ID: 1178083718

View in Genome Browser
Species Human (GRCh38)
Location 21:29092315-29092337
Sequence CTCTTGCCTCCTCTTTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178083718_1178083721 -3 Left 1178083718 21:29092315-29092337 CCTCTCTAAAGAGGAGGCAAGAG 0: 1
1: 0
2: 1
3: 25
4: 285
Right 1178083721 21:29092335-29092357 GAGGTTTCAATTTCTTCTCAGGG 0: 1
1: 0
2: 2
3: 11
4: 248
1178083718_1178083720 -4 Left 1178083718 21:29092315-29092337 CCTCTCTAAAGAGGAGGCAAGAG 0: 1
1: 0
2: 1
3: 25
4: 285
Right 1178083720 21:29092334-29092356 AGAGGTTTCAATTTCTTCTCAGG 0: 1
1: 0
2: 1
3: 26
4: 277
1178083718_1178083723 30 Left 1178083718 21:29092315-29092337 CCTCTCTAAAGAGGAGGCAAGAG 0: 1
1: 0
2: 1
3: 25
4: 285
Right 1178083723 21:29092368-29092390 CTGACATCAAAAGGTCTGTGCGG 0: 1
1: 0
2: 0
3: 18
4: 144
1178083718_1178083722 21 Left 1178083718 21:29092315-29092337 CCTCTCTAAAGAGGAGGCAAGAG 0: 1
1: 0
2: 1
3: 25
4: 285
Right 1178083722 21:29092359-29092381 AAAAAAGAACTGACATCAAAAGG 0: 1
1: 0
2: 4
3: 84
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178083718 Original CRISPR CTCTTGCCTCCTCTTTAGAG AGG (reversed) Intronic
902053941 1:13584649-13584671 CTCCTTTATCCTCTTTAGAGAGG + Intronic
902931371 1:19733901-19733923 CTCTTTCCTCCTCTGTAAAATGG + Intronic
903395460 1:22998686-22998708 CTCTTGACTCCTTCTTGGAGTGG - Intergenic
903586381 1:24418708-24418730 CAGTTGCCTCCTCTGTAAAGTGG - Intronic
905429703 1:37912675-37912697 CTCTTGACTCCCTCTTAGAGTGG + Intronic
906948342 1:50314792-50314814 TCCTTGCCTCCTCTTTAAAGGGG + Intergenic
907158030 1:52352360-52352382 CTGTGGCTTCCTCTTGAGAGAGG - Exonic
908958857 1:69670740-69670762 CTCTTCCCTCCTCTTTCCATTGG + Intronic
909182263 1:72439550-72439572 CTCTTGCCTCCCCTTTCCAAAGG + Intergenic
909730010 1:78878550-78878572 CTCTTGACTCCCTCTTAGAGTGG + Intergenic
909848755 1:80433809-80433831 CTCTTCCCTCCTCTTTCCATAGG + Intergenic
911241320 1:95470743-95470765 CTCTTCCCTCCCCTTTACACAGG + Intergenic
914781262 1:150787266-150787288 TTCTTGCCTCCTTTCTAGAATGG + Intergenic
915916147 1:159942080-159942102 TTGTTGCCTCCTCTTCAGAGGGG - Intronic
916508737 1:165452554-165452576 CTGCTGTCTCCTCTCTAGAGGGG - Intergenic
917536000 1:175875127-175875149 CTTTTGCCTCCTCTTCACGGAGG + Intergenic
921796594 1:219352076-219352098 ATCATGCTTCCTCTATAGAGTGG - Intergenic
922275181 1:224070990-224071012 CTCTTCTCTTCTCTTTAGACAGG + Intergenic
922994006 1:229941571-229941593 CTCTTGACTCCTCTTCCCAGTGG - Intergenic
924283817 1:242464815-242464837 CACTTCACTCCTCTTTAGGGTGG - Intronic
1062771631 10:105456-105478 CTCCTGCCTGCTCTGTGGAGGGG + Intergenic
1063355348 10:5393873-5393895 CTGCTGCCTACTCTATAGAGGGG - Exonic
1064176386 10:13079252-13079274 CGCGTGCCTCCTCATGAGAGAGG - Intronic
1065280859 10:24136102-24136124 CTTTTATCTCCTCCTTAGAGTGG - Intronic
1065880427 10:30032925-30032947 CAGTTTCCTCCTCTGTAGAGTGG - Intronic
1066101636 10:32123001-32123023 ATCTTGCCTACTCTGTGGAGTGG + Intergenic
1069724301 10:70567417-70567439 CTCTTTCCTCCCCATGAGAGGGG - Exonic
1073028528 10:100506418-100506440 CTCTTCCCTTCTCTTTTTAGGGG - Exonic
1074386145 10:113018234-113018256 CTCCTCCCACCTCTTAAGAGTGG - Intronic
1075006092 10:118831178-118831200 CTGTTTCCTCCTCTCTAAAGGGG + Intergenic
1075348946 10:121706518-121706540 CTTTTTCCTCCTCTCTAAAGTGG + Intergenic
1075348949 10:121706527-121706549 TTCTGACCTCCACTTTAGAGAGG - Intergenic
1075428518 10:122361837-122361859 CTCTTTCCTCCTCTGTAAAATGG + Intergenic
1075946423 10:126437110-126437132 GTCTTCTCTCCTCTTTACAGGGG + Intronic
1076048167 10:127311761-127311783 CTCTTGCCTCATCCTCAGTGAGG + Intronic
1076549434 10:131268151-131268173 CTCCTGCCTGCTCTGTGGAGTGG + Intronic
1077012220 11:384440-384462 CTCCTGCCTGCTCTGTGGAGTGG - Intergenic
1078953070 11:16157286-16157308 TTTTAGCCTCCTCTTTTGAGGGG + Intronic
1079110897 11:17604559-17604581 CTCTTCCCTCCTCTGTAAAATGG + Intronic
1080845596 11:36024120-36024142 CTCTTCCTGCCTCTCTAGAGTGG - Intronic
1082099822 11:48163236-48163258 CTGCTGCCTCATCTTTAAAGGGG + Intronic
1083224547 11:61276676-61276698 CTCTTGCCTCCTCCTCAGGCTGG - Exonic
1083401953 11:62429674-62429696 CTCTTGCCTCAGCTGTAGCGGGG - Intergenic
1083756934 11:64796889-64796911 CTCTTGCCTCCTCTGCAGATGGG - Exonic
1084310025 11:68311738-68311760 CTCTTTCCTCCTTTGTAAAGTGG - Intergenic
1085354296 11:75821714-75821736 CTCTTGCCTCCTCTTAGCTGTGG + Intronic
1088363196 11:109012438-109012460 CTCTTGGATCCTCTTGATAGAGG + Intergenic
1088927031 11:114312879-114312901 CTCTTGCCTTCTCCCTGGAGAGG + Exonic
1088938159 11:114425669-114425691 CTCTTGCCTCCACTTTCCACAGG + Intronic
1089643031 11:119860097-119860119 CTGTTTCCTCCTCTTTAAAATGG - Intergenic
1089703128 11:120257600-120257622 CTCTCCCCTCCTCTCTGGAGTGG - Intronic
1089823068 11:121246276-121246298 CTCCTGCCTGCTCCTTGGAGCGG - Intergenic
1091678308 12:2507722-2507744 CACTTGCCTTCTCTGTAGAATGG - Intronic
1091992932 12:4971405-4971427 CTGTTTCCTCCTCTGTAGACAGG + Intergenic
1093511344 12:19932684-19932706 CTCTTGCCTCTTCTCAATAGAGG + Intergenic
1093565934 12:20603850-20603872 CTCTTGTCTCCTCTCTAAAAAGG - Intronic
1094736172 12:33236813-33236835 CTCCTGCCACTTATTTAGAGTGG - Intergenic
1096504698 12:52085390-52085412 CAATTCCCTCCTCTTTAGGGTGG + Intergenic
1096543151 12:52319651-52319673 CACTCACCTCCTCTGTAGAGTGG + Intronic
1096602768 12:52742192-52742214 CTCCTGCCTCCTCTGCAGAGTGG - Intergenic
1096978846 12:55716927-55716949 CTCTCGCCTCCTCTTTTCTGGGG - Exonic
1097337811 12:58404249-58404271 CTCTTTTCTCCTCATTACAGTGG + Intergenic
1098480429 12:70951848-70951870 CTTTAGCCTCTTCTTTGGAGAGG + Intergenic
1101891996 12:108725466-108725488 CACTTTCCTCCTCTGTAGTGTGG - Intronic
1102410057 12:112709849-112709871 CACTTTCCTCCTCTGTAAAGTGG - Intronic
1102949911 12:117024478-117024500 CTGTTTCCTCCTCTGCAGAGCGG - Intronic
1107178162 13:37423511-37423533 CTCTTCCCTCCTCTTTCCACAGG - Intergenic
1110189387 13:72714010-72714032 CACTTGTCTCCTATTTAGATAGG - Intronic
1110501360 13:76231755-76231777 CTCTTCCCTCCTCTTTCCAAAGG - Intergenic
1114280966 14:21192293-21192315 CTCCTGCCTGCTCTTCTGAGTGG - Intergenic
1114581626 14:23765679-23765701 CTCTTGCCTCTTCTTAAAACAGG - Intergenic
1115104582 14:29745123-29745145 CTCGTGTCACCTCCTTAGAGAGG + Intronic
1115829023 14:37313590-37313612 CTTTTGCCTTCTGTTTTGAGTGG - Intronic
1117650939 14:57904717-57904739 CACTTGCCTCATCTTTAAAATGG - Intronic
1118425641 14:65658007-65658029 CTCTTTCATCCTCTTTAACGGGG - Intronic
1119309415 14:73633898-73633920 CTCCTCCCTCCTCTTCAGCGCGG + Intergenic
1120844699 14:89115629-89115651 CTCTTGTCTCCCCTTAGGAGGGG - Intergenic
1121644667 14:95509562-95509584 CTGTTTCCTGCTCTTTAAAGAGG - Intergenic
1122802903 14:104240567-104240589 CTCTTGCCTCCTCCTTATATGGG + Intergenic
1125561141 15:40634621-40634643 CTCTTGCCTCAGCTATAGATAGG + Intronic
1127035247 15:54908717-54908739 CTCTTCCCTCCTCTTTCCAAAGG - Intergenic
1127238321 15:57081399-57081421 CTCTTGCCTCATCTGTGGAATGG + Intronic
1127627966 15:60798828-60798850 TGCTTGCCTCCACTTTAGAGTGG - Intronic
1128383618 15:67131579-67131601 CAGTTTCCTCCTCTTTACAGCGG - Intronic
1128441301 15:67711439-67711461 CAGTTTCCTCCTCTTTAGATGGG + Intronic
1129880729 15:79004531-79004553 CTCTGGCCTCATCCTTAGAGAGG + Intronic
1130847798 15:87763524-87763546 CTCTTGCCTTGTCTTGAGAGTGG - Intergenic
1131066596 15:89438697-89438719 CTCTTGCCAGCTCTAGAGAGGGG + Intergenic
1132120976 15:99175107-99175129 CTGCTGCCTCCACTTGAGAGGGG + Exonic
1132937201 16:2487133-2487155 CTCTTGCCTCCACATCTGAGGGG + Intronic
1137256291 16:46778083-46778105 CTCCTGCCTCCTCTGTAGAGTGG - Intronic
1137282813 16:46992598-46992620 CTCCTGCCTGCTCTGTGGAGTGG + Intergenic
1137481764 16:48857753-48857775 CTCTTCCCTCATTTTTAGAATGG - Intergenic
1137620730 16:49875096-49875118 CTCTTGCCTTCTCTGTAAAGTGG - Intergenic
1137632262 16:49955231-49955253 ATCTTTCTTCATCTTTAGAGAGG + Intergenic
1138364112 16:56458706-56458728 CTCTTTCCTCCTCTACAAAGTGG - Intronic
1139103759 16:63801687-63801709 CTCTTCCCTCCCCTTTACAAAGG + Intergenic
1139854050 16:69966782-69966804 CTCCTGCCTCAGCTTTCGAGTGG + Intergenic
1139883031 16:70189695-70189717 CTCCTGCCTCAGCTTTCGAGTGG + Intergenic
1140369478 16:74405824-74405846 CTCCTGCCTCAGCTTTCGAGTGG - Intergenic
1142248656 16:88981078-88981100 CTCCTCCCTCCTCTGTAAAGTGG - Intergenic
1142676343 17:1516000-1516022 CTCTTGCCTGCTCTTTCACGGGG - Intronic
1143281396 17:5757327-5757349 CTCTTGCCTCTTCATCACAGAGG + Intergenic
1144642820 17:16947518-16947540 CTTTTGCCTACTTTTTAGTGGGG - Intronic
1146317673 17:31820931-31820953 CTCTTTCCTCTTCTCTTGAGAGG - Intergenic
1146912403 17:36657186-36657208 CTCTTTCCTCCTCTCTGGACAGG + Intergenic
1147977227 17:44254847-44254869 CTCTTTCCTCATCTTTAAAGTGG - Intronic
1148199621 17:45741231-45741253 CTGTTGCCTCCTCTGTAAAATGG + Intergenic
1148496740 17:48057416-48057438 CTCTTGTCTCCTCTTCTGACCGG + Exonic
1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG + Exonic
1152329090 17:79660463-79660485 CTCTTGCCTACTTTTTAATGGGG - Intergenic
1152454515 17:80405839-80405861 CTCTTGACTCCTGCTTGGAGTGG + Intergenic
1152673657 17:81625001-81625023 CTCTAGCTTCCTCTTCAGTGTGG - Intronic
1154234432 18:12590729-12590751 CTCCTGCCCCCGCTTGAGAGTGG - Intronic
1156265448 18:35484025-35484047 CCCTTGCCTCCACTTCAGTGTGG - Intronic
1157012328 18:43665806-43665828 CTCTTGCCTCGTCTTGACGGAGG - Intergenic
1157802600 18:50633143-50633165 CTCTTGTCTCCTCTGCTGAGGGG + Intronic
1161761442 19:6175901-6175923 TTATTGCCTCTTCTTTAAAGTGG - Intronic
1164904089 19:31952832-31952854 CTTTTTCCTCCTTTTTAGATTGG + Intergenic
1166251751 19:41576237-41576259 CTCTGTCCTCCTCTGTGGAGAGG - Exonic
1166652553 19:44585491-44585513 CACATGCATCCTCATTAGAGGGG + Intergenic
1166829452 19:45630042-45630064 CTCTCTCCTCCTCTTTAGAATGG - Exonic
925087354 2:1118287-1118309 CTTTTGACTTCTCTGTAGAGGGG - Intronic
925404133 2:3595077-3595099 CTCATGGCTGCTATTTAGAGAGG - Intronic
925685600 2:6469714-6469736 CTCTTGCTCCCTCTTTAGCCTGG - Intergenic
925878313 2:8330286-8330308 CACCTGCCTCCTCTTTTGGGAGG - Intergenic
927511476 2:23646843-23646865 CTCTTTCCTCATCTTTAAAGTGG + Intronic
927570208 2:24152922-24152944 CTCTTCCCTCCCCTTTACACAGG + Intronic
929388597 2:41442090-41442112 CTCTTCCCTCCTCTTTCCAAAGG + Intergenic
929763515 2:44825548-44825570 CCCTGGGCTCCTCTTGAGAGGGG - Intergenic
931409973 2:62019853-62019875 ATCTTCCCTCCTCTTGAGTGCGG - Intronic
931650234 2:64462044-64462066 CTCTTGCCTTCTCTTTCCTGTGG + Intergenic
933589229 2:84213670-84213692 CTCTTTTCTCCTCTTTAAGGTGG - Intergenic
935594756 2:104869853-104869875 CTCTTGCCCCCTCCTTCAAGGGG + Intergenic
936459154 2:112699032-112699054 CTCTTGCCTACTTTTTAATGGGG + Intergenic
936765955 2:115848690-115848712 CTCTTGCCTCCTCAGGAGAAAGG - Intergenic
937040163 2:118814694-118814716 CTCTTGCCAGGTCTTTTGAGGGG - Intergenic
938014250 2:127854416-127854438 CTGTTGCTTCCTCTTCAGTGTGG - Intronic
939843889 2:147220694-147220716 CTCTTGCCTTTTATTAAGAGGGG + Intergenic
942347138 2:175015306-175015328 CTCTTGGTTCTACTTTAGAGTGG - Intergenic
945042475 2:205753623-205753645 CTCTTGCTACCTGTTTAGAAGGG - Intronic
946598655 2:221334812-221334834 ATTTTGCCTCATCATTAGAGGGG - Intergenic
947341924 2:229149754-229149776 ATCTTGTCTCCTCTTGAGTGAGG - Intronic
947598717 2:231431178-231431200 CTCTTGACTCCCTTTTGGAGTGG - Intergenic
948575538 2:238947208-238947230 CTCCTGCCTGCTCTGCAGAGCGG + Intergenic
948672125 2:239575308-239575330 CCCTTGCCTCCACATTAAAGGGG + Intergenic
1169381300 20:5109862-5109884 CTCTTGCTTTTTCTTAAGAGCGG - Intronic
1170668969 20:18412695-18412717 CTCCTGCCTCTGCTTTTGAGAGG + Exonic
1171147068 20:22794240-22794262 CTCTTTCCTGCTTCTTAGAGAGG + Intergenic
1171961274 20:31496806-31496828 CTCTTGCCTCCTCTGCTGGGTGG - Intergenic
1172697775 20:36834273-36834295 CACTTTCCTCATCTGTAGAGTGG - Intronic
1172760610 20:37318612-37318634 CTGGTTCCTCCTCTTGAGAGGGG + Intergenic
1174180268 20:48670046-48670068 CTGTTTCCTCCTCTGTCGAGTGG - Intronic
1174498875 20:50969543-50969565 CTCTTGCCTCTTTTTAAGATTGG - Intergenic
1175130747 20:56787699-56787721 CTCCTGCCTCCTCCCTAGAACGG + Intergenic
1175728432 20:61335103-61335125 CTCTTGCCAACTCTGTAAAGTGG - Intronic
1176104953 20:63381588-63381610 CTCCTGCCTCCTCTTGAGTCAGG + Intergenic
1176510985 21:7747870-7747892 TTACTGCCTCCACTTTAGAGAGG - Intronic
1178083718 21:29092315-29092337 CTCTTGCCTCCTCTTTAGAGAGG - Intronic
1178645098 21:34378399-34378421 TTACTGCCTCCACTTTAGAGAGG - Intronic
1178810604 21:35877922-35877944 CTATTTCCTCATCTATAGAGTGG - Intronic
1180148438 21:45935034-45935056 CTCTTTCCTTCTTTTGAGAGAGG + Intronic
1181673032 22:24434710-24434732 CTGTGGCTTCCTCTTTAGATAGG - Intronic
1182652980 22:31867018-31867040 CTCCCCCCTCCGCTTTAGAGTGG - Intronic
1183125777 22:35780187-35780209 CTCTGGCCTTCTCTTTAGTGCGG + Intronic
1183236065 22:36618566-36618588 GTCTTGCCTCCACTTTTGAAAGG + Intronic
1183598461 22:38826252-38826274 CACTTGCCTCCTCTGTAAAATGG + Intronic
950157825 3:10737102-10737124 CTCTTACCTCCTGTGTAGTGTGG + Intergenic
951762244 3:26159994-26160016 CTCTTGACTCCCTCTTAGAGTGG - Intergenic
951819308 3:26790855-26790877 CTCTTACCTACTCTTTGGAAAGG + Intergenic
952015316 3:28949852-28949874 CTCTTGCCTCAGCTTTAGCAGGG - Intergenic
952981021 3:38736026-38736048 CACTTGTCACCTCCTTAGAGGGG - Intronic
955052717 3:55428368-55428390 CTCATGCCTCCTCTGAAGAAGGG + Intergenic
955278602 3:57572296-57572318 TTCTTGTCTTCTCTTTACAGTGG - Exonic
956219484 3:66886735-66886757 CTCTTGGCTTCCCTTTATAGTGG - Intergenic
956453046 3:69392810-69392832 CTCCTGCCTCCTTTTTGGAATGG - Intronic
956789642 3:72670661-72670683 CTCTTTCCTCCAGTTAAGAGAGG + Intergenic
956881873 3:73519249-73519271 CTCTGGCCTCCTCTTTACGCTGG - Intronic
957107170 3:75905713-75905735 ATCTGGCCTCTTTTTTAGAGTGG + Intergenic
958612887 3:96450032-96450054 CTGCTGCCTCCTCCTTAGAGGGG + Intergenic
959181313 3:102984159-102984181 CTTTTGCCTGCTCTTTAGTGGGG - Intergenic
959442376 3:106393301-106393323 AATTTGCCTCCTCTTTAGAATGG - Intergenic
960564975 3:119123261-119123283 TTCTTCCCTCCTCTTTACACAGG - Intronic
960634375 3:119768692-119768714 CTCCTGCCTGCTCTGTGGAGTGG + Intergenic
961695600 3:128701941-128701963 ATTTTGCCTCCACTTTAGAATGG - Intergenic
961791272 3:129378447-129378469 CTCCTGCCTGCTCTGTGGAGTGG + Intergenic
962824640 3:139089043-139089065 CTCCTGCCTGCTCTGTGGAGTGG + Intronic
962862577 3:139418594-139418616 TTCTTCCCTCCTCTTTACAAAGG + Intergenic
963223082 3:142832380-142832402 CTCCTGCCTCATCTGTATAGAGG + Intronic
964675248 3:159271172-159271194 CTCTTTCCACCTTTGTAGAGAGG + Intronic
964702275 3:159581618-159581640 CTCTCCCCTTCTCTGTAGAGGGG - Intronic
965096733 3:164238631-164238653 CTCTTGCATCTTCTTAAAAGAGG - Intergenic
966255964 3:177917366-177917388 CTCCTGCCTGCTCTGTGGAGTGG - Intergenic
969696859 4:8739959-8739981 CTCTTGGGGCCTCTTTAGAGGGG - Intergenic
970163296 4:13210581-13210603 CTTTGGCCTCCTCCTGAGAGAGG + Intergenic
970534344 4:17013929-17013951 CTCATGCCTCCTATGTAGACAGG + Intergenic
971567778 4:28167802-28167824 TTCTTGCCTCCTCTTTCCAAAGG + Intergenic
971866278 4:32176759-32176781 CTCTTTCAGCCTCTTTGGAGTGG + Intergenic
972339181 4:38136300-38136322 CTCATTCCTCCTCTGTAGGGTGG + Intronic
972703089 4:41513526-41513548 CTCCTAACTCTTCTTTAGAGAGG + Intronic
972931171 4:44072613-44072635 CTCCTGCCTGCTCTGTGGAGTGG + Intergenic
973751464 4:54024316-54024338 CTCTTGCCTCCCTCTTGGAGTGG + Intronic
973822806 4:54677539-54677561 CTCTTGCCTCCTCTTTCCTCGGG + Intronic
974396027 4:61336512-61336534 CTCTTGACTGCTTTTTAGAGAGG - Intronic
974498858 4:62670947-62670969 CTCTTGCTTCTTCTTTTGATTGG + Intergenic
975313077 4:72925226-72925248 CTCTTCCCTCCCCTTTACACAGG + Intergenic
975502214 4:75099751-75099773 CTCTTCCCTCCACTTTACAAAGG + Intergenic
975699965 4:77055024-77055046 CTCTTGTCTACTCTTAAGAATGG + Intronic
977558034 4:98504549-98504571 CTCTTGCCCCATATTAAGAGTGG + Intronic
977558169 4:98505518-98505540 CCCATGCCACCTCCTTAGAGAGG + Intronic
977697038 4:99977152-99977174 CTTTTGCCTACTTTTTAAAGGGG - Intergenic
979145277 4:117239582-117239604 CTCTTGCTTGCTCTATGGAGTGG - Intergenic
980660759 4:135855220-135855242 CTCTTTCCTCCTCTTTCCAGAGG + Intergenic
980834950 4:138179766-138179788 CTCTTGACTCCACATTAAAGTGG - Intronic
981482557 4:145253839-145253861 CTCTTGACTCCCTTTTGGAGTGG - Intergenic
981996208 4:150977814-150977836 CTCTTCCCTCCTGTTTACATAGG - Intronic
982326377 4:154133434-154133456 CCCTTGCCTCTTCTTTACATTGG - Intergenic
982445247 4:155483427-155483449 CTCTTGCATCCTCATGTGAGAGG + Intergenic
982827249 4:160016911-160016933 CTTTTGCTTCCTGTTTAGAGGGG - Intergenic
984897733 4:184556792-184556814 CTTTTGCCTCCTTTTTAATGGGG - Intergenic
985105113 4:186492142-186492164 CTCTTCCCTTCTCTTTCTAGAGG + Intronic
988868462 5:35361486-35361508 CTCCTGCCTCCTTTTTCTAGAGG + Intergenic
988959591 5:36356497-36356519 CTCTGTCCTCCTATTTGGAGAGG - Intergenic
990266545 5:54082762-54082784 CTCAAGCCTCATATTTAGAGGGG + Intronic
990563648 5:57007900-57007922 CTCTTGAGTCCTCTTTAGCATGG - Intergenic
990955554 5:61334674-61334696 CTCTTTCCTTCTGTCTAGAGGGG + Intronic
992011706 5:72534096-72534118 CCCCTTCCTCCTCTTTAGAAAGG - Intergenic
994766815 5:103928727-103928749 CTCTTGTCTCCTTTGTAGTGGGG + Intergenic
994766868 5:103929392-103929414 CCCTTGCCTCTTCTTCAGAGAGG - Intergenic
994853875 5:105091385-105091407 CTCTTTCCTCCTCTTTCCAAAGG - Intergenic
996931599 5:128895997-128896019 CTCTTCCCTCCTCTTTCTACAGG + Intronic
997193165 5:131959081-131959103 CTGTTTCCTCCTCTTTACAGAGG + Intronic
999412920 5:151367954-151367976 CTCCTGCATCCTTTTTAGAAAGG - Intergenic
1000426109 5:161093373-161093395 CTTCTGCCTGCTCTTTGGAGTGG - Intergenic
1002140585 5:177134838-177134860 CTTTTTCCTCCTCTGTAGACTGG - Intronic
1003046720 6:2740162-2740184 CTATTTCCTCCACTTTACAGTGG - Intronic
1006360599 6:33585038-33585060 CTGTTTCCTCGTCTTTAAAGTGG + Intergenic
1006391515 6:33761645-33761667 CTCTCCCCTCCTCTCCAGAGTGG + Intergenic
1007237761 6:40403322-40403344 CACATGTCTGCTCTTTAGAGTGG + Intronic
1007372996 6:41439056-41439078 CTCTGGCCTCCTCTGTAGCTAGG - Intergenic
1008616987 6:53235986-53236008 TTCTTGTCTCCCCTTTAGAAGGG + Intergenic
1008713010 6:54252625-54252647 CTCTGGCCTCCTCATAGGAGTGG + Intronic
1009273425 6:61644625-61644647 CTTTTGCCTACTTTTTAAAGGGG - Intergenic
1010483519 6:76382310-76382332 CTCTTTCCTCCTCTTTCCAAAGG + Intergenic
1012566167 6:100655594-100655616 CTCTTGCCTCATCTGAAAAGAGG - Intronic
1013687511 6:112601946-112601968 CTCTTCCCTCCTCTTTCCACAGG - Intergenic
1013895102 6:115078644-115078666 CTCTAGCCTTCCCTTAAGAGGGG + Intergenic
1013925569 6:115468022-115468044 CTCTTCCCTCCTCTTTCCAAAGG + Intergenic
1014049581 6:116936465-116936487 CTCTTGTCTCCTTTTTGGAGGGG - Intergenic
1014189033 6:118470588-118470610 CTCTTCCATCATCTTTTGAGTGG + Exonic
1014688178 6:124529988-124530010 CTCTGGCCTCTTCTTATGAGAGG - Intronic
1015786571 6:136924509-136924531 CTCTTGCCTGCTCTCCTGAGCGG - Exonic
1015974853 6:138779371-138779393 ATCTTCCCTTCTCTTTAGACGGG + Intronic
1016190625 6:141260868-141260890 CTCCTGCCTCCTCCATGGAGTGG - Intergenic
1019296172 7:276549-276571 CTCCTGCCTGCTCTGTAGAGTGG - Intergenic
1020794571 7:12664350-12664372 CTCTTGACTCCCTCTTAGAGTGG + Intergenic
1022056991 7:26747456-26747478 CTCCTCCCTCCTCTGTAAAGTGG + Intronic
1022423569 7:30246493-30246515 CTCCTGCCTGCTCCCTAGAGCGG + Intergenic
1022741074 7:33122457-33122479 CTCTTTCCTCCTCTTTCCAAAGG + Intergenic
1023790557 7:43750062-43750084 CTCCTGCCTGCTCCCTAGAGTGG + Intergenic
1024662370 7:51510767-51510789 CTCTTCCCTCCCCTTTACACAGG + Intergenic
1024685844 7:51744429-51744451 TTGTTGCATCCTCCTTAGAGTGG - Intergenic
1024976328 7:55117272-55117294 GTCTTGCCACCTTTTTAGATCGG + Intronic
1027611975 7:80372861-80372883 CCCTTGCCTCCTCTTGCAAGTGG - Intronic
1029206272 7:98870897-98870919 CTCTTGCCCCTTCTTGATAGAGG + Intergenic
1031265191 7:119572428-119572450 CTCCTGCCTGCTCTGTGGAGTGG - Intergenic
1033691384 7:143740691-143740713 CTCTTGCCTCCCCTTTCCAAAGG - Intergenic
1033997724 7:147372514-147372536 CTCTTGACTTCTGTTAAGAGTGG - Intronic
1035288378 7:157820972-157820994 CTCTTGCCTCCCCTCCAGCGTGG - Intronic
1035911363 8:3570551-3570573 TTCCTGCCCCCTCTCTAGAGCGG - Intronic
1036176865 8:6547600-6547622 CACTTGCCTCATCAGTAGAGGGG + Intronic
1037063638 8:14548142-14548164 CTGTTTCTTCCTCTGTAGAGTGG - Intronic
1037940096 8:22944796-22944818 CTGTTTCCTCATCTTTAGAGTGG + Intronic
1038262844 8:26012487-26012509 TTCTTGCCTTCTTCTTAGAGTGG + Intronic
1038688702 8:29742089-29742111 CTCTTTCCTCATCTGTAGAATGG - Intergenic
1038871834 8:31503742-31503764 CTCTTCCCTCCTCTTTCCAAAGG + Intergenic
1039282054 8:35996931-35996953 CTCTTCCCTCCTCTTTCCAAAGG + Intergenic
1039289915 8:36083213-36083235 CACATGTCTGCTCTTTAGAGTGG + Intergenic
1041745952 8:61209659-61209681 CTCTTTCCTCCTCTCTTCAGAGG - Intronic
1045590002 8:103582701-103582723 CTCTTCCCTCCTCTTTCCAAAGG - Intronic
1045843924 8:106611146-106611168 TACATACCTCCTCTTTAGAGGGG - Intronic
1046048377 8:108989571-108989593 CTTTTGCCTGCTATATAGAGGGG + Intergenic
1046361543 8:113164971-113164993 ATTTTGCTTCGTCTTTAGAGTGG + Intronic
1046384051 8:113486244-113486266 CTCTTCCCTCCTCTTTCCACAGG + Intergenic
1047510110 8:125509381-125509403 CAGTTTCCTCCTCTGTAGAGTGG - Intergenic
1051800046 9:20922396-20922418 CTCTCCCTTCCACTTTAGAGTGG - Intronic
1052214583 9:25950944-25950966 CTCTTCCCTCCCCTTTACAAAGG + Intergenic
1052403576 9:28031585-28031607 CACTTTCCTCATCTTTAAAGTGG + Intronic
1055414559 9:76066930-76066952 CCCTTCCCTCATTTTTAGAGAGG - Intronic
1057092692 9:92273854-92273876 CTTTTGCCTCCTCTGTAGCATGG - Intronic
1057815668 9:98292281-98292303 CTCTTCCCTCTTCTTTATAATGG - Intronic
1058241655 9:102569666-102569688 CTCTTCCCTCCTCTTTCCAGAGG - Intergenic
1058952250 9:109914903-109914925 CTCTTGCCTCCTCTTTTAGTTGG + Intronic
1059463367 9:114449510-114449532 CTCTGGCCTGGTCTTTACAGCGG - Intronic
1061199046 9:129125657-129125679 CTGTTTCCTCATCTGTAGAGTGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1187966337 X:24616016-24616038 CCTTTGTCTCCTCTTTAGAAAGG + Intronic
1189856516 X:45229691-45229713 CTCCTGCCTGCTCTGTGGAGTGG + Intergenic
1193911929 X:87316776-87316798 CTCTTTCCTCCCCTTTACACAGG + Intergenic
1195126403 X:101813402-101813424 CTCTTGCCTGCTCCCTGGAGTGG - Intergenic
1195179179 X:102339934-102339956 CTCTTGCCTGCTCCCTGGAGTGG + Intergenic
1195977499 X:110543489-110543511 CTTTTTCCTCATCTTTAGAATGG + Intergenic
1196982077 X:121225798-121225820 CCCTTGCCTACTCTTTAATGAGG + Intergenic
1197052514 X:122077133-122077155 CTCTTTCCTCCTCTTTCTACAGG + Intergenic
1197096736 X:122604895-122604917 CTCTTGCCTCCCCTTTCCAAAGG - Intergenic
1197366925 X:125574433-125574455 CTTTTGCCTACCTTTTAGAGAGG - Intergenic
1197399737 X:125975049-125975071 CTCTTCCCTCCCCTTTTCAGTGG - Intergenic
1198701771 X:139404816-139404838 CTCTTTCCTTCTCTGTAGAATGG - Intergenic
1198818016 X:140614074-140614096 CTCTTCCCTCCTCTTTCCAAAGG + Intergenic
1199441035 X:147867620-147867642 CTATTCCCTCCTCTTTCCAGAGG - Intergenic
1199488511 X:148373506-148373528 CCCTAGCCTCCTGGTTAGAGAGG - Intergenic
1201927770 Y:19308134-19308156 CTCTTTCCTCTTCTTTACAAAGG + Intergenic