ID: 1178085235

View in Genome Browser
Species Human (GRCh38)
Location 21:29105556-29105578
Sequence ATTTATCTGGAGAAGTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178085231_1178085235 0 Left 1178085231 21:29105533-29105555 CCTTGAGGAAGGAGTGTGTAATT 0: 1
1: 0
2: 1
3: 25
4: 208
Right 1178085235 21:29105556-29105578 ATTTATCTGGAGAAGTGGGATGG 0: 1
1: 0
2: 1
3: 32
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178085235 Original CRISPR ATTTATCTGGAGAAGTGGGA TGG Intronic
901759523 1:11461686-11461708 AATTATTTTGTGAAGTGGGAGGG + Intergenic
901774671 1:11552100-11552122 ATAAAGTTGGAGAAGTGGGAGGG + Intergenic
904058941 1:27691664-27691686 AATTATCTTGAGAACTGGAAAGG - Intergenic
904506309 1:30957765-30957787 ATTTTTCTTTAAAAGTGGGAAGG - Intronic
907814125 1:57901523-57901545 ATTTATTTGTAGCAGTGAGAGGG - Intronic
909660483 1:78076433-78076455 ATGTATTGGGACAAGTGGGATGG + Intronic
910182071 1:84495872-84495894 ATTTTTCTAGAGAAGAGGCAAGG + Exonic
911554639 1:99328923-99328945 AGTCTTCTGCAGAAGTGGGAAGG - Intergenic
911635929 1:100236353-100236375 GTTAACCTGGAAAAGTGGGAGGG - Intronic
913073216 1:115319563-115319585 ATTTCTTTGGAGAAGTGGAATGG + Intronic
914695334 1:150072884-150072906 ATTTATTTTTTGAAGTGGGAAGG + Intronic
914786814 1:150840664-150840686 AGTTAACTGGAGGAGTGGAATGG + Intronic
916601480 1:166297539-166297561 ATTTTTCTGGAGCATGGGGAGGG + Intergenic
916608606 1:166367578-166367600 AGTTATCTGGAAAAATGAGATGG + Intergenic
917619700 1:176783591-176783613 ATTTGTCTGGAGAAGTTAGAGGG + Intronic
918127853 1:181600108-181600130 AGAAATCTGCAGAAGTGGGAGGG + Intronic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
919741506 1:200983901-200983923 ATTTCTGTGGAGAGGTGGGGAGG + Intronic
920291833 1:204928981-204929003 ATTAAGCTGGGGAAGAGGGAAGG - Intronic
920318478 1:205097715-205097737 ATTTATGTGGAAATCTGGGAAGG + Intronic
920562176 1:206946741-206946763 TTTCATCTGGAAAAGAGGGATGG + Intergenic
921430347 1:215058183-215058205 ATTTATCTAGTGAAGGGGCATGG - Intronic
921533986 1:216322147-216322169 ATTTATCTGGAAATGTCAGAAGG + Intronic
921584161 1:216928348-216928370 ATTGAAATGGAGGAGTGGGATGG - Intronic
921837797 1:219795630-219795652 ATATCTCTGGGGAAGTGTGATGG - Intronic
922861105 1:228817237-228817259 ACTAAACTGGAGAAGTGAGAAGG + Intergenic
922871187 1:228903275-228903297 TTTTATCTGGAGCAGTGCCATGG + Intergenic
922883061 1:228997144-228997166 TTTAATCTGGGGAAGTGGCATGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1065244330 10:23742239-23742261 ATTGATAGGGAGAAGTGTGAGGG + Intronic
1065352504 10:24808047-24808069 AATTATATGGAGAAGTAGAATGG + Intergenic
1066411582 10:35175481-35175503 ATTTCTCTGAAGAAGTTAGAGGG + Intronic
1067185313 10:44022193-44022215 AATTAGCTTGAGAAGAGGGATGG + Intergenic
1071236940 10:83660184-83660206 ATTGATCTAGAGAAGAGAGAAGG - Intergenic
1071479290 10:86052306-86052328 ATTTATCTGAGGGAGTGGGGAGG + Intronic
1071572208 10:86703593-86703615 ATGGAGCTGGAGAAGTGGCAAGG - Intronic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072785472 10:98276938-98276960 ATTTGACTGGAGCAGTGGGTGGG - Intergenic
1075995925 10:126876314-126876336 ATGGATCTGGAAAGGTGGGAAGG - Intergenic
1076035887 10:127197657-127197679 ATGTGTCTGGAGAGGTGGGTGGG - Intronic
1076310522 10:129503277-129503299 CTTTATCTCGGGAAGTGGCAGGG - Intronic
1078534991 11:12165761-12165783 ATCTATTTGGAGAAGAAGGACGG + Intronic
1078983289 11:16562713-16562735 ATTCTGCGGGAGAAGTGGGAGGG - Intronic
1079551331 11:21702333-21702355 ATTTGTCTGAAGATGGGGGAAGG - Intergenic
1080898746 11:36467593-36467615 TTCTATCTGGAGAAGTGAGGAGG - Intergenic
1083019240 11:59489456-59489478 ATTTATCAGGGCAAGTGAGAAGG - Intergenic
1085922778 11:80978792-80978814 ATATATATGGGCAAGTGGGATGG + Intergenic
1086609023 11:88731206-88731228 ATGAAGCTGGAGAAGTGGGCAGG - Intronic
1087006136 11:93473859-93473881 ATGTCTCTGGAGAATTGGGGTGG + Intergenic
1088842438 11:113638349-113638371 ACTTTTCTGAATAAGTGGGATGG - Intergenic
1088870195 11:113884254-113884276 ATTTATCTGGCCAGGTGGCAAGG + Intergenic
1090667335 11:128923452-128923474 AGTTACCTGGGGAAGTGGGAAGG + Intergenic
1091061107 11:132463013-132463035 ATTAATCTGGATAATTGGTAAGG - Intronic
1093647841 12:21609196-21609218 ATGAACCTGGAGAAGTGGGAAGG + Intergenic
1093829743 12:23740748-23740770 ATTTAACTGGGGAGGTGGAAGGG + Intronic
1096390878 12:51228205-51228227 GTATATTTGAAGAAGTGGGATGG + Intergenic
1098075430 12:66724789-66724811 CTTTGTCTGCAGAAGTGGAAGGG + Intronic
1099552917 12:84071003-84071025 ATTCTTCTTGAGAAGTGGGGGGG + Intergenic
1099925257 12:89009152-89009174 ATTTTTGTGGAGAAGAGGGGAGG - Intergenic
1100157951 12:91823140-91823162 TTTTACCTGGAGAAGTGCCATGG - Intergenic
1100176730 12:92039054-92039076 GTGTATCTGTAGAAGTTGGAAGG - Intronic
1105342556 13:19541084-19541106 AGTTATCTGAAGCTGTGGGATGG + Intergenic
1107003040 13:35573628-35573650 ATTCAGCTGGCTAAGTGGGAAGG - Intronic
1107740965 13:43450250-43450272 GTTTATTTGGAGAGGTGTGAGGG - Intronic
1108556643 13:51600014-51600036 AGCTATCTGGAGATGAGGGAGGG - Intronic
1108789512 13:53950486-53950508 ATTTATCTGGATTATTGAGATGG + Intergenic
1109559443 13:64027469-64027491 ATTATTCTGGGGAAGTAGGAGGG + Intergenic
1109572319 13:64209147-64209169 TTGTATCTGGAGAAGTGGATAGG - Intergenic
1111456715 13:88493960-88493982 CTTTATCTGGAGAGGTTGGTTGG - Intergenic
1113773376 13:112927109-112927131 GTTTAGCTGGAGAAGTGGGGAGG + Intronic
1114173031 14:20293658-20293680 ACCTATCTGGAGAAGTGATAAGG + Intronic
1115069818 14:29307507-29307529 ATTTCTGAGGAGAGGTGGGAAGG + Intergenic
1116427648 14:44809888-44809910 ACTTATCTGGCAAAGTGGAAAGG - Intergenic
1118234926 14:63993724-63993746 CTTTAACTGGTAAAGTGGGAAGG - Intronic
1119116951 14:72032188-72032210 AATTAATTGGGGAAGTGGGAAGG + Intronic
1119794195 14:77380932-77380954 ATTCATGTGGAGGAGTGGTAGGG - Intronic
1120051596 14:79873408-79873430 TTTTATCTGGAGAAATGTGGAGG - Intergenic
1120548165 14:85835849-85835871 ATTTTTCTAAAGAAGTGGGATGG + Intergenic
1121688732 14:95859113-95859135 ATTTACCTGGAGGAATGGGACGG - Intergenic
1121747109 14:96305596-96305618 TTTTAGCCGGAGAAGTGGGAGGG + Exonic
1122658369 14:103278396-103278418 ATTCATCTCGAGAAGTCGAAAGG - Intergenic
1202830769 14_GL000009v2_random:26913-26935 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1123674175 15:22692020-22692042 AACTATCTGGAGTGGTGGGATGG + Intergenic
1124326185 15:28765006-28765028 AACTATCTGGAGTGGTGGGATGG + Intergenic
1124908566 15:33895706-33895728 ATTTATCTGGTGGAGTTGGTGGG - Intronic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1127976768 15:64003335-64003357 ATTAATCTGCATTAGTGGGAAGG + Intronic
1129195160 15:73960110-73960132 ATTTTTGTGAAGAAGTGGAAGGG - Intergenic
1129889017 15:79058736-79058758 ATTTATCTTTAAAAGTGGGTGGG - Intronic
1130603138 15:85291642-85291664 ATATAACTGGAGAAGGAGGAGGG + Intergenic
1130689833 15:86072535-86072557 ATTTATCAGGAAAGATGGGAGGG + Intergenic
1131457540 15:92595018-92595040 GTTTATCAGGTGAAGTGGGGTGG + Intergenic
1131933100 15:97467975-97467997 ATGTATCTGCAGGAGGGGGATGG + Intergenic
1132044410 15:98551230-98551252 ATTTGTGTGGTGAACTGGGAAGG + Intergenic
1133076643 16:3285249-3285271 AGTTATCTGGGCAGGTGGGAGGG + Intronic
1133546409 16:6812002-6812024 ATTTATCTGGAGAAATGGCATGG - Intronic
1134323085 16:13181504-13181526 ATGTGTCTGGAGAAGTTGGTAGG + Intronic
1134690959 16:16190870-16190892 ATGGAGCTGGAGAAGAGGGAGGG + Intronic
1135106868 16:19657419-19657441 GTTTATCTGCAGAAATGGGAAGG - Intronic
1135776196 16:25258716-25258738 ATGGAATTGGAGAAGTGGGAGGG + Intergenic
1138441084 16:57035379-57035401 TTTTATCCTGAGCAGTGGGAAGG - Intronic
1139766314 16:69233332-69233354 TTTTGTCTGAAGAACTGGGAGGG - Intronic
1141223558 16:82093851-82093873 AGTTTTCTGGGAAAGTGGGAGGG + Intronic
1141277248 16:82599597-82599619 ATTTATCTAGGGCAGAGGGAAGG + Intergenic
1141739629 16:85882420-85882442 ATGTTTCTGGAGAAGTGGCAGGG - Intergenic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143346885 17:6256271-6256293 ATGTATGTGGAGAAGAGGGAGGG + Intergenic
1147334535 17:39719456-39719478 CGTTCTCTGGAGAAGTGGTATGG + Intronic
1147521324 17:41176175-41176197 AACTATCTGGAGAAGTGTGCAGG - Intergenic
1148536392 17:48442587-48442609 ACTTACCTAGAGAAGTTGGAAGG - Intergenic
1148660574 17:49328280-49328302 AGTCAGATGGAGAAGTGGGAAGG + Intronic
1149495364 17:57114088-57114110 ATTCATCAACAGAAGTGGGAGGG + Intronic
1150901983 17:69289591-69289613 ATGTATGTGTGGAAGTGGGAGGG + Intronic
1150954688 17:69844115-69844137 AGTTACCTGAAGATGTGGGATGG + Intergenic
1151491405 17:74433885-74433907 TTTGCTCTGGAGAAGTGAGAAGG + Intronic
1155354575 18:24939957-24939979 ATTTATCTGGAAAAGAATGAGGG - Intergenic
1155359673 18:24987694-24987716 ATTCTTCTGGAGCAGTGGGAGGG + Intergenic
1155468689 18:26168163-26168185 ATTGCTCTGGAGAATTAGGAGGG - Intronic
1156198268 18:34800885-34800907 ATTTATATGGAAAAGTTGCAGGG - Intronic
1156897024 18:42257358-42257380 CTTTATCCAGAGAAGAGGGAGGG - Intergenic
1157204159 18:45684372-45684394 ATTTTTCTGGAGAAGTCATATGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157751918 18:50186766-50186788 CTTTATCTGAAGAATTGGGGTGG - Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158457866 18:57623287-57623309 ATTTTTGTGGAGATGGGGGAGGG + Intergenic
1160042615 18:75359634-75359656 ATTTGTCTTAAGAAGTGGAAGGG + Intergenic
1162410189 19:10501135-10501157 GTCAATCTGGAGAATTGGGAAGG + Intronic
1163257902 19:16168611-16168633 ATTTTTCTGAAAAATTGGGAGGG + Intronic
1164404144 19:27927548-27927570 ATTTTTGTGCAGAAGTGGAAAGG - Intergenic
1164703458 19:30302754-30302776 GTTTATCTGGAGGATTGGGATGG - Intronic
1167384379 19:49155482-49155504 ATTTAGCTGGAGAGAGGGGAGGG - Intergenic
1202641924 1_KI270706v1_random:100863-100885 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
926115212 2:10208910-10208932 CTTGAGCTGGAGAGGTGGGAGGG - Intronic
926367975 2:12151077-12151099 ATATATCTGGAGATGTGCCATGG - Intergenic
929200292 2:39228142-39228164 CTTTATCTGAAGACTTGGGACGG + Intronic
929622454 2:43369270-43369292 ATTCATGTGGAGAAGTGGGCAGG - Intronic
929716842 2:44320493-44320515 ATTTTTCTGGACAAGGGAGAGGG + Exonic
930848067 2:55926803-55926825 ATTTTTCTGGAAAAGTGGCTGGG - Intergenic
933997030 2:87677611-87677633 ATTTCTCTAGATAAGTGGAAAGG + Intergenic
935616006 2:105082604-105082626 CTTTCTCTGGAGAAATGGGGAGG + Intronic
938076572 2:128341449-128341471 ATGTAACTGCAAAAGTGGGAAGG - Intergenic
938182694 2:129197207-129197229 ACTTCTCTGAAGAAGTGGAATGG + Intergenic
939716980 2:145596120-145596142 AAATATCAGCAGAAGTGGGAGGG - Intergenic
939760172 2:146165758-146165780 TTTTATCAGGAGAAGTGGAAGGG + Intergenic
940911627 2:159214856-159214878 ATTTTTCTGGAGAAATGTGGTGG + Intronic
941029917 2:160499524-160499546 ATGAATCTGGAAAAATGGGAAGG - Intergenic
941236106 2:162976303-162976325 ATATATTTAGAGGAGTGGGAAGG + Intergenic
941706151 2:168660281-168660303 CTTTATTTGGAGAGGTGGGAAGG - Intronic
942339447 2:174928023-174928045 AGTTGTCTGGAGAAGTAGAAGGG + Intronic
942778384 2:179612608-179612630 AGTTATCTGGAGCTGGGGGATGG + Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943346350 2:186742377-186742399 ATTAAATTGGAGAGGTGGGAGGG - Intronic
943604428 2:189960384-189960406 ATTAATTTGGAGAAGAGGGGAGG - Intronic
943785289 2:191871026-191871048 ATTTATAAGGAAAAGTGGAAGGG - Intergenic
944681792 2:202084077-202084099 ATATACCTGGGGAAGTGGGTGGG + Intronic
945650621 2:212554398-212554420 ATGAATCTGGAGAGGTAGGATGG + Intergenic
945695186 2:213093273-213093295 ATGTATCTGGAGAGGTGAGAAGG - Intronic
945799216 2:214404820-214404842 ATTTGGCTGGAGATATGGGAAGG + Intronic
946814039 2:223557690-223557712 ATATATATGCAAAAGTGGGATGG - Intergenic
947846561 2:233249139-233249161 ATTAATTTGGAGAAGTCAGAAGG + Intronic
1168984186 20:2033756-2033778 ATTTATTTACAGAGGTGGGAGGG + Intergenic
1169112706 20:3044119-3044141 ATGGACCTGGACAAGTGGGAGGG + Intronic
1170487041 20:16828866-16828888 ATTTCAGTGGGGAAGTGGGAAGG + Intergenic
1171889039 20:30691053-30691075 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1172886899 20:38237441-38237463 ATTTATCTGGGTAAGTGTGAAGG + Intronic
1175372417 20:58500895-58500917 GTGCATCTGGAGGAGTGGGAGGG - Intronic
1176609956 21:8871751-8871773 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1177020806 21:15855072-15855094 ATATATGTGTAGAGGTGGGAGGG + Intronic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1178085235 21:29105556-29105578 ATTTATCTGGAGAAGTGGGATGG + Intronic
1178996004 21:37400417-37400439 AATTATTTGGAAAAGTAGGAAGG + Intronic
1180360021 22:11881002-11881024 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1181997325 22:26893052-26893074 ATTTAGCTGCAGATGTGGGCAGG - Intergenic
1182229403 22:28825809-28825831 ATATATTAGGAGAAGGGGGAAGG + Intergenic
1183454997 22:37917802-37917824 AGATACCTGGAGAGGTGGGAGGG + Intronic
1184204904 22:42995896-42995918 ATTTTTCTGGAGACTGGGGAAGG - Intronic
1184650197 22:45916125-45916147 ACCCATCTGGAAAAGTGGGATGG + Intergenic
1184673151 22:46026188-46026210 GTATATCTGGAGAAGCTGGAAGG + Intergenic
950133540 3:10564372-10564394 ACTTAGCTGGAGAATAGGGATGG - Intronic
950473333 3:13199770-13199792 ATTTGCCTGGAGCAGAGGGAAGG - Intergenic
951143933 3:19203212-19203234 AAATATCTTGAGAAATGGGAAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953939462 3:47079374-47079396 AACTATCTTGAGAGGTGGGAGGG - Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
956477929 3:69642978-69643000 ATTTCTCTGGTGAAATGGGAAGG + Intergenic
957195406 3:77061232-77061254 ATTTATTAGGAGAAGTCTGAAGG + Intronic
957831761 3:85530623-85530645 ATTTATATAGAAAAGTGGGCCGG - Intronic
958500329 3:94897783-94897805 ATTTTTCAAGAGAGGTGGGATGG - Intergenic
959557918 3:107744068-107744090 ATTATTCAGGAAAAGTGGGAAGG + Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
961147166 3:124603858-124603880 ATTATTCTAGAGAGGTGGGAGGG - Intronic
962233779 3:133691042-133691064 ATTTATAAGAAAAAGTGGGATGG + Intergenic
962463869 3:135639097-135639119 ATTTATGTGGAGAAGAGAGATGG - Intergenic
962664831 3:137643277-137643299 ATTTATCTGGATGAGCAGGAGGG - Intergenic
963124381 3:141801753-141801775 AATAGTCAGGAGAAGTGGGAAGG + Intronic
963599687 3:147367831-147367853 ATTCAGGTGGAGAAGAGGGAGGG - Intergenic
963639412 3:147839787-147839809 ATTGGCGTGGAGAAGTGGGAAGG + Intergenic
966068382 3:175844125-175844147 ATAAATCAGGACAAGTGGGATGG + Intergenic
966285527 3:178290909-178290931 AATTACCTGGAGTGGTGGGAAGG - Intergenic
966451899 3:180072928-180072950 CTGTATTTGGAGAAGAGGGAGGG + Intergenic
1202736642 3_GL000221v1_random:6541-6563 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
968822492 4:2865679-2865701 ATTTTTCTGGAGCAGGGGGAAGG - Intronic
969663247 4:8542692-8542714 AATGGTCTGGAGCAGTGGGATGG + Intergenic
970034396 4:11716071-11716093 ATTCACCTGGAGAAGGGAGAGGG - Intergenic
971389597 4:26173603-26173625 AGTTATCTGGAGTCGTGGGTGGG - Intronic
974433500 4:61828838-61828860 ATTTAACAGGAGAAGGGGCAGGG - Intronic
975653203 4:76614956-76614978 TTTTTTCTGGAGAAGAGGGAAGG - Intronic
975654923 4:76632014-76632036 TTTTATCTGAATAATTGGGATGG + Intronic
975695514 4:77008935-77008957 CTTTAGATGGAGAAGTGGAAAGG + Intronic
976013869 4:80525768-80525790 AGTTATCTGAAGAAGTGAGCTGG - Intronic
977744197 4:100525697-100525719 ATTTATTTCGAGAAGTTGGATGG - Intronic
983367351 4:166810026-166810048 ATTTTTATGGAGAAGCGGGTAGG - Intronic
983762873 4:171434973-171434995 ATTTATATTCAGTAGTGGGATGG - Intergenic
985135842 4:186785338-186785360 ACATATCTCCAGAAGTGGGATGG + Intergenic
1202769292 4_GL000008v2_random:186728-186750 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
989646104 5:43634169-43634191 ATGTCTCTGGAGAATTGGGTGGG + Intronic
990534186 5:56704011-56704033 TTTTCTCTGGGGCAGTGGGAAGG - Intergenic
991037143 5:62138787-62138809 CTTGGTCTGGAAAAGTGGGAGGG + Intergenic
991232220 5:64347405-64347427 AACTATCTGGAGAAGAGGGAAGG + Intronic
992834471 5:80626529-80626551 ATTGCTCTGGAGAATTAGGAGGG - Exonic
993247424 5:85468348-85468370 ATTGATATGGAGAAGTGTGGAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994609028 5:102012301-102012323 ATTTATTTGAAGAAATGGAAAGG - Intergenic
995680043 5:114705683-114705705 ATTTGACTGTAGAAGTGGGCAGG + Intergenic
997271413 5:132541318-132541340 ATTTCTCTGGAGAAGTCTCAAGG - Intergenic
997608594 5:135194235-135194257 ATTTATCTGGAGAGGAAAGAAGG + Intronic
998513757 5:142735004-142735026 ATTTATCTGCAGAAAGGAGAAGG + Intergenic
1001897172 5:175392573-175392595 ATCTATCTGAACAAGAGGGATGG - Intergenic
1002884945 6:1285289-1285311 AATAATCTGGAGAAGTGAGTTGG + Intergenic
1003476014 6:6483661-6483683 ATATATGTTCAGAAGTGGGATGG - Intergenic
1005088898 6:22035468-22035490 ATTCCTCTGGTGCAGTGGGAAGG + Intergenic
1005227537 6:23659838-23659860 GTTTGTGTGGAGAAGTGGGCTGG - Intergenic
1006053618 6:31363765-31363787 ATTGCTCTGGAGAATTAGGAGGG - Intergenic
1006231003 6:32586700-32586722 ATTTATGTGGAGAAATCCGAAGG - Intronic
1007304410 6:40892835-40892857 AAATATGTGAAGAAGTGGGAAGG - Intergenic
1008469076 6:51862742-51862764 ATTTTCCAGGAGAGGTGGGAAGG + Intronic
1008595179 6:53035030-53035052 CTTTGGCTGGAGAAGTGGGCAGG + Intronic
1008678954 6:53851829-53851851 ATTTATGTGCAGTTGTGGGAAGG - Intronic
1009281005 6:61751613-61751635 TTTTGTCTGGAAAAGTAGGAAGG + Intronic
1009931541 6:70182251-70182273 ACTAATCTAGAGAAGTGTGAGGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011074222 6:83420839-83420861 ATTTCTCTGTGGATGTGGGAAGG - Intronic
1011140878 6:84154926-84154948 ATTTATCTAGAGAAGGGTAAGGG - Intronic
1012642499 6:101636917-101636939 TTCTATGTGGTGAAGTGGGAAGG + Intronic
1013277486 6:108599780-108599802 ATTTGTCTGAAGAAATGGGATGG - Intronic
1013485821 6:110595174-110595196 ATTTATCTGGAGCTGAGGAAGGG + Intergenic
1014466122 6:121759120-121759142 ATTTACCTTAAGAATTGGGAAGG + Intergenic
1015392692 6:132700676-132700698 ATTTAAATGGAGATGTGTGAGGG - Intronic
1015778574 6:136839948-136839970 ATTTGTCTGGGGAAGGGGCAGGG + Intronic
1016832429 6:148447082-148447104 ATTTATCTGTAGAGGCAGGAAGG + Intronic
1017234332 6:152103875-152103897 ATTTAACTGATGAATTGGGAGGG + Intronic
1017273143 6:152532890-152532912 AGTAATATAGAGAAGTGGGAAGG + Intronic
1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG + Intronic
1020081719 7:5289739-5289761 CTTTATCTGGAGAGGAGGCATGG - Intronic
1021982224 7:26065960-26065982 CTTTCTTGGGAGAAGTGGGATGG - Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1025197189 7:56942410-56942432 CTTTATCTGGAGAGGAGGCATGG + Intergenic
1025674759 7:63634529-63634551 CTTTATCTGGAGAGGAGGCATGG - Intergenic
1028238553 7:88390623-88390645 ATTGATTTGCAGAAGTGGAATGG + Intergenic
1029661670 7:101966552-101966574 ATTTTTCTGGGAAAGTGGGAAGG + Intronic
1030233688 7:107235310-107235332 ATTTATCTTTATAAGTGGGGAGG + Intronic
1032287075 7:130547034-130547056 ACTTATTTGGAGACTTGGGAAGG - Intronic
1032689123 7:134265117-134265139 TCTTTTCTGGAGAAGTGGGGAGG + Intergenic
1033304675 7:140215757-140215779 AGTTATCAGGAGTAATGGGACGG + Intergenic
1034825218 7:154256245-154256267 ATTTATCTTGATTAGTGGAAAGG + Intronic
1035791497 8:2309771-2309793 ATTCATCTGAAGAAGTAGAATGG + Intergenic
1035801308 8:2411934-2411956 ATTCATCTGAAGAAGTAGAATGG - Intergenic
1037135799 8:15458692-15458714 ATTTATCTTGAAAAGTCGGGAGG - Intronic
1038239466 8:25795372-25795394 ATTTACATGCAGAAGTGGGCAGG + Intergenic
1039100534 8:33937011-33937033 ATTTGTCTGGCTAAGTGTGATGG + Intergenic
1039412695 8:37368583-37368605 ATTTAACTAGAAAATTGGGAGGG + Intergenic
1039608888 8:38903545-38903567 TTTGTTCTGCAGAAGTGGGAAGG + Intronic
1040706030 8:50128523-50128545 ATTTATCTGGACATGTGTGTAGG - Intronic
1044417716 8:91954883-91954905 GTGTGGCTGGAGAAGTGGGATGG + Intergenic
1046791826 8:118330769-118330791 ATTAAACTAGAAAAGTGGGACGG + Intronic
1049141726 8:140961313-140961335 GTTTATCTGGAGATTTGGTATGG - Intronic
1049347513 8:142146681-142146703 ATGTGGCTGGAGAAGTGGGAGGG + Intergenic
1053138331 9:35665498-35665520 TCCTATCTGGAGAATTGGGACGG + Intronic
1054360421 9:64108911-64108933 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1054766153 9:69044353-69044375 ATGTCTCTGAAGAAGTGAGAGGG - Intronic
1055355301 9:75431554-75431576 ATTTGTGTTGGGAAGTGGGAAGG - Intergenic
1056207263 9:84332413-84332435 ATTGCTCTGGAGAATTAGGAGGG + Intronic
1056308208 9:85312329-85312351 GTTTATCTGGGGAAGTTGTAAGG - Intergenic
1057997648 9:99833941-99833963 AGTTGTCAGGAGAACTGGGATGG + Intronic
1059631772 9:116132213-116132235 ATATATATCCAGAAGTGGGATGG - Intergenic
1059728174 9:117029379-117029401 ACTTATCTGGAGAAGGGCAATGG - Intronic
1062589453 9:137266838-137266860 AGGTATCTGGGGGAGTGGGAGGG + Intronic
1203694180 Un_GL000214v1:80444-80466 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203705374 Un_KI270742v1:36981-37003 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1203558635 Un_KI270744v1:28824-28846 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203642093 Un_KI270751v1:23619-23641 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1185999270 X:4989630-4989652 GTTTATGTGGAGGAGTAGGATGG - Intergenic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1187585626 X:20658694-20658716 ATTAATCTAGAGAAGTGATAAGG + Intergenic
1189311055 X:40017897-40017919 CTTTATATTGAGAAGCGGGAGGG - Intergenic
1189510483 X:41656716-41656738 ATTGATCTGGGGAAGGGGGGTGG + Intronic
1190429677 X:50367230-50367252 TTTTCTCTTGATAAGTGGGAAGG + Exonic
1190869353 X:54412170-54412192 CTTTATCTGGAGGAATGGGAAGG - Intergenic
1190876730 X:54465407-54465429 ATTAGTGTGGAGAAGTAGGAAGG + Intronic
1192700351 X:73462985-73463007 ATATATCTGAAGGAGTGAGATGG + Intergenic
1193334025 X:80266161-80266183 ATGTGTCTGCAGATGTGGGATGG - Intergenic
1194280707 X:91949926-91949948 AGTGATCAGGAGAAGTGGGATGG + Intronic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1196260922 X:113580357-113580379 CTCTATCTTGAGAGGTGGGAGGG + Intergenic
1197542207 X:127778259-127778281 AATTATCTGGACAAGTATGAAGG + Intergenic
1198912109 X:141626376-141626398 ATTAATTTGGAGAAGTGGATGGG - Intronic
1199114741 X:143978103-143978125 ATTAATCTCTAGAAGTGAGAGGG - Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1200598192 Y:5173482-5173504 AGTGATCAGGAGAAGTGGGATGG + Intronic
1200713891 Y:6515875-6515897 AGTTATCTGTATAAGTGAGATGG - Intergenic
1201019934 Y:9645283-9645305 AGTTATCTGTACAAGTGAGATGG + Intergenic