAGAGGAGGTCGG + Intronic
1104977763 12:132559938-132559960 CGGGAGGCGGGAGCGCGGGCGGG - Intronic
1105363607 13:19744032-19744054 CGGGAGGCGGAGGCTGCAGTGGG + Intronic
1105890309 13:24677889-24677911 GGGGAGCGGGGAGGGGAAGTGGG - Intergenic
1106241949 13:27920072-27920094 CGGGAGTCGGGAGCTGGAGCCGG - Exonic
1107737895 13:43417235-43417257 CGGGAGACGGGAGAGGGAGAGGG + Intronic
1107953541 13:45486332-45486354 CGGGAGACGGGAGAGGGAGAGGG + Intronic
1108408022 13:50124341-50124363 CGGGCGGCGGGAGAAGCAGTCGG + Intronic
1110436393 13:75481854-75481876 CGGGAGCCCGGTGCGGCAGTTGG - Exonic
1111048397 13:82846690-82846712 AGGGAGGCGGGAAGGGAGGTAGG + Intergenic
1112278163 13:98039779-98039801 CGGGAGGCGGAGGCTGCAGTGGG + Intergenic
1113654209 13:112057955-112057977 CGGAAAGAGGGAGCGGAAGCGGG - Intergenic
1113828835 13:113278299-113278321 CTGGAGGCGGGAGCTGCAGTGGG - Intergenic
1114084019 14:19225343-19225365 CGGGAGGTGGAGGCGGCAGTGGG - Intergenic
1115500481 14:34045197-34045219 TGGGAGGCGGAGGCTGAAGTGGG - Intronic
1115608227 14:35026867-35026889 CGGGAGGCGGGGGTTGCAGTGGG + Intronic
1115851229 14:37591935-37591957 GCGGGGGCGGGAGCGGAAGCGGG - Exonic
1116919760 14:50560539-50560561 CGGGAGGGGGGTGGGGAAGAAGG - Intronic
1117252899 14:53953579-53953601 CGGGCGGCGGGCGCGGAGGTTGG - Intronic
1118035062 14:61857612-61857634 CAAGAGGCTGGAGGGGAAGTGGG + Intergenic
1119442860 14:74640485-74640507 CGGGAGGCAGGAGAGGAAAGAGG - Intergenic
1119759400 14:77140639-77140661 CGGGAGGCGGGCGCGAAGGGGGG - Intronic
1119783662 14:77296458-77296480 CAGGAGGCGGGGGAGTAAGTGGG - Intronic
1121182824 14:91942351-91942373 GAGGAGGTGGGAGAGGAAGTGGG - Intronic
1121274378 14:92657721-92657743 CGGGAGGTGGGCGTGGAAGGAGG + Intronic
1122532479 14:102438222-102438244 CGGGAGCAGGGAGCGGGAGCAGG - Intronic
1122837303 14:104436538-104436560 CGGGAGGCTGGAGGCTAAGTAGG - Intergenic
1122902163 14:104786455-104786477 CGGGAGGAGGGAGGGGCTGTGGG - Intronic
1122904565 14:104795801-104795823 CGGGCGGCGGAGGCGGATGTGGG - Intergenic
1124816740 15:33001560-33001582 GGGGAGGTGGGGGGGGAAGTGGG - Intronic
1125020395 15:34979649-34979671 GGGGAGGCGGGAGGGATAGTAGG - Exonic
1125597079 15:40894128-40894150 AGAGAGGCGGGAGCGGGAGCTGG + Intergenic
1127427110 15:58867448-58867470 TGGGAGGCGGGAGCAGAGGAGGG - Intronic
1127427161 15:58867768-58867790 AGGGAGACGGAAGCAGAAGTTGG - Intronic
1128374786 15:67066728-67066750 CGGGAGGCGGCGGCGGAGGAGGG - Intronic
1129716263 15:77852849-77852871 GGAGAGGCAGGAGCGGGAGTGGG + Intergenic
1131098982 15:89673445-89673467 CGGGAGGCTGGAGAGGGAGGTGG - Intronic
1131239926 15:90730521-90730543 CGGGAGGCGGAAGTTGCAGTGGG - Intronic
1132915983 16:2344268-2344290 CGGGAGGCGGAGGCTGCAGTGGG - Intergenic
1133828852 16:9303138-9303160 CGGGTGGCGGGGGAGGAGGTGGG + Intergenic
1133832132 16:9333042-9333064 AGGGAGGCAGGAGAGTAAGTTGG - Intergenic
1135314664 16:21434364-21434386 CGGGAGGTGGAAGCCGCAGTGGG + Intronic
1135367587 16:21866644-21866666 CGGGAGGTGGAAGCCGCAGTGGG + Intronic
1135444227 16:22504518-22504540 CGGGAGGTGGAAGCCGCAGTGGG - Intronic
1136318278 16:29466581-29466603 CTGGAGGCGGGACCTGAGGTGGG + Exonic
1136324777 16:29514839-29514861 CGGGAGGTGGAAGCCGCAGTGGG + Intergenic
1136432853 16:30205930-30205952 CTGGAGGCGGGACCTGAGGTGGG + Exonic
1136439462 16:30254824-30254846 CGGGAGGTGGAAGCCGCAGTGGG + Intergenic
1137797636 16:51235715-51235737 AGGGAAGAGGGAGCTGAAGTCGG - Intergenic
1139470268 16:67174605-67174627 CGGTAGCCTGGGGCGGAAGTGGG - Exonic
1139632764 16:68240340-68240362 CGGGAGGCGGAAGTTGCAGTGGG - Intergenic
1139754541 16:69132269-69132291 CGGGAGGGCGGCGCGGAGGTGGG - Intronic
1140472212 16:75222318-75222340 CTGGTGGCGAGAGGGGAAGTGGG - Intronic
1141156202 16:81598893-81598915 CGGGAGGCGGGGGTTGCAGTGGG + Intronic
1141190414 16:81820692-81820714 TGGGAGGCGGAAGCTGCAGTGGG - Intronic
1141225766 16:82113559-82113581 CGGGAGGCGGAGGCTGCAGTGGG - Intergenic
1141417336 16:83886144-83886166 CGGGAGGAGGAAGCAGAAGGAGG + Intergenic
1141517267 16:84553941-84553963 CTGGAGGCAGGTGCGGAGGTAGG - Intronic
1142586582 17:978639-978661 GGGGAGGCGGGGGCGGGAGACGG + Intronic
1142836700 17:2593239-2593261 CGGGAGGCGCGAGAGGCAGCGGG - Intronic
1142836770 17:2593542-2593564 CGGGCGCCGGGAGCGGAGGAGGG - Intronic
1145158225 17:20556880-20556902 CGGGAGACGGGAGAGGGAGAGGG - Intergenic
1146229526 17:31095389-31095411 CGGGAGGTGGGAGCGGAGTGGGG + Intronic
1146398536 17:32486897-32486919 CCGGAAGCGGGAGCGGGAGCGGG + Exonic
1146445491 17:32929436-32929458 CGGGAGACGGGAGCAGCAGAGGG + Intronic
1147235905 17:39057350-39057372 CGGGAGGCGGATGCTGCAGTGGG - Intergenic
1148838645 17:50480010-50480032 CTGGAGCCCGGAGCTGAAGTAGG - Exonic
1150654918 17:67033252-67033274 CGGGAGGAGGGAGAGAAGGTGGG - Exonic
1151322762 17:73361516-73361538 CGGGAGGAGGGAGCGGGGGGAGG + Intronic
1151451695 17:74201979-74202001 GGGGAGGCGGGAGCTGAGCTCGG + Intergenic
1151732241 17:75918274-75918296 GGGGAGGCGGGAGGGGAAGGCGG + Intronic
1152069826 17:78128902-78128924 CAGGAGGAGGGGTCGGAAGTTGG - Intronic
1152080205 17:78182533-78182555 CGGGAGGACAGAGCGGAAGCTGG + Intronic
1152352897 17:79793215-79793237 GGGGAGGGAGGAGCGGGAGTTGG - Exonic
1152425581 17:80216902-80216924 CTGGAGGTGGGAGGGAAAGTGGG + Intronic
1152552051 17:81034926-81034948 AGGGGGGCGGGATCGGAGGTGGG - Intergenic
1152762959 17:82119084-82119106 CGGGAGGTGGGGGCGGGGGTGGG + Intronic
1153284821 18:3448275-3448297 GGGGAGCCGGGAGCGGAGGGAGG - Intronic
1156075658 18:33275678-33275700 GGGGAGGAGGGAGGGGAAGCGGG + Intronic
1156277122 18:35594088-35594110 CGGGGGGCGGGGGCAGGAGTAGG + Intronic
1157464279 18:47930740-47930762 CGGAGGGCGGAAGCGGAGGTGGG - Intronic
1157618785 18:49003369-49003391 GGGGAGGAGGGAGAGGAGGTGGG - Intergenic
1158435625 18:57434161-57434183 CTGGAGGTGGGAGTGGAACTGGG - Intergenic
1158582098 18:58692470-58692492 GGGGAGGTGGGAGAGGAAGAGGG - Intronic
1158955064 18:62529731-62529753 TGGGAGGCGGGAGCGGGTGCTGG + Intronic
1160141933 18:76332132-76332154 GGGGAAGGGGGAGGGGAAGTAGG + Intergenic
1160185685 18:76674713-76674735 CTGCAGGCTGGAGGGGAAGTGGG + Intergenic
1160204718 18:76822918-76822940 CGGGAGGCGGGTGAGGGAGCAGG + Intronic
1160597821 18:79989186-79989208 CGGGAGGCGGAGGCTGCAGTGGG - Intronic
1160835434 19:1122617-1122639 CAGGGGGCGGGAGCGGGGGTGGG - Intronic
1161025632 19:2035433-2035455 CTGGAGGCGGGAGCGGAAGGAGG - Intergenic
1161150076 19:2702798-2702820 CGGGAGGCCGGAGCGGGGGCGGG + Intergenic
1161324246 19:3655867-3655889 CGGGAGGGGGGAGTAGGAGTAGG - Intronic
1161898255 19:7098995-7099017 CGGGTGGTGGGAGCCGAGGTCGG + Intergenic
1162125717 19:8498593-8498615 CGGGTGCCGGGAGCTGAAGCCGG + Exonic
1162728949 19:12706166-12706188 CGGGAGGCGGGAGCCGCTCTGGG + Intronic
1162925111 19:13926948-13926970 AGGAAGGAGGGAGAGGAAGTTGG - Intronic
1163513528 19:17749454-17749476 CAGGAGGAGGGAGGGGAAGGGGG + Intronic
1164576063 19:29405873-29405895 GGGGAGGCAGCAGCGGACGTGGG - Intergenic
1166144541 19:40825024-40825046 TGGGAGGCGGGACTGGAGGTGGG + Intronic
1166303828 19:41926711-41926733 CGGGAGGGGGGAGCGGGCGGGGG + Intronic
1166677248 19:44747673-44747695 CTCGAGGTGGGAGGGGAAGTCGG + Intergenic
1166731885 19:45064038-45064060 CGGGGAGCGGGAGCGGGAGCGGG - Exonic
1166882981 19:45940291-45940313 CGGGAGGCGGGGGCGGCGGCGGG + Exonic
1166958285 19:46480634-46480656 CGGGAGGCGGGGGTGGTGGTCGG + Intergenic
1167087437 19:47320019-47320041 CGCCAGGCAGGAGAGGAAGTCGG - Exonic
1167454428 19:49591169-49591191 GGGGAGGGGGGAGGGGAAGGGGG - Intergenic
1167641811 19:50686601-50686623 CGGGCGGAGGGAGGGGAGGTGGG + Intronic
1167643751 19:50695177-50695199 CGGGAGGGGGGAGGGGGAGGGGG + Intronic
1167743877 19:51339991-51340013 TGAGAGGCTGGAGCGGGAGTAGG - Intronic
1168352675 19:55685692-55685714 CGGGTGCCGGGAGCCGCAGTAGG - Intronic
925891508 2:8438653-8438675 CGGTTAGCGGGAGGGGAAGTGGG - Intergenic
925927616 2:8681738-8681760 CGGGAGGAGGGAGAGGAGGAGGG - Intronic
927717270 2:25360836-25360858 CGGGTGGCGGGAGGGCAGGTGGG - Intergenic
927972937 2:27317004-27317026 CGGGAAGAGGGTGTGGAAGTTGG - Intronic
928132254 2:28661022-28661044 TGGGAGGCGGAGGCGGAGGTGGG + Intergenic
929206362 2:39298889-39298911 CGGGAGGCGGAGGTTGAAGTGGG + Intronic
929313557 2:40452113-40452135 CGGGAGGCAGGCGCGGAGGCCGG + Intronic
929778342 2:44942235-44942257 CGGGAGGCGGCAGCGGCGGCGGG + Exonic
929878124 2:45814031-45814053 GGGGAGGGGGGACCGGAGGTGGG - Intronic
930177331 2:48314557-48314579 CGGGAGGCGGGACTGGAGGGAGG + Intergenic
931751859 2:65338155-65338177 CGGGAGACGGGAGAGGGAGACGG - Intronic
932036705 2:68252810-68252832 CTGGAGGCGGGCGGGGAAGAAGG + Intronic
932406131 2:71513577-71513599 AGGGAGGAGGGAGAGGAAGAGGG + Intronic
932699843 2:73985044-73985066 CGGGAGGCGGGAGCCCCAGGCGG + Intergenic
932740880 2:74290305-74290327 AGGGAGGCAGCAGCGGAAGCAGG - Intronic
933750988 2:85602105-85602127 CGGGAAGGGGGAGGGGAAGGGGG + Exonic
934655865 2:96116607-96116629 CTGGAGGCGGGCGCGGGAGCGGG + Intergenic
934942430 2:98512284-98512306 GGGGAGGAGGGATCTGAAGTGGG + Intronic
935301536 2:101697655-101697677 CGGGAGGCGGAGGCGGAGGCGGG - Intronic
936278521 2:111119899-111119921 GGGGAGGCGGGAGGGGAGGAGGG + Intronic
938322972 2:130377567-130377589 TGGGAGGCAGGAGAGGAGGTGGG - Intergenic
938451479 2:131425109-131425131 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451484 2:131425122-131425144 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451489 2:131425135-131425157 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451494 2:131425148-131425170 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451499 2:131425161-131425183 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451504 2:131425174-131425196 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451509 2:131425187-131425209 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451514 2:131425200-131425222 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451519 2:131425213-131425235 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
939629687 2:144516960-144516982 CGGGAGGCGGAGGCGGAGGGAGG + Intronic
942806886 2:179941232-179941254 TGGGTGGCGGGAGGGGAAGGTGG + Intergenic
943367200 2:186977609-186977631 TGGGAGGAGTGAGCAGAAGTGGG + Intergenic
944970135 2:204983402-204983424 GGGGAGTCGGGAGAGGAAGGGGG + Intronic
945080566 2:206084484-206084506 TGGGAGGAGGGAGAGGAAGTGGG - Intronic
945245204 2:207711518-207711540 CGGTAGGCGGCGGCGGAAGGAGG + Intronic
946190170 2:218003770-218003792 GGGGAGGAGGGGGAGGAAGTGGG - Intergenic
946692597 2:222320230-222320252 GGGGAGGCGGGAGGGGGAGGCGG - Intergenic
947877792 2:233479487-233479509 CGGGAGGCGGAGGTTGAAGTGGG + Intronic
948610239 2:239162146-239162168 TGGGAGGCTGCAGCGGGAGTTGG - Intronic
948832077 2:240603117-240603139 CGGGAGGCGGGAGCACTGGTAGG - Intronic
948939035 2:241187179-241187201 CGGGAGGCAGGAGGGGAGGGAGG - Intergenic
1170629980 20:18057651-18057673 CGGGAGGAGGGGGCCGCAGTCGG - Exonic
1170664707 20:18376290-18376312 CGGGAGACGGGAGGGGGAGGGGG + Intergenic
1171343933 20:24451841-24451863 CGGGAGGTAGCAGAGGAAGTTGG - Intergenic
1171480354 20:25450707-25450729 CGGGAGGCTGAAGCGGGAGTTGG + Intronic
1171567330 20:26208081-26208103 CGGGCGGCGGGCGGGGAAGGGGG + Intergenic
1172144583 20:32747299-32747321 CGGGAGGCGGAAGTTGCAGTGGG + Intergenic
1172161842 20:32874294-32874316 CGGGAGGCAGAGGCTGAAGTTGG - Intronic
1172841046 20:37903026-37903048 CGGGAGGAGGGAGGGGAGGAGGG + Intergenic
1173575432 20:44110336-44110358 GGGGAGGTGGGAGTGGAAATGGG - Intergenic
1174217749 20:48930183-48930205 CGGAAGGCGAGAGAGGAAATGGG + Intronic
1175452787 20:59084180-59084202 CGTGAGGCGGGAGATGAGGTGGG + Intergenic
1175885661 20:62289065-62289087 TGGAAGACGTGAGCGGAAGTAGG + Intronic
1176057147 20:63154850-63154872 CGGGAGGAGGGAGGGAAAGGGGG - Intergenic
1176306835 21:5128109-5128131 GGGGCGGCGGGAGCGGACCTAGG + Intronic
1176547517 21:8208199-8208221 CGGGCGGCGGGCGGGGAAGAGGG - Intergenic
1176555426 21:8252408-8252430 CGGGCGGCGGGCGGGGAAGAGGG - Intergenic
1176566468 21:8391246-8391268 CGGGCGGCGGGCGGGGAAGAGGG - Intergenic
1176574344 21:8435433-8435455 CGGGCGGCGGGCGGGGAAGAGGG - Intergenic
1176610956 21:8986725-8986747 CGGGCGGCGGGCGGGGAAGAGGG - Intergenic
1177605240 21:23369212-23369234 CAGGAGGCGGAAGTGGTAGTGGG + Intergenic
1178073327 21:28992951-28992973 CGGGAGGCGGGAGCGGAAGTGGG - Exonic
1178177730 21:30123724-30123746 TGGGAGGCTGGAGGGGAGGTAGG - Intergenic
1178914485 21:36699052-36699074 CCGGAGGGGGGAGCGGGAGGGGG - Intergenic
1179624741 21:42642565-42642587 TGGGAGTCGGGAGCAGGAGTTGG - Intergenic
1179850222 21:44133921-44133943 GGGGCGGCGGGAGCGGACCTAGG - Intronic
1180034071 21:45234274-45234296 CGGCAGGCGGAAGCGGCAGGCGG + Intergenic
1180034074 21:45234287-45234309 CGGCAGGCGGAAGCGGCAGGCGG + Intergenic
1180064848 21:45407030-45407052 CAGGAGGCTGAAGCGGAAGCAGG + Intronic
1180138716 21:45877919-45877941 CGGGAGGCGGCAGTGGGAGCAGG + Intronic
1180155856 21:45977223-45977245 TGGGAGGAGGGAGAGGAAGAAGG - Intergenic
1180293955 22:10867860-10867882 CGGGAGGTGGAGGCGGCAGTGGG + Intergenic
1180496761 22:15897275-15897297 CGGGAGGTGGAGGCGGCAGTGGG + Intergenic
1181115195 22:20628280-20628302 CGGGAGGCGGAAGTTGCAGTGGG + Intergenic
1182074704 22:27487820-27487842 CAGGGGGCAGGAGTGGAAGTTGG - Intergenic
1182550948 22:31100488-31100510 AGGGAGGCGTGAGAGGAGGTGGG - Intronic
1183359024 22:37373825-37373847 TGGGAGGCGGCAGCAGCAGTGGG - Exonic
1183715023 22:39528491-39528513 CAGGAGGCGGAAGCGGAGGCAGG - Intergenic
1184109920 22:42388639-42388661 CGGGAGGCGGGAGGGAAGGAGGG + Intronic
1184510501 22:44930544-44930566 CGGGAGGCGGGACAGGAGGGTGG + Intronic
1185078260 22:48694825-48694847 CGGGGGGTGGGGGCGGAGGTCGG - Intronic
1185091639 22:48778851-48778873 GGGGAGGCGAGGGCAGAAGTGGG + Intronic
1185123875 22:48993144-48993166 GGGGAGGAGGGAGGGGAAGAAGG - Intergenic
1203252390 22_KI270733v1_random:124484-124506 CGGGCGGCGGGCGGGGAAGAGGG - Intergenic
1203260447 22_KI270733v1_random:169570-169592 CGGGCGGCGGGCGGGGAAGAGGG - Intergenic
951217827 3:20040850-20040872 CGGGAGGCGGAGGTGGAAGCGGG - Intronic
951611259 3:24494881-24494903 CGGGAGGAGGGGGCGGAGGAGGG - Intronic
953084708 3:39655258-39655280 CGGGAGGAGGGAGAGGGAGAGGG - Intergenic
953589927 3:44241902-44241924 CCGGGGCCGGAAGCGGAAGTGGG - Exonic
954316336 3:49803672-49803694 CGGGAGGAGAGAGTGGAAGGGGG + Intronic
954858111 3:53664187-53664209 AGGGAGGTGGGAGGGGAAGGGGG - Intronic
956017452 3:64898542-64898564 CAGGAAGAGGGAGAGGAAGTTGG + Intergenic
956425267 3:69127966-69127988 CTGGAGTGGGGAGGGGAAGTGGG + Intergenic
956655896 3:71550089-71550111 CTGGAGGCGGGAGGGTGAGTGGG - Intronic
957592526 3:82218849-82218871 CTGGAGGCAGGAGCAGAAGATGG - Intergenic
958847551 3:99283081-99283103 CCAGAGGCGGGAGGGGTAGTCGG + Intergenic
959866170 3:111273013-111273035 CGGGAGGCGGAGGCGGGAGGTGG - Intronic
959866173 3:111273020-111273042 CGGGAGGCGGGAGGCGGAGGCGG - Intronic
960535017 3:118805963-118805985 CTGGAGGTGGGAGAGGAATTAGG - Intergenic
960681927 3:120257535-120257557 TGGGAGGTGGGAGGAGAAGTGGG + Intronic
961219252 3:125187014-125187036 CAGGAGGCGGGAGTGGCAGAGGG + Intronic
961555252 3:127692691-127692713 GGGTTGGCGGGAGTGGAAGTCGG - Intronic
962134951 3:132722773-132722795 CGGGACGGGGCAGCGGAACTGGG + Intergenic
962305949 3:134286244-134286266 GGGGTGGGGGGAGGGGAAGTTGG + Intergenic
962318774 3:134374595-134374617 CGGGAGGAGGGAGCGGGAGAAGG - Intronic
962623259 3:137199381-137199403 CGGGAGACGGGAGAGGGAGAGGG + Intergenic
964753545 3:160074526-160074548 CGGGAGGGGTGAACAGAAGTGGG + Intergenic
965266132 3:166546308-166546330 AGGGAGGAAGGAGCAGAAGTTGG + Intergenic
965348848 3:167588079-167588101 GGGGAGGTTGGAGAGGAAGTGGG - Intronic
965768751 3:172158867-172158889 AGGGAGGAGGGAGAGGAAGAGGG - Intronic
966617376 3:181926671-181926693 CGGGAGACGGGAGAGGGAGAGGG + Intergenic
966912828 3:184568987-184569009 CGGGAGGAGGGAGCGGAGGGAGG - Intronic
967316018 3:188153205-188153227 CTGGAGGCGGGAACCCAAGTGGG + Intergenic
967493657 3:190120434-190120456 CGGGGGGCGGGGGCGGGAGCGGG + Exonic
967978858 3:195053115-195053137 TGGGAGGTGGGAGCGGGAGGTGG - Intergenic
968006524 3:195246893-195246915 CAGGAGGCTGGAGCGGCAGGTGG - Intronic
968092991 3:195909631-195909653 GGGGAGGCGGGCGCGGGACTCGG - Intronic
968483356 4:847010-847032 CGGGAGGCGGAGGCGGAGGCAGG - Intergenic
969258938 4:6021696-6021718 GGGGAAGCTGGAGCTGAAGTGGG + Intergenic
969448541 4:7259632-7259654 CGGGAGGCAGGAGGGGAGGCGGG - Intronic
969869058 4:10093533-10093555 CGGGTGACGGGAGAGGCAGTTGG - Intronic
970192512 4:13529599-13529621 CGGGAGGAGGCAGCCGGAGTCGG + Intergenic
971665316 4:29475973-29475995 TGGGTGGCTGGAGGGGAAGTGGG + Intergenic
972693838 4:41425418-41425440 CGGGAGGCGGGGGTTGCAGTGGG - Intronic
972741682 4:41893204-41893226 AGGGAGGTGGGAGGGGAATTGGG - Intergenic
975072016 4:70153382-70153404 AGGGAGGAAGGAGAGGAAGTGGG - Intronic
975139102 4:70902344-70902366 CAGGGGGAGGGGGCGGAAGTGGG - Intronic
975556772 4:75673178-75673200 CGGGCGCCGGGAGGGGAGGTCGG - Intronic
975625887 4:76346634-76346656 CGGGAGGCGGAGGTGGCAGTGGG + Intronic
975653089 4:76614158-76614180 CGGGAGGCTGAAGCGGGAGAAGG - Intronic
976236347 4:82901015-82901037 CGGGGCGTGGGAGCGGAATTGGG + Intronic
977422769 4:96824116-96824138 AGGAAGGAGGGAGGGGAAGTTGG - Intergenic
980075410 4:128288278-128288300 CGGGCGGGGGGAGCGCAAGGAGG - Exonic
980128185 4:128793325-128793347 CGGGAGGCGGAAGTTGCAGTGGG - Intergenic
980129157 4:128802833-128802855 GGGGAGGCGGGAGAGGAAGCAGG - Intergenic
980130446 4:128811866-128811888 CTGGGGGCGGGAGCGGGAGCGGG + Intronic
981562602 4:146063969-146063991 AGGGATGAGGGAGCAGAAGTAGG - Intergenic
982660639 4:158202154-158202176 CTGGAGGAGGGAGTGGGAGTGGG - Intronic
985203213 4:187505631-187505653 GGAGAGGCGGGAGCGGAAACTGG + Intergenic
985403910 4:189617005-189617027 GGAGAGGCGGGAGCGGAAACTGG - Intergenic
987919759 5:24264516-24264538 TGGGAGGCGGCAGGGGTAGTGGG - Intergenic
989099190 5:37808692-37808714 GGGGAGGCGGGTGGGGAGGTCGG - Intergenic
989381970 5:40817905-40817927 CAGGAGGCGGGGGCTGCAGTGGG + Intergenic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
990557647 5:56951904-56951926 CGGGGGGCGGGAGCGGGCGCGGG - Intronic
992204213 5:74414449-74414471 AGGGAGGGGGCAGAGGAAGTAGG + Intergenic
992812862 5:80407526-80407548 CGGGAGGAGGAAGGGGAAGCGGG + Intergenic
992907058 5:81357007-81357029 AGGGAGGCGGGAGAGGAAGAAGG - Intronic
994475053 5:100257147-100257169 CAGGGGGAGTGAGCGGAAGTGGG - Intergenic
995052719 5:107724732-107724754 CGGGAGGCGGCAGCGGTGGCGGG - Intergenic
995531956 5:113100543-113100565 CGGGAGGCGGGGGTTGCAGTGGG - Intronic
996159720 5:120147390-120147412 CGGGAGACGGGAGAGGGAGAGGG - Intergenic
997541916 5:134669998-134670020 TGGGAGGCGGAAGCTGCAGTGGG - Intronic
998046274 5:138989587-138989609 CGGAAGGAGGGAGGGGAAGAAGG + Intronic
999241130 5:150128046-150128068 CGGGAGGAGGGAGGAGAAGAGGG - Intronic
1002071606 5:176681709-176681731 TGGGAGGCGGGACAGGAAGAGGG - Intergenic
1002204672 5:177554328-177554350 CTGGAGGCGGGAGCGGGTGCAGG - Exonic
1003042413 6:2700411-2700433 CCGGAGGCGACAGAGGAAGTGGG - Intronic
1004347016 6:14857836-14857858 CTGAAGGCGGGGGTGGAAGTGGG - Intergenic
1005078653 6:21934596-21934618 CGGGAGGCGGAGGTTGAAGTGGG - Intergenic
1005682346 6:28218981-28219003 GGGGCGGGGGGAGCGGAAGAAGG + Intergenic
1006180398 6:32150544-32150566 CGGGCGGCGGCGGGGGAAGTGGG + Exonic
1007108191 6:39297636-39297658 CAGGAGGTGGGAGGGGGAGTGGG - Intergenic
1010865844 6:80975782-80975804 TTGGAGGCGGGAGCTTAAGTGGG + Intergenic
1012132844 6:95518918-95518940 CGAGAGGCGGGTGGGGAGGTGGG + Intergenic
1013575739 6:111482711-111482733 CGCGGGGCGGGAGCGGGAGTCGG - Intronic
1015169496 6:130236455-130236477 CGGGAGGCGGGGGTTGCAGTGGG - Intronic
1016601585 6:145867515-145867537 CGGGAGGCTGAAGCTGCAGTGGG + Intronic
1016726259 6:147372506-147372528 CGGGAGGCGGAAGTTGCAGTGGG - Intronic
1016993438 6:149944922-149944944 CGGGAGGTGGGAGAGGGTGTGGG - Intronic
1017004895 6:150022608-150022630 CGGGAGGTGGGAGAGGGTGTGGG + Intronic
1017182291 6:151564914-151564936 GGGGAGGCGGTAGCTGCAGTGGG + Intronic
1018017847 6:159727716-159727738 CGGCTGGCGGGAGCGGACGCGGG + Intronic
1018388707 6:163327332-163327354 CGCATGGCGGGAGGGGAAGTGGG - Intergenic
1018430346 6:163716851-163716873 CAGAAGGCGGAAGGGGAAGTGGG + Intergenic
1019609348 7:1929136-1929158 GGGGAGGAGGGAGGGGAAGATGG - Intronic
1022056636 7:26742407-26742429 AGGGAGAGGGGAGAGGAAGTGGG + Intronic
1022548159 7:31208593-31208615 CAGGAGGCGGTGGTGGAAGTTGG - Intergenic
1023034596 7:36119315-36119337 CTGGAGGTGGGTGTGGAAGTTGG + Intergenic
1024028357 7:45433341-45433363 AGGGAGGAGGGAGAGGAAGGAGG - Intergenic
1024068640 7:45767837-45767859 TGGGAGGCGGAGGCGGAAGCGGG - Intergenic
1026155407 7:67821667-67821689 CGGGAGGTGGAAGCTGCAGTGGG - Intergenic
1026982611 7:74535678-74535700 TGGGAGGCGGGACCGGAACTGGG - Intronic
1027266410 7:76497399-76497421 CGGGAGGCGGGAGGGCTGGTGGG - Exonic
1027317790 7:76995517-76995539 CGGGAGGCGGGAGGGCTGGTGGG - Intergenic
1032337973 7:131043714-131043736 CGGGAGGCGGAGGCTGTAGTGGG + Intergenic
1034418770 7:150978340-150978362 CGGGAGGCGGGGGCCGGAGCCGG - Intergenic
1034435046 7:151059525-151059547 GGGGAGGCGGGAGCGGGGGCCGG - Intronic
1034447133 7:151119541-151119563 CAGGAGGCGGGAGCCGGAGGTGG - Intronic
1034696457 7:153058513-153058535 AGGAAGGCGGAAGAGGAAGTGGG - Intergenic
1034958461 7:155350318-155350340 AGGAAGCCGGGAGCGGAAGTCGG - Intergenic
1035284180 7:157795753-157795775 CGGGAGGCGGGAGGTGGAGGAGG + Intronic
1035705305 8:1670349-1670371 TGGGAGCTGGGAGCGGAAGAGGG - Intronic
1036848357 8:12185059-12185081 GAGGTGGCGGGAGCGGCAGTCGG - Intronic
1037098026 8:15008729-15008751 GGGGAGGAGGGAGGGGAAGAGGG + Intronic
1037788825 8:21919404-21919426 CGGCAGGCGGGCGCTGGAGTGGG - Intergenic
1038702484 8:29861726-29861748 TGGGATGCGGAAGGGGAAGTTGG + Intergenic
1040431018 8:47342408-47342430 CGGGAGGCGGAGGCTGCAGTGGG - Intronic
1041045024 8:53880533-53880555 CGGGAGGAAGGAGCGGGGGTGGG - Intronic
1041690153 8:60679656-60679678 CGGGGGGCGGGGGCGGGAGGCGG - Intronic
1042190281 8:66178827-66178849 TGGGAGGAGGAAGGGGAAGTGGG + Intergenic
1043486095 8:80700862-80700884 GGGGAGGGGGGAGTTGAAGTGGG - Intronic
1043910955 8:85863496-85863518 CGAGAGTGGGGAGCAGAAGTAGG - Intergenic
1043965809 8:86473690-86473712 CGGGAGGCGGAGGCTGCAGTGGG + Exonic
1044302916 8:90606456-90606478 CGGGAGGCGCGGGCGGGAGCCGG - Intergenic
1044591601 8:93917774-93917796 GGGGAGGCGGGAGCGGAGGAGGG - Intronic
1044646469 8:94448771-94448793 GGGGAGGAGGGAGAGGAAATCGG + Intronic
1046529258 8:115422438-115422460 CGGGAGGCGGAGGTGGCAGTGGG - Intronic
1046871309 8:119208413-119208435 CGGGAGGCGGAGGCGGGAGGCGG + Exonic
1047463609 8:125091749-125091771 GGGGAGTCAGGGGCGGAAGTCGG - Exonic
1048234252 8:132674812-132674834 CGGGAGGCGGAGGCTGCAGTGGG + Intronic
1048925136 8:139264860-139264882 AGGGAGGCGGGAGGGGCAGGAGG - Intergenic
1049060668 8:140273747-140273769 GGGAGGGCGAGAGCGGAAGTGGG - Intronic
1049535683 8:143180259-143180281 GGGGTTGCGGGAGCGGAGGTGGG - Intergenic
1049712398 8:144071236-144071258 GGGGAGGGGGGAGGGGAAGGGGG - Intergenic
1049762163 8:144336593-144336615 CGGGGGGGGGGAGGGGAAGGGGG - Intergenic
1051720845 9:20035646-20035668 CGGGAGGCTGAGGCTGAAGTGGG + Intergenic
1053350655 9:37411406-37411428 GGGGAGGAGGGAAGGGAAGTGGG + Intergenic
1056177674 9:84051299-84051321 CGGGAGGCGGAGGCTGCAGTGGG - Intergenic
1057264139 9:93603012-93603034 TGGGAGGGGGGCGCGGAGGTGGG + Intronic
1057643842 9:96854376-96854398 CCGGAAGCGGGAGAGGAAGCGGG - Exonic
1059012189 9:110474072-110474094 CGGGAGGGGGAAGTGGCAGTGGG - Intronic
1060185276 9:121560349-121560371 GGGGAGGGGGGAGAGGAAGAGGG + Intergenic
1060200378 9:121648940-121648962 CGGGAGGTGGGAGCAGATGGGGG + Intronic
1060268557 9:122126235-122126257 CGGGAGGCGGCAGAGGCAGCGGG + Intergenic
1061128262 9:128689910-128689932 AGGGAGGGGGGAGAGGAAGGGGG - Intronic
1061202576 9:129146212-129146234 CGGGAGCAGGGAGCGGGAGGTGG - Intronic
1061614012 9:131767563-131767585 CGGGAGGTGGAAGTTGAAGTGGG - Intergenic
1061896058 9:133648361-133648383 GGGGAGGCGGCAGCGGATGAGGG - Intronic
1061897393 9:133655560-133655582 CGGGAGGAGGGGGCGGCAGCTGG + Intronic
1062064113 9:134517216-134517238 GAGGAGGCGGGAGGGGAAGCAGG - Intergenic
1062389293 9:136327668-136327690 GGGGACGCGGGAGCGGGAGCCGG - Exonic
1062596245 9:137301188-137301210 CGGGCGGCGGGAGCCGAAGGCGG - Exonic
1203468795 Un_GL000220v1:107635-107657 CGGGCGGCGGGCGGGGAAGAGGG - Intergenic
1203476616 Un_GL000220v1:151607-151629 CGGGCGGCGGGCGGGGAAGAGGG - Intergenic
1185477073 X:421810-421832 CGGGAGGCGGGAGCAGGTGGGGG - Intergenic
1185825995 X:3250186-3250208 TGGGAGGAGGGAGTGGAAGAGGG + Intergenic
1186427773 X:9477823-9477845 CTGGAGGTGGGAGCAGAAATGGG - Intronic
1187045980 X:15647536-15647558 GGGGAGGGGGGAGGGGAAGGGGG + Intronic
1187051959 X:15703838-15703860 GGGGAGGGGGGAGGGGAAGGGGG + Intronic
1188077717 X:25799151-25799173 TGTGAGGAGGGAGTGGAAGTGGG - Intergenic
1188287646 X:28347710-28347732 CGGAAGGAGGGAGGGGAAATAGG - Intergenic
1189324988 X:40106533-40106555 CGGGAGGCGGGAGCGCGGGCGGG - Intronic
1189324998 X:40106557-40106579 CGGGAGGCGGGAGCGCGGGGAGG - Intronic
1189945929 X:46178968-46178990 AGGGAGGGAGGAGAGGAAGTGGG - Intergenic
1190234456 X:48605011-48605033 CTGGAGGCGGGAGCAGAAGTAGG + Exonic
1190640997 X:52482675-52482697 CGGGAGGCTGGAGCCCACGTGGG - Intergenic
1190646675 X:52530190-52530212 CGGGAGGCTGGAGCCCACGTGGG + Intergenic
1190864900 X:54376151-54376173 TGGGAGGCTGAAGTGGAAGTGGG - Intergenic
1190878795 X:54478042-54478064 CGGGAGGCGGAGGCTGCAGTGGG + Intronic
1191085480 X:56563534-56563556 GGGGAGGCGAGCGCGGAACTGGG + Intergenic
1191828523 X:65391731-65391753 CGGGAGGAGGGAGAGGGAGAGGG - Intronic
1192197505 X:69038389-69038411 CTGGGGGCGGGAGAGGAAGGAGG - Intergenic
1192317515 X:70064105-70064127 CGGGAGGCGGAGGCTGCAGTGGG + Exonic
1192425062 X:71068082-71068104 CGGGCGGCGCGAGCGGGAGGGGG - Intronic
1192624599 X:72714286-72714308 CGGGAGACGCGAGCGGGAGGCGG + Intronic
1198462883 X:136880364-136880386 CGGGAGTTGGTAGCGGAGGTCGG - Intronic
1199736794 X:150693329-150693351 CGGGGGGCGGGAGCGGGGGCGGG - Intronic
1199760225 X:150899028-150899050 CGGGAGGCGGCAGCGCCGGTGGG + Intergenic
1200138362 X:153885741-153885763 GGGCAGGCGGGGGCTGAAGTTGG - Intronic
1201253009 Y:12079660-12079682 TGGGAGGAGGGAGTGGAAGAGGG - Intergenic