ID: 1178081429

View in Genome Browser
Species Human (GRCh38)
Location 21:29070363-29070385
Sequence CACTGTCCTGTCTAATTAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178081429 Original CRISPR CACTGTCCTGTCTAATTAGC GGG (reversed) Intronic
903546118 1:24124347-24124369 CACTGTCCTGTCTAAAATGGAGG + Intronic
905316329 1:37083783-37083805 CATTGTCCGGGCTATTTAGCAGG + Intergenic
906771361 1:48487804-48487826 CACAGTCCTGACTAATTACCTGG - Intergenic
911410562 1:97500967-97500989 CAATTTACTGTGTAATTAGCAGG + Intronic
913176510 1:116277472-116277494 CCCAGTCCTGTCAAATGAGCTGG + Intergenic
913611341 1:120512545-120512567 CTCTTTCCTGTCTGATGAGCTGG - Intergenic
922688311 1:227665296-227665318 CACTGGAATGTGTAATTAGCTGG - Intronic
1063198155 10:3762259-3762281 CACTGTCCTTTCTAACAGGCAGG - Intergenic
1063394338 10:5672587-5672609 CACTGGCATGACTAACTAGCAGG - Intergenic
1065312521 10:24430214-24430236 CAGTGTCCTGACTAAGGAGCTGG + Intronic
1070221147 10:74446777-74446799 CACTGTACTATCTAAATAGGAGG - Intronic
1071590039 10:86864192-86864214 CATGTGCCTGTCTAATTAGCAGG - Intronic
1076661709 10:132059787-132059809 CACTGGCCTTGCTAATTTGCAGG + Intergenic
1079052013 11:17169317-17169339 CACTGTCCTCTCTGAATAGTAGG + Exonic
1084354889 11:68631521-68631543 CATGTGCCTGTCTAATTAGCAGG - Intergenic
1085339123 11:75719871-75719893 CACTGTCCTGTCCAATCCTCGGG - Intronic
1090460323 11:126885782-126885804 CACTGTGCTGTCTAATTCTAGGG + Intronic
1091948483 12:4570920-4570942 CCCTGTCCTTTCTGCTTAGCTGG + Intronic
1092029160 12:5269440-5269462 CACTGTGCTGTGTTATGAGCTGG - Intergenic
1099676427 12:85766700-85766722 CACTGTCCTGTCTAGTGATTGGG - Intergenic
1100199458 12:92282659-92282681 CTCTCTCCTATCTAATTAGCTGG - Intergenic
1102286830 12:111664545-111664567 CACTGCCCTGCTTATTTAGCTGG - Intronic
1102647940 12:114415703-114415725 CACTGTCCTCTCCAATTCCCAGG - Intergenic
1105895904 13:24717362-24717384 CACTGTGCTGTGTACCTAGCAGG - Intergenic
1112501799 13:99948630-99948652 CACTGTTTAGTCTAATAAGCAGG + Intergenic
1116332775 14:43616108-43616130 CAGGTTCCTGTCTAATTGGCTGG - Intergenic
1116876416 14:50116393-50116415 CATTGTCCTTTCTAAATACCTGG - Exonic
1116911383 14:50469194-50469216 CACTGTCCTGTCAGCTTTGCTGG - Intronic
1117189234 14:53274689-53274711 CAATGTCCAGTCCAATTGGCTGG + Intergenic
1118936618 14:70294729-70294751 CATGTGCCTGTCTAATTAGCAGG + Intergenic
1119345610 14:73921164-73921186 CACTGTCCTGCCTGCTTATCTGG + Intronic
1131711450 15:95060318-95060340 CACTGTCCTGTCATCTAAGCCGG + Intergenic
1133775102 16:8889589-8889611 TACTGTCCCTCCTAATTAGCCGG + Intergenic
1133988217 16:10684591-10684613 CCCTGTCCTGCCTAATGAGCTGG + Intronic
1139178609 16:64718940-64718962 CACTGTCCTTTCTCATTCCCTGG - Intergenic
1141796050 16:86274992-86275014 CACAGTCCTGTCTCTTTAGTTGG + Intergenic
1142796111 17:2308657-2308679 GACTATCCTGGCCAATTAGCTGG + Intronic
1147777755 17:42914970-42914992 AAATGTTCTGTCTAATAAGCAGG - Intergenic
1149714108 17:58770647-58770669 CATTGTGATGTTTAATTAGCTGG - Intronic
1153831457 18:8927288-8927310 CATTGTCCAGTCTTATTTGCAGG + Intergenic
1155384376 18:25261244-25261266 ACCTGACCTGTCTGATTAGCAGG + Intronic
1157735086 18:50040373-50040395 CAATGTCCTGTCTTCTTAGCTGG + Intronic
1160473045 18:79156288-79156310 CCCTTTCCTGCCTAGTTAGCTGG + Intronic
1164816656 19:31209361-31209383 CTCTGTCCTGTCTCCCTAGCAGG - Intergenic
1165932777 19:39370974-39370996 CACTGTCCTGCCAACTAAGCAGG + Intronic
1166196769 19:41211483-41211505 CACTCTCCTGCCTCAGTAGCTGG - Intergenic
1167194532 19:48018808-48018830 CTCAGTCTTGCCTAATTAGCAGG - Intronic
1167778788 19:51581765-51581787 CAGTATCCTTTCTAATTAACAGG + Exonic
925122944 2:1433074-1433096 CAGTCTCCTGTTTCATTAGCTGG + Intronic
928544392 2:32315632-32315654 CACTCTCCTGCCTCAGTAGCTGG - Exonic
928999058 2:37327692-37327714 AACTGTCTTGTCTGATTTGCAGG + Intergenic
929226463 2:39516220-39516242 CACTGTCCTGTGTACCTATCTGG + Intergenic
929807109 2:45155916-45155938 CACTGTTCTGTCTCATTGCCTGG + Intergenic
933556842 2:83840669-83840691 CAATTTCCAGTCTAATTACCTGG + Intergenic
945572602 2:211487830-211487852 CACTGGCCAGAGTAATTAGCTGG + Intronic
948479735 2:238241680-238241702 CACTGACCTCTGTAATTACCTGG + Intergenic
1171279202 20:23882028-23882050 CAATTTCCTGTCTAACTAGGAGG - Intergenic
1173155089 20:40601854-40601876 CATTCTCCTGTCTTAGTAGCTGG - Intergenic
1174936273 20:54873580-54873602 CACTGTGCTTTTTAATCAGCAGG - Intergenic
1178081429 21:29070363-29070385 CACTGTCCTGTCTAATTAGCGGG - Intronic
1180176840 21:46094919-46094941 GACTGTCGTGTCTAATTCTCTGG - Intergenic
1180663257 22:17487584-17487606 CACTCTCCTGCCTCAGTAGCTGG - Intronic
1183058661 22:35322168-35322190 CACTGTCCTGTCTACACTGCAGG + Intronic
951090202 3:18563683-18563705 AACTGTCCTATCTGATTAACTGG - Intergenic
956488370 3:69745382-69745404 CTCTGCCTTGTATAATTAGCTGG - Intronic
962543394 3:136406721-136406743 CAATGTACTGTATTATTAGCAGG + Intronic
963322399 3:143823031-143823053 CTCTGTCCTGTCTTAATTGCTGG - Intronic
963526560 3:146422445-146422467 CCCTGTCCTCTCTATTTACCAGG - Intronic
969269096 4:6086652-6086674 CACTGTCCTGGTTGAATAGCAGG + Intronic
972268505 4:37485829-37485851 CACTGTCCTGTCCTAATAGCAGG + Intronic
975470699 4:74762806-74762828 CACTGTCCTTTCACATTATCAGG - Intronic
975762209 4:77631504-77631526 CAATGTCCAGTCTAGTTGGCTGG + Intergenic
978079115 4:104569938-104569960 CAGTGTCCTCTCTCATTTGCTGG - Intergenic
982463850 4:155705432-155705454 CATTCTCCTGCCTGATTAGCTGG - Intronic
983056656 4:163104647-163104669 CACTGAACTCACTAATTAGCCGG + Intergenic
989614141 5:43322449-43322471 CATTTACCTGTCCAATTAGCAGG + Intergenic
992734049 5:79701141-79701163 GATTCTCCTGTCTAAGTAGCTGG - Intronic
997936790 5:138119325-138119347 CACACTCCTGTCTACTTAGGAGG - Intronic
1000964646 5:167641401-167641423 CACTGAACTGCCTAATTAGAAGG - Intronic
1001743082 5:174069668-174069690 TAGCTTCCTGTCTAATTAGCTGG + Intronic
1002518840 5:179779003-179779025 CACTGCCCTCTCTCATTACCTGG - Intronic
1002662315 5:180799881-180799903 CAGTGTCCTGTCCATATAGCAGG - Intronic
1004340453 6:14803622-14803644 CACTGTCTTGTCTAATTATCAGG - Intergenic
1007510621 6:42371840-42371862 CACTGTTCTGTTTAAGTAGGAGG + Intronic
1009514670 6:64599691-64599713 CATAGTCCTGTCTAATTTTCTGG + Intronic
1010298953 6:74236179-74236201 CAATGTCTTGTCTAATCTGCAGG - Intergenic
1016349486 6:143151951-143151973 CCCTGTCCTGTCTACAAAGCTGG + Intronic
1017550193 6:155497385-155497407 CACTGTCCTGTGATATTAACAGG + Intergenic
1018324424 6:162649963-162649985 CACTTTGCTGTCTAATTCCCAGG - Intronic
1021877963 7:25066167-25066189 CAGTGGCCTGGCTAATTAACGGG + Intergenic
1021933906 7:25610672-25610694 AAGTGTTCTGTCTAATTAGATGG - Intergenic
1022567345 7:31416473-31416495 CACTTTCCTGTCCATTTACCAGG - Intergenic
1028444710 7:90908370-90908392 GAGTGTACTGTTTAATTAGCTGG - Intronic
1028858575 7:95620872-95620894 CATTGCCCTGTCATATTAGCTGG - Intergenic
1029102761 7:98147418-98147440 CACTGTGTTGCCTAATTAACTGG + Intronic
1032919684 7:136531678-136531700 CTCTTTCTTGTCTAATTTGCTGG - Intergenic
1035954510 8:4061215-4061237 CTCTTTCCTCTCTAATCAGCAGG - Intronic
1036012036 8:4736814-4736836 CACTGTGCTGTCTGATTTGTGGG + Intronic
1039580266 8:38660202-38660224 CACATTCCTGTCCAATCAGCAGG - Intergenic
1042048053 8:64676523-64676545 CACTGTCCTGTATAATTAATAGG - Intronic
1043948331 8:86279014-86279036 GAATGTCCAGTCTAATGAGCTGG - Intronic
1048691928 8:136975533-136975555 CATTTTGCTGTCTAATTACCTGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1052808687 9:33036918-33036940 CACTGTCCTAGCTCATTGGCAGG - Intronic
1055786833 9:79879402-79879424 CATAGTGTTGTCTAATTAGCAGG + Intergenic
1058892433 9:109372430-109372452 GACTGGCCTGTATAATTAGGGGG + Intergenic
1060714834 9:125915729-125915751 TATTGTCCAGTCTCATTAGCTGG - Exonic
1187703904 X:21990524-21990546 CACTTTCCTGTCTATTTAAATGG - Intronic
1189953024 X:46251747-46251769 CACTGTCCTGTCCAAATAAATGG - Intergenic
1194165448 X:90508729-90508751 CCCTGTTTTGTCTTATTAGCAGG - Intergenic
1195739622 X:108050513-108050535 CACTGTCTTATCTTATTAACTGG - Intronic
1196525047 X:116721555-116721577 CACATGCCTGTCCAATTAGCAGG + Intergenic
1200511716 Y:4086539-4086561 CCCTGTTTTGTCTTATTAGCAGG - Intergenic