ID: 1178078546

View in Genome Browser
Species Human (GRCh38)
Location 21:29036626-29036648
Sequence GTCTATAGTAAGCCTGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178078546 Original CRISPR GTCTATAGTAAGCCTGGCTA GGG (reversed) Intronic
901376287 1:8841969-8841991 GTCTATAGTTACCCAGTCTAAGG + Intergenic
906228070 1:44138439-44138461 GGCTATAGCCAGCCTGGCTCTGG + Intergenic
910533276 1:88266061-88266083 GTCTTTAGAAAGCCTGGTTTTGG - Intergenic
914962723 1:152220529-152220551 GGCTATAGTAAGCATGGTTCTGG - Exonic
915968560 1:160334771-160334793 GAAAGTAGTAAGCCTGGCTAAGG + Intronic
918569716 1:185975314-185975336 CTCTACAGAAAGCATGGCTAGGG + Intronic
919051266 1:192514258-192514280 GTCTTTAGGAATCCTGGCAAAGG - Intergenic
919244936 1:194970429-194970451 GTCAACATTAAGCCTGGCCATGG - Intergenic
923813142 1:237343083-237343105 GTCTATAGGTATGCTGGCTATGG - Intronic
1063175869 10:3550576-3550598 GTCTAAAATAAGCCTGTGTAGGG + Intergenic
1080139013 11:28892026-28892048 GTTTATAGTATGGATGGCTATGG - Intergenic
1080624366 11:34015111-34015133 GTCTTTAGTTAGCCAGCCTAGGG - Intergenic
1081905308 11:46665541-46665563 GTCTCTGGTAAGGCTGGCCAGGG + Intronic
1082082948 11:48026292-48026314 GTCTTTGGTAAGCCTGGGAAAGG + Intronic
1084010242 11:66344322-66344344 GTGTATAGTAAGCCTGGCCTAGG + Intronic
1085105546 11:73839392-73839414 ATTTATAGTAAGTCTTGCTATGG - Intronic
1086433985 11:86763513-86763535 GTCTACAGAAAGCCTGACAAGGG + Intergenic
1087388299 11:97501930-97501952 GTCTAAAGAATGCCTGGCTATGG + Intergenic
1088180589 11:107104572-107104594 CTCTACAGGAAGCATGGCTAGGG + Intergenic
1088337280 11:108720363-108720385 GTCTATGGTAATCCAGGCAAGGG - Intronic
1106960171 13:34989371-34989393 GTGTACAGGAAGCCTGGCTGGGG + Intronic
1108439349 13:50434266-50434288 TTTTATAGTTAGTCTGGCTAAGG + Intronic
1109687282 13:65838144-65838166 CTGTATAGGAAGCATGGCTAAGG + Intergenic
1110405884 13:75150071-75150093 GTCAATTGTAGGTCTGGCTAGGG - Intergenic
1112492366 13:99878958-99878980 GTTTAAAGTAAGCATGGCTCTGG + Intronic
1117771962 14:59142555-59142577 GTCTTTCATAAGCCTGGGTATGG - Intergenic
1120016576 14:79480898-79480920 GTATATAGGAAGCATGGCTGGGG - Intronic
1123974975 15:25544640-25544662 GTCTAAAGTAAGCCTGGTCTTGG + Intergenic
1125914203 15:43470803-43470825 GTCTAGAGGAAGCCTGGTTGGGG - Intronic
1126082145 15:44974058-44974080 TTCTCTAGTAAGCCTGGTAATGG + Intronic
1126443224 15:48714264-48714286 GTCTATAATAAGGCTGGGCATGG - Intronic
1126490758 15:49233153-49233175 GTGTACAGGAAGCATGGCTAGGG + Intronic
1130579243 15:85120525-85120547 GTCTAGAGAAAGACTGGCTGAGG + Intronic
1133418081 16:5621999-5622021 GTCAAAAGTAAACATGGCTATGG + Intergenic
1134073710 16:11276208-11276230 GCCTATAGTGAGACTGGCCATGG + Exonic
1143777735 17:9210309-9210331 GTCTACAGCCACCCTGGCTATGG + Intronic
1159440053 18:68466740-68466762 ATCTAGAGTAAGCCTAGCTCTGG + Intergenic
925094666 2:1186532-1186554 GTATACAGGAAGCATGGCTAGGG + Intronic
932378619 2:71261128-71261150 GTCTCTAGGTAGCCAGGCTATGG - Intergenic
934653935 2:96107746-96107768 GTCTATAGTAAGGCTGGGAGGGG - Intergenic
939321521 2:140628968-140628990 GTGTACAGGAAGCATGGCTAGGG - Intronic
944456873 2:199904096-199904118 GTCTAGAGTGAGCTTGGGTATGG + Intergenic
948104120 2:235399338-235399360 CTGTATAGGAAGCATGGCTAGGG - Intergenic
1173560079 20:43998036-43998058 CTCTATAGGAGGCATGGCTAGGG + Intronic
1178078546 21:29036626-29036648 GTCTATAGTAAGCCTGGCTAGGG - Intronic
1182297539 22:29318575-29318597 GTCTTTAGGAAGCCTGGCACAGG - Intronic
949485470 3:4533675-4533697 GGCTAAAGTCTGCCTGGCTATGG - Intronic
952974345 3:38681415-38681437 ATCTATAGCAAGCCTGGAGATGG + Intergenic
953428203 3:42813416-42813438 TTGTATAGGAAGCATGGCTAAGG + Intronic
959237216 3:103740267-103740289 GTGTACAGGAAGCATGGCTAGGG + Intergenic
963963729 3:151341336-151341358 GTATATAATAAGCCTGGCAATGG - Intronic
967385449 3:188906428-188906450 GTCAATGCCAAGCCTGGCTAAGG - Intergenic
971642495 4:29153804-29153826 GTGTACAGGAAGCCTGGCTGGGG + Intergenic
974136693 4:57827038-57827060 CTGTACAGTAAGCATGGCTAGGG + Intergenic
975893087 4:79052331-79052353 GTCTATAATAGACCTGGCCATGG + Intergenic
977247814 4:94654395-94654417 TTCTAGAGTTAGCCTGGATATGG - Intronic
978602587 4:110444134-110444156 CTGTATAGGAAGCATGGCTAGGG - Intronic
992095467 5:73358543-73358565 TTCTATTGTAATCCTGTCTAAGG - Intergenic
998479050 5:142446005-142446027 CTCTATAGGAAGCATGGCTAGGG + Intergenic
1003280854 6:4690240-4690262 CTCTACAGGAAGCCTGGCTGGGG + Intergenic
1008613730 6:53206834-53206856 GTCTATATTCAGCCTGGCCCAGG + Intergenic
1012660743 6:101887628-101887650 CTGTATAGGAAGCATGGCTATGG + Intronic
1015029305 6:128575186-128575208 GTCAAAAGTAAGTCTGGTTAAGG + Intergenic
1015890032 6:137961093-137961115 CTCTACAGGAAGCATGGCTAGGG - Intergenic
1020610953 7:10397273-10397295 GTCAATATTAGGTCTGGCTAGGG - Intergenic
1026512003 7:71035147-71035169 CTCTCTACTAAGCCTGGCTTTGG - Intergenic
1027914296 7:84295512-84295534 GTCAATAGAAAGCCTAGTTATGG - Intronic
1028452161 7:90997847-90997869 GTCTTTAGTAAGCCTGACAGTGG + Intronic
1030005977 7:105120463-105120485 GTTTATAGTATGCCTAGTTATGG - Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1042258955 8:66837087-66837109 ATCTATAGTAAGACTGACTGAGG + Intronic
1044888340 8:96804248-96804270 GACTATAGAAAACCTTGCTAAGG + Intronic
1048606218 8:135971501-135971523 CTCTATATTAAGCCTTACTAAGG + Intergenic
1056635868 9:88330799-88330821 CTCTATAGTGAGCATGGCTGGGG - Intergenic
1058528749 9:105885559-105885581 GTCTACTGTAAGCTTGGCTGAGG + Intergenic
1058554616 9:106153679-106153701 GTCTGTAGTAACCCTGGCTGGGG + Intergenic
1186497559 X:10023874-10023896 GTCTAAAGTAACCCTGGCGGTGG + Intronic
1187225447 X:17372086-17372108 TTCTATAGGAAGCCTGACTAGGG + Intergenic
1192066497 X:67890685-67890707 CTGTACAGGAAGCCTGGCTAGGG - Intergenic
1194269339 X:91791319-91791341 CTGTATAGGAAGCATGGCTAGGG + Intronic
1194908372 X:99607857-99607879 GTCTCCAGGAAGCCTGGCTTTGG + Intergenic
1196318962 X:114266318-114266340 TTCTATAGGAAGCCTTTCTATGG + Intergenic
1199582476 X:149374094-149374116 GTGTATAGTAAGCATGGACAAGG - Intergenic
1200022561 X:153224453-153224475 GTCTATAGAATGCCTGGCTCAGG + Intergenic
1200586559 Y:5012304-5012326 CTGTATAGGAAGCATGGCTAGGG + Intronic
1200859451 Y:7974834-7974856 GTCTTTAGTAGGCAGGGCTAAGG + Intergenic