ID: 1178087048

View in Genome Browser
Species Human (GRCh38)
Location 21:29122515-29122537
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1922
Summary {0: 10, 1: 113, 2: 237, 3: 403, 4: 1159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178087041_1178087048 1 Left 1178087041 21:29122491-29122513 CCAATGAAACTGGCTTTTAGTGG 0: 1
1: 1
2: 7
3: 55
4: 178
Right 1178087048 21:29122515-29122537 ATGGAGAGCTGGAAAGGGGATGG 0: 10
1: 113
2: 237
3: 403
4: 1159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900031185 1:374078-374100 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900031200 1:374127-374149 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900051754 1:602327-602349 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900096949 1:943683-943705 CTGAAGACCTGGAAGGGGGAGGG - Exonic
900151932 1:1182615-1182637 CTGAGGAGTTGGAAAGGGGAGGG + Intronic
900691081 1:3981025-3981047 ATGGAGGGCAGGACAAGGGAAGG - Intergenic
900741175 1:4332226-4332248 CTGGGGAGCTGGGAAGGGGATGG + Intergenic
900907614 1:5571853-5571875 AAGGGAGGCTGGAAAGGGGATGG - Intergenic
901173932 1:7284938-7284960 ATATGGAGCTGGAAAGCGGAGGG - Intronic
901225786 1:7612257-7612279 ATGGGGAGCTGGACAAGGGATGG + Intronic
901331204 1:8410185-8410207 AAGGAGGGCTGGGCAGGGGAGGG + Intronic
901778299 1:11575617-11575639 AGGGAGAGCAGGAAAGTGGGCGG + Intergenic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902063693 1:13666305-13666327 ATGAAGAGCAGGAATGGGGGTGG + Intergenic
902749738 1:18499451-18499473 ATGGGGACCTGGAAAGGGGAAGG - Intergenic
903413544 1:23166913-23166935 ATAGTGAGCTGGGAAGGGAATGG - Intronic
903601678 1:24546554-24546576 AAGGAAAGCTGGAAAGGGGATGG - Intergenic
903739977 1:25553046-25553068 AGGGAGAGCAGGGAAGGGTAAGG - Intronic
903819926 1:26094351-26094373 GTGGAGAGGTGGGGAGGGGAGGG - Intergenic
904222504 1:28984010-28984032 AAGGGGAGCTGAAAAGGGGCCGG + Intronic
904346661 1:29876839-29876861 AAGGGGAGCTGGAAAAGGTATGG - Intergenic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
904583893 1:31568455-31568477 ATGGAGAGAGGGTAAGGGAACGG - Intergenic
905100040 1:35512178-35512200 AAGGATTGCTGGAAATGGGAGGG + Intronic
905461117 1:38123588-38123610 AGGGAGAGCTGGCAGTGGGAAGG + Intergenic
905767039 1:40609997-40610019 AAGGGAAGCTGAAAAGGGGATGG - Intergenic
905829140 1:41050251-41050273 ATGGGAAGCTGGAAAGCAGATGG - Intronic
905830193 1:41059500-41059522 ATGGGGAGCTGGAAAGGGGATGG - Intronic
906138775 1:43520648-43520670 GTGGGGAGCTGGATGGGGGAGGG + Intergenic
906202103 1:43966880-43966902 AGGGAGAGCTGGGAAGGAGCTGG + Intronic
906249276 1:44298997-44299019 GTGGTTAGCTGGCAAGGGGAAGG + Intronic
906328040 1:44860774-44860796 ATGGGCAGCTGGAAGGGAGAAGG + Intronic
906636867 1:47415999-47416021 AAGGAGGGGTGGAAAGGGAAGGG + Intergenic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907616295 1:55930200-55930222 AAGGAGAGCTGGAGATGGGATGG + Intergenic
907856209 1:58306286-58306308 AAGGAGAACTGGAAGGGGCAAGG + Intronic
908059277 1:60329645-60329667 GTGGAGAGCTGGGAGTGGGAGGG - Intergenic
908059616 1:60333459-60333481 GTGGGGAGCTAGAAAGGGGCTGG - Intergenic
908199364 1:61778532-61778554 ATATATAGTTGGAAAGGGGAGGG - Intronic
908207939 1:61870216-61870238 AAGGGGAGCTGCAAAGGAGATGG + Intronic
908269895 1:62412327-62412349 ATAGGGAGCTGGAAGGTGGAGGG - Intergenic
908423786 1:63985157-63985179 ATTGAGATCAGGAAAGGAGATGG - Intronic
908896777 1:68909963-68909985 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
909005051 1:70265888-70265910 ATGGAGGGAGGGAAAGAGGACGG + Intronic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909094504 1:71270832-71270854 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
909125885 1:71668820-71668842 ATGGAGAGCTAGGCAGGGAATGG + Intronic
909234661 1:73137469-73137491 AAGGAAATCTGGAAAGGGCATGG + Intergenic
909486591 1:76180779-76180801 ATGGGGAGCTAGACAGGAGATGG - Intronic
909717599 1:78728229-78728251 AAGGGGAGCTGAAAAGGTGATGG - Intergenic
909804636 1:79858955-79858977 ATGGGGATCTGGTCAGGGGATGG + Intergenic
909837603 1:80276598-80276620 ATGGAGAGGTGGAAAGGAGATGG - Intergenic
909917405 1:81337113-81337135 ATGGAGAGCTGGAAAGGGGATGG - Intronic
909986953 1:82172906-82172928 AAGGGGAGTTGGAAGGGGGATGG - Intergenic
910051302 1:82977509-82977531 AGGGAGAGAGGGAAGGGGGAAGG - Intergenic
910149623 1:84126342-84126364 ATGGGGAGCTGGAAAGCGGATGG + Intronic
910150250 1:84134027-84134049 AAAGGGAGCTGGAAAGAGGATGG + Intronic
910414550 1:86983705-86983727 AAGGAGCTCTGGAGAGGGGACGG + Intronic
910488899 1:87746347-87746369 ATGGGGAACTGGAAAGGAGATGG - Intergenic
910630009 1:89344631-89344653 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
910748722 1:90603416-90603438 GTGAAGGGCTGGAAAGAGGATGG + Intergenic
911205713 1:95090043-95090065 AAGGGGAGCTGGAAAAGGGATGG + Intergenic
911335439 1:96575177-96575199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912041738 1:105398696-105398718 GTGGGGAATTGGAAAGGGGATGG + Intergenic
912061970 1:105685456-105685478 ATAGAGTGCTGGATAGGGAATGG + Intergenic
912088501 1:106040330-106040352 ATAGGGAGATGGAAAGGGAAAGG + Intergenic
912376294 1:109212593-109212615 ATGAAGAGATGGATAGGGCAAGG + Intergenic
912387660 1:109280282-109280304 ATGGAAAGATGGAGAGAGGAGGG - Intronic
912582088 1:110729971-110729993 AGGGAGAGTGGGAAAGGGGATGG - Intergenic
912582565 1:110734005-110734027 ATGGGGAGGTGGAGAGGAGAAGG + Intergenic
912612865 1:111066481-111066503 ATGGGAAGCTTGAAAGGGGATGG - Intergenic
912898457 1:113620415-113620437 AATGAGGGCTGGAAAAGGGATGG - Intronic
913097675 1:115534848-115534870 AGGGGGAGCTGGAAAGGGGATGG - Intergenic
913100971 1:115565189-115565211 ATGAAGAGCTGCAAAGGTGGTGG + Intergenic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914256658 1:145965457-145965479 AAGGAGAACTGGAATGGTGAGGG + Intronic
914457124 1:147846432-147846454 ATGGAAAGCTGGGAAGGAGGAGG + Intergenic
915066404 1:153228658-153228680 ATGGAGAGCAGGCATGGGGGTGG + Intergenic
915162397 1:153929736-153929758 ATGGAGAGTGAGAAAGGGAAGGG - Exonic
915514688 1:156405995-156406017 TTGGAGAGCTGGCAAAGGTAGGG - Intronic
915972905 1:160366810-160366832 ATGGAGAGCTGGGGAAGGGGTGG - Intergenic
916055687 1:161067843-161067865 ACAGAGAGGTGGAAAGTGGAAGG - Intronic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916330397 1:163609960-163609982 ATGGAGAGGTGGAAATGGGATGG + Intergenic
916337783 1:163692655-163692677 AAGGGAGGCTGGAAAGGGGATGG + Intergenic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
916384255 1:164249739-164249761 ATGGGGAGCTGGAAAGGGGCTGG - Intergenic
916705166 1:167341871-167341893 ATGGGGAGCTGGAAAGGGAATGG + Intronic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917087576 1:171319196-171319218 CTGGGGAGCTGGAAAGGGGATGG + Intronic
917099532 1:171431447-171431469 ATGGGCAGCTAGAAAGGGGATGG + Intergenic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
917517236 1:175718446-175718468 CTGGAGACCTGGGTAGGGGAAGG + Intronic
917588922 1:176457337-176457359 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
917589195 1:176459637-176459659 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
917789350 1:178489475-178489497 AAGGAGAGAAGGAAAGGGCAAGG + Intergenic
918057519 1:181034840-181034862 ATGGAGATTTGGAAGGGCGAGGG + Intronic
918087507 1:181258086-181258108 AGGGAGAGAAGGAAAGGGGAGGG + Intergenic
918229160 1:182512782-182512804 ATGCGGAGCTGAAAAAGGGATGG + Intronic
918562129 1:185881305-185881327 AAGGGGAGCAGAAAAGGGGATGG + Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918990501 1:191692713-191692735 GAGGGGAGCTGGAAGGGGGATGG - Intergenic
919021924 1:192116771-192116793 ATGGAGAGAAGGAAAGGTCATGG - Intergenic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
919240847 1:194914361-194914383 AAGGAGAGCTGGAAAGGGGAAGG - Intergenic
919551263 1:198990944-198990966 ATGCAGAGCTGGAAAAGAGGAGG + Intergenic
919656317 1:200200719-200200741 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
919815181 1:201432821-201432843 GGGGAGAGGAGGAAAGGGGAGGG + Intergenic
920192626 1:204203134-204203156 ATGGTGGGATGGGAAGGGGAAGG + Intronic
920204990 1:204284653-204284675 AGGGAGATCTGGAAAGGGACTGG + Intronic
920275337 1:204800263-204800285 GTGAAGAGGTGGAAAGGAGAGGG + Intergenic
920357075 1:205381752-205381774 ATCGAGAGCTGGAGAGAAGAAGG - Exonic
920700626 1:208215714-208215736 AAGGAGGGAAGGAAAGGGGATGG + Intronic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920795570 1:209133093-209133115 ATGGAGAATTGGAAAAGGGATGG + Intergenic
920921201 1:210298617-210298639 ATGGGGAGCTGGGGAGGGGATGG + Intergenic
920950351 1:210566711-210566733 ATAGGGAGCTGGAAGGGGAATGG - Intronic
921342225 1:214145618-214145640 ATGGATAGAGGCAAAGGGGAAGG - Intergenic
921520928 1:216153073-216153095 ATGGGAAACTGGAAAGGGGATGG - Intronic
921632884 1:217456015-217456037 ATGGGGAGCTGGGAAGGGGACGG - Intronic
921680017 1:218020438-218020460 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
922334298 1:224606376-224606398 ATGGGGAGCTGGAAAGGGGATGG + Intronic
922872119 1:228911367-228911389 ATCAAGTGCTGGAAAGGGGGAGG - Intergenic
922913831 1:229239558-229239580 GAGGGGAGCTGGAAAAGGGATGG + Intergenic
923193142 1:231640186-231640208 AGGGAGAGAGGGGAAGGGGAGGG - Intronic
923315221 1:232773543-232773565 AATGGGAGCTGGACAGGGGATGG - Intergenic
923519133 1:234722505-234722527 GCGAAGGGCTGGAAAGGGGAGGG + Intergenic
923566137 1:235077281-235077303 AAGGAGGGCTGGAAAGAGGAAGG + Intergenic
923701122 1:236301400-236301422 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
923892833 1:238234999-238235021 AAGAGGAGCTGAAAAGGGGACGG + Intergenic
923911103 1:238444912-238444934 GAGGGGAGCTGGAAAAGGGATGG - Intergenic
923944273 1:238864982-238865004 AAGGGGAGCTGAAAAGGGGACGG + Intergenic
923957847 1:239042855-239042877 ATAGGGAGCTTGAAAGGGAATGG - Intergenic
923975481 1:239257319-239257341 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924679669 1:246219426-246219448 AAGGTGAGCTGAAAAGGGGATGG - Intronic
924804706 1:247353036-247353058 AAAGGGAGCTGAAAAGGGGATGG - Intergenic
924818355 1:247463056-247463078 AAGGGGAGCTGGAAAGGGGTTGG + Intergenic
924875970 1:248105080-248105102 AGGGAGTGGTGGCAAGGGGAGGG - Intergenic
1063049791 10:2434427-2434449 ATGAAAAGCTGGAAATGGTAGGG - Intergenic
1063131887 10:3185459-3185481 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1063280918 10:4628482-4628504 ATGGAGAGGAGGAGAGGGAAGGG - Intergenic
1063511216 10:6646926-6646948 AGGGAGAGAGGGAAAGGGAAAGG - Intergenic
1063511246 10:6647054-6647076 AGGGAGAGAGGGAAAGGGAAAGG - Intergenic
1063522977 10:6757766-6757788 ATTGGGAGCTGGAAAAGGGATGG + Intergenic
1063523401 10:6761120-6761142 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1063802712 10:9598785-9598807 ATGGAGAAATGGACAGGTGAAGG - Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1063945470 10:11171892-11171914 ATGGAGGACTGGAGTGGGGAGGG + Intronic
1064105921 10:12501070-12501092 GTGGAGTACGGGAAAGGGGATGG - Intronic
1064405570 10:15059173-15059195 ATGGAGGGGAGGGAAGGGGAGGG - Intronic
1064599347 10:16977514-16977536 ATGGGGAGCTGGAAAGGGGGTGG - Intronic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1064705610 10:18069709-18069731 ATAGGGAGCTGGAAGGGGAATGG - Intergenic
1064785268 10:18887986-18888008 ATGGAGAGCTGGGAAGGGGATGG - Intergenic
1065009138 10:21405964-21405986 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1065294845 10:24264378-24264400 ATGGAAATTTGGGAAGGGGATGG + Intronic
1065454402 10:25891951-25891973 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1065638207 10:27752771-27752793 AGGGCGATCTGGAAAGGAGATGG + Intergenic
1065908827 10:30283649-30283671 ATGGAGACCTGGAAAAGAGAGGG + Intergenic
1065909256 10:30287147-30287169 AAGGGGAGCTGGAAAGGAGATGG + Intergenic
1066050092 10:31626116-31626138 ATGGAGATTTGGAAAGGTGAAGG - Intergenic
1066251471 10:33637281-33637303 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1066268385 10:33798288-33798310 ATGGAGAGATGGAGAGGGCAAGG + Intergenic
1066281014 10:33918446-33918468 ATGGAGAGCTGGAAAGGGAATGG + Intergenic
1066288386 10:33990825-33990847 ATGCAGAGAAGTAAAGGGGACGG - Intergenic
1066305115 10:34133016-34133038 ATGGGAAGCTGGAAAGGGGATGG - Intronic
1066379481 10:34889113-34889135 ATGGTGTGCTGGAAATGGTAAGG - Intergenic
1067120944 10:43471626-43471648 GAGGGGAACTGGAAAGGGGACGG + Intronic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067229658 10:44397437-44397459 AGGGAGAGGAGGAGAGGGGAGGG + Intergenic
1067266292 10:44748278-44748300 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
1067267234 10:44756999-44757021 ATGGGGAGGTGAGAAGGGGATGG - Intergenic
1067546614 10:47196657-47196679 ATGGAGAGTGGGAGAGGGTAGGG - Intergenic
1067710675 10:48648960-48648982 ATGGAGAGATGGAAGGGCCAAGG + Intronic
1067848374 10:49740131-49740153 ATGCAGAGCTGCTAAGGAGAAGG + Intronic
1067897627 10:50201161-50201183 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1068015922 10:51516185-51516207 CTGGAATGCTGGAATGGGGATGG + Intronic
1068174047 10:53434387-53434409 ATTAATATCTGGAAAGGGGAAGG - Intergenic
1068318848 10:55383134-55383156 AAGGGGAGCTGGAAAGGGGATGG + Intronic
1068358577 10:55945113-55945135 GTGGAGAGCTGGAAAGGGGATGG + Intergenic
1068441206 10:57057129-57057151 ATTAACAGCTGGAAAGGGGCGGG + Intergenic
1068455284 10:57247198-57247220 TAGGAGAGCTGGGAGGGGGATGG - Intergenic
1068497902 10:57808387-57808409 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1068681277 10:59823046-59823068 AAGGGGAGCTGAAAAGGGGATGG - Intronic
1068845213 10:61663721-61663743 ATGGAGAGCTGGTGATGGGAGGG - Intronic
1068907063 10:62338518-62338540 ATGGGGAACTGGAAAGGGGTGGG - Intergenic
1069125624 10:64628933-64628955 AAGGAGAGCTGAAAAGTGGATGG - Intergenic
1069195540 10:65546290-65546312 ATTAAGAGCTGGACTGGGGAGGG - Intergenic
1069247182 10:66220686-66220708 ATGGGAAGCTGGAAAGGGAGGGG + Intronic
1069601061 10:69708449-69708471 ACGGGGAGCTGGAAAGGGGATGG - Intergenic
1069973955 10:72198037-72198059 AGGGGGAGCAGGGAAGGGGAGGG + Intronic
1070016931 10:72542887-72542909 AAGGCGAGCTGGAAAAGGGATGG + Intronic
1070204469 10:74242892-74242914 GAGGGGAGCTGGAGAGGGGACGG - Intronic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1071042507 10:81330694-81330716 ATGGAAAGATAGAAAGGGAAAGG + Intergenic
1071124752 10:82320918-82320940 ATGAGGAGCTGGAAAGGTGATGG - Intronic
1071149774 10:82620403-82620425 GAGGGGAGCTGGAGAGGGGATGG + Intronic
1071360468 10:84841476-84841498 ACTGAGAGCTGGAAAGCTGATGG - Intergenic
1071428451 10:85582980-85583002 AAGAGGAGTTGGAAAGGGGATGG + Intergenic
1071490121 10:86130629-86130651 ATGGGGAGCTGGAAAGGGGTTGG - Intronic
1071733789 10:88275134-88275156 ATATAGACCTGGAATGGGGAGGG + Intronic
1071960383 10:90804196-90804218 AAGGGGAGCTGGAAAGGGGATGG - Intronic
1072972031 10:100025696-100025718 ATGTGGAGCTGGAAAGGGGATGG + Intergenic
1073217019 10:101842083-101842105 ATTGAGACCTGGGAAGGGGGAGG - Intronic
1073361703 10:102904516-102904538 ATGCATAGCTGAAAAGGGCATGG + Intergenic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073735076 10:106336273-106336295 ATGGTGAGCTGGAAAGGGGATGG - Intergenic
1073762754 10:106648676-106648698 AGGAAGTGCTGGAAAGGGAAGGG + Intronic
1073927248 10:108531303-108531325 ATGGGGTGGGGGAAAGGGGAGGG + Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074364901 10:112849919-112849941 GGGGAGAGCTGGGAAGGGGTAGG + Intergenic
1074473996 10:113753242-113753264 ATGGACAGAGGGAAAGGTGATGG + Intronic
1074710049 10:116169681-116169703 ATGTGGAGCTGGAAAGGGGATGG - Intronic
1075084545 10:119405687-119405709 ATGCAGAGCTGGAAAGTGGCAGG - Intronic
1075627238 10:123972299-123972321 ATGGAGGGGTGGAGAAGGGAGGG + Intergenic
1075627289 10:123972417-123972439 ATGGAGGGGTGGAGAGGGGTGGG + Intergenic
1075627327 10:123972507-123972529 ATGGAGGGGTGGAGAGGGGAGGG + Intergenic
1075848671 10:125568069-125568091 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1075968237 10:126631242-126631264 TTGGAGAGCTAGAAAGGAGGAGG - Intronic
1076102512 10:127794398-127794420 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1076158472 10:128222407-128222429 ATGAACAGCTGGAAAGCGGGAGG - Intergenic
1076600389 10:131653528-131653550 ATGGAGGCCTGGAAAGCAGAGGG + Intergenic
1076630028 10:131846828-131846850 GTTGAGAGCTGGGGAGGGGAGGG + Intergenic
1076738342 10:132468537-132468559 ATGGAAAGCAGGGGAGGGGAGGG + Intergenic
1076850764 10:133091608-133091630 ATTGAGAGCTGGAAGGGGCTCGG - Intronic
1077382465 11:2250544-2250566 ATAGAGAGCTGGAAAGAGCCCGG + Intergenic
1077535893 11:3123870-3123892 GTGGAGAGCTAGCAAGGGGCAGG + Intronic
1077554565 11:3219685-3219707 AGGGATGGCTGGAAAGGGAAGGG - Intergenic
1077712440 11:4550836-4550858 GTGGGGAGCTGGAAAGGGGATGG - Intergenic
1077712978 11:4554366-4554388 GTGGGGAGCCGGAAAGGGGATGG - Intergenic
1077991330 11:7414832-7414854 TTGGAGAACTGAGAAGGGGAGGG + Intronic
1078136083 11:8652752-8652774 AGGGTGATCTGGAAAGGGGTTGG + Intronic
1078270117 11:9787504-9787526 AAGGAAGGGTGGAAAGGGGAGGG - Intronic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078435386 11:11320776-11320798 TGGGAGAGCTGGAAAGGACAAGG - Intronic
1078450072 11:11434200-11434222 AAGGAGAGCTGGAAATAGAATGG - Intronic
1079206180 11:18416812-18416834 ATGGAGGGCTGGGGAGGGTAGGG - Intronic
1079538080 11:21539519-21539541 ATGCGGAGCTGGAAAGGGGATGG + Intronic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1079898396 11:26150112-26150134 AAGGGGAGCTGAAAAGGGGACGG + Intergenic
1080536845 11:33230260-33230282 ATGAAGGGGTGGGAAGGGGATGG + Intergenic
1080588849 11:33704040-33704062 ATGCAGAGCTGGAGTGGGGGAGG - Intronic
1080604410 11:33852892-33852914 GAGGGGAGCTGGAGAGGGGACGG + Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1081001834 11:37682865-37682887 AAGGGGAACTGAAAAGGGGATGG + Intergenic
1081034390 11:38124140-38124162 GAGGAGAGTTAGAAAGGGGATGG + Intergenic
1081062907 11:38503181-38503203 ATGGAGAGCTGGAAGAGCAATGG + Intergenic
1081109871 11:39121480-39121502 GAGGAGAGCTGGAGAAGGGATGG + Intergenic
1081312586 11:41592129-41592151 ATGAGGAGCTGGAAGGGGGATGG + Intergenic
1081312812 11:41593994-41594016 ATGGGGAGCTGGGAAGAGGATGG + Intergenic
1081374211 11:42339858-42339880 ATAGGGAGCTGGAAAGGGGATGG - Intergenic
1081502615 11:43681077-43681099 GAGGAGAGCTGGGGAGGGGAAGG - Intronic
1081617645 11:44600090-44600112 AGGGACAGCTGGCAGGGGGAGGG + Intronic
1081626491 11:44659063-44659085 ATGGAGAGATGGAAGGATGAAGG + Intergenic
1081746153 11:45473809-45473831 ATGGAGTGGAGGAAAGGGGCAGG + Intergenic
1081754624 11:45535857-45535879 ATGGAGTGCTGGATGGGGCAGGG - Intergenic
1082645542 11:55720104-55720126 GGGAGGAGCTGGAAAGGGGATGG + Intergenic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082749764 11:57003130-57003152 ATGGGGAGCCGGAAAGGCGATGG + Intergenic
1082751418 11:57022501-57022523 ATGGGGAGCTGAAAGGGGGATGG + Intergenic
1082893687 11:58167016-58167038 ATGGAGACCTGCAAGGGTGAGGG - Intronic
1083367245 11:62148662-62148684 ATGGAGCGGAGGGAAGGGGAGGG + Intronic
1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG + Intronic
1083535326 11:63461685-63461707 ATGGACAGCTTGGAAGTGGAAGG + Intronic
1083913030 11:65720987-65721009 AAGGAGAGGGGGAGAGGGGAGGG - Intergenic
1084270404 11:68026512-68026534 ACTGAGAGCTGGAGGGGGGATGG - Intronic
1084445051 11:69198766-69198788 ATGGAGAGATGGAAGGATGAAGG - Intergenic
1084691970 11:70732780-70732802 GGGGAGTGCTGGAGAGGGGAGGG - Intronic
1084766493 11:71312379-71312401 AAGGTGAGCTGGAAAGGGGATGG + Intergenic
1084941661 11:72616427-72616449 CTGGAGACCTGGAGAGGGGCAGG - Intronic
1085082365 11:73645746-73645768 AGGGAGAGCTGGAGAGAGGCTGG + Intergenic
1085348015 11:75780633-75780655 GTGGGGAGCTGGAAGGGGAAGGG - Intronic
1085422025 11:76370968-76370990 AGGGAGAGCTGGGAAAGGGGAGG - Intronic
1085751288 11:79163189-79163211 AGTGAGAGAAGGAAAGGGGAAGG + Intronic
1085947009 11:81284459-81284481 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1086286395 11:85256342-85256364 ATGGGGAGCTGGAAAGCAGATGG - Intronic
1086287457 11:85265858-85265880 CAGGGGAGCTGGAAAGGGAATGG - Intronic
1086493415 11:87378059-87378081 GAGGAGAGCTGGAGAGGGAATGG + Intergenic
1086783044 11:90930934-90930956 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1087009577 11:93500579-93500601 ACGCAGAACTGGAAAGGGGAAGG + Intronic
1087069677 11:94065612-94065634 AGGGAGAGAAGGAAAGGGGAAGG + Intronic
1087320319 11:96650392-96650414 ATGGAGAGCTGGAGAGGCCCTGG + Intergenic
1087396617 11:97609145-97609167 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1087467400 11:98525993-98526015 ATCGTGAGCTGGAAAGGGGATGG + Intergenic
1087602979 11:100339357-100339379 GAAGGGAGCTGGAAAGGGGATGG + Intronic
1087608421 11:100405393-100405415 AAGGGGAGCTGGAAAAGGGATGG + Intergenic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1087698784 11:101412399-101412421 ATGGCGAGCTGGAAAGGGGATGG - Intergenic
1087717499 11:101625421-101625443 AGGGAGAGGTGAAAAGAGGAAGG - Intronic
1087896261 11:103589981-103590003 ATGAGGAGCTGGAGAGGGGATGG - Intergenic
1087933706 11:104006795-104006817 ATAGGGAGCTGGAAGGGGGATGG - Intronic
1087934196 11:104013193-104013215 ATGGGGAGCAGGAAAAGAGATGG - Intronic
1088428337 11:109729693-109729715 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1088450618 11:109977747-109977769 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1088777594 11:113100548-113100570 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1089031044 11:115329807-115329829 ATAGGGAGCCGGAAAGGAGATGG + Intronic
1089113388 11:116074453-116074475 AGCGAGAGCTGGAAGTGGGAAGG - Intergenic
1089162128 11:116446602-116446624 TAGGAGAGATGGAAATGGGATGG + Intergenic
1089361812 11:117894846-117894868 ATATAGAGTTGGAAAGTGGAAGG - Intergenic
1089710557 11:120311458-120311480 ATGGAAAGCTGGATGGGGGCAGG + Intronic
1089847221 11:121467712-121467734 CTGGAGAGGAGGAAAAGGGAAGG + Intronic
1090135852 11:124198752-124198774 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
1090418116 11:126554996-126555018 ATGAGGAGTTGGAAAGGGGATGG - Intronic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090599776 11:128358202-128358224 CTGAAGGGCCGGAAAGGGGAGGG + Intergenic
1090678912 11:129031994-129032016 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1091082203 11:132681518-132681540 AAGGGGAGCTGGAGAGGAGATGG - Intronic
1091379404 12:46262-46284 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1091663166 12:2399442-2399464 ATGGGGAGCTTGAAAGGGGATGG + Intronic
1091770855 12:3150351-3150373 ATGGGGGGCAGGAATGGGGAGGG + Intronic
1091780819 12:3213626-3213648 AAGGGGGGCTGGAAGGGGGAGGG - Intronic
1091812891 12:3414720-3414742 ATGGGGAGTTGGAAAGGGGATGG + Intronic
1091995177 12:4987692-4987714 ATGGAGGGCTGGCAAGAGAAAGG + Intergenic
1092465656 12:8729329-8729351 AAGCGGAGCTGAAAAGGGGATGG + Intronic
1092569083 12:9702239-9702261 ATAGGGAGCTGGAAAGTGGATGG + Intergenic
1092850835 12:12624921-12624943 AGGGGGAACTGAAAAGGGGATGG + Intronic
1092927314 12:13283053-13283075 GTGAAGAACAGGAAAGGGGAGGG + Intergenic
1092936747 12:13371270-13371292 AAGGAGAGCAGGAAAGGCAATGG - Exonic
1092953225 12:13526772-13526794 ATGGAATGCAGCAAAGGGGAAGG + Intergenic
1092981877 12:13803742-13803764 ATGGTGAGATGGGAAGGTGATGG + Intronic
1093091304 12:14924034-14924056 ATGGAAAGCTGGGGAGCGGAGGG - Intronic
1093245441 12:16730672-16730694 ATGGGGAGCATGAAACGGGATGG - Intergenic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1093370311 12:18356668-18356690 ATGGAGAGCTGGAAAGGAGATGG + Intronic
1093592333 12:20917666-20917688 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1093731234 12:22568043-22568065 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
1093731375 12:22569127-22569149 GAGGGGAGCTGGAAAGGGGATGG - Intergenic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1093751400 12:22804222-22804244 ATAGGGAGTTGGAAAGGGGATGG + Intergenic
1093751791 12:22808083-22808105 ATGGGGAACTGGAAACAGGATGG + Intergenic
1093764621 12:22948629-22948651 ATGTAAAGCTGGATAAGGGAGGG + Intergenic
1093769100 12:22998980-22999002 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1093937760 12:25019410-25019432 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1094412602 12:30182931-30182953 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1094436413 12:30425205-30425227 ATGGGGAACTGGAAATGGAATGG - Intergenic
1094455906 12:30632653-30632675 ATAGAGACCTGGAATGGGGAGGG - Intronic
1094474979 12:30833880-30833902 ATGGGGCGCTGGAAAGGGGATGG - Intergenic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1094745605 12:33341227-33341249 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1094853479 12:34392660-34392682 CTGGAAGGCTTGAAAGGGGAAGG + Intergenic
1095086266 12:38060014-38060036 ATGGGGAGCAGGAAAGGAGGAGG + Intergenic
1095183836 12:39178402-39178424 ATGGGGAGCTGGTAGGGGGATGG - Intergenic
1095477129 12:42596986-42597008 ATGGAGAGCTGGTGGGGAGAAGG + Intergenic
1095551887 12:43451862-43451884 ACAGAGAGCTGGAAAGAGGAAGG + Intronic
1095748097 12:45682162-45682184 ATGAGGAGGTGGAAGGGGGATGG - Intergenic
1095986953 12:48005117-48005139 ACGCAGAGCTGGATGGGGGAGGG - Intergenic
1096170234 12:49462682-49462704 AAGGGGAGCTGAAAAGGGGTTGG + Intronic
1096460630 12:51819964-51819986 ATGGAGAGCTGGGGAGGGAGGGG + Intergenic
1096612245 12:52810090-52810112 ATGGAGACTTGAAAAAGGGAGGG + Intronic
1096919888 12:55072457-55072479 CAGGGGAGCTGGACAGGGGATGG + Intergenic
1096932923 12:55235640-55235662 ATGGATAGATGGAAAGTGAAAGG + Intergenic
1096983995 12:55744642-55744664 AAGGAGAGCTGGAAAAGGGGGGG - Intronic
1097136330 12:56859523-56859545 ATGGAGACTTGGAAGGGAGAGGG - Intergenic
1097290826 12:57913653-57913675 ATGGGGAACTGAAAGGGGGATGG - Intergenic
1097451678 12:59744447-59744469 AAGGGGAGCTGCAAAGGGAATGG - Intronic
1097728900 12:63105580-63105602 ATGAAGAGATGAAAAAGGGATGG - Intergenic
1097747852 12:63318836-63318858 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
1098109359 12:67105505-67105527 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098336818 12:69412927-69412949 ATGCAGCGGTGGAAGGGGGAGGG + Intergenic
1098396849 12:70028581-70028603 ATGGGGAGCTAGAAGGGGTATGG + Intergenic
1098469371 12:70826103-70826125 ATGGAGAGAGGGAAAGAAGAAGG + Intronic
1098554630 12:71804432-71804454 TTGGGGAGCTGGAAAGGGAATGG - Intergenic
1098744093 12:74213579-74213601 ACGGGGAGCAGGAAGGGGGATGG + Intergenic
1098757671 12:74386958-74386980 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098758334 12:74391671-74391693 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098936895 12:76490561-76490583 AAGGGGAGCTGAAAAGGGGATGG - Intronic
1099494970 12:83335615-83335637 GAGGAGAGCTGGAGAGGGGGTGG + Intergenic
1099646088 12:85358995-85359017 AGGGAGAGAAGGGAAGGGGAGGG - Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099871718 12:88358009-88358031 AGGAAGAGAAGGAAAGGGGAAGG - Intergenic
1100128170 12:91456202-91456224 AGGGAGAGCGGGAAAGGGAGGGG - Intergenic
1100267149 12:92988432-92988454 TTGTAGAGATGGGAAGGGGAGGG + Intergenic
1100293065 12:93235779-93235801 AAGGGAAGCTGGAAGGGGGATGG - Intergenic
1100370679 12:93966621-93966643 ATGGAGGGATGGAAAGAGGGAGG - Intergenic
1100370703 12:93966701-93966723 ATGGAGGGATGGAAAGAGGGAGG - Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100478119 12:94952737-94952759 ATGAGGAGCCAGAAAGGGGATGG - Intronic
1100978504 12:100146035-100146057 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1101273234 12:103170701-103170723 ATGGAGTGATGAAAAGGGGTTGG - Intergenic
1101378039 12:104187853-104187875 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1101432826 12:104641127-104641149 AAGGGGAGCTAAAAAGGGGAAGG - Intronic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1101550258 12:105754793-105754815 ATGGGGCACTGGAAAAGGGATGG + Intergenic
1101581848 12:106048818-106048840 ATGGAGGGAGGGAAAGGAGAGGG + Intergenic
1101888543 12:108690988-108691010 ATGCAGAGCTGCAATGGGAAGGG - Intronic
1102082473 12:110109620-110109642 CTGGAGAGCAGGAAGGGGCAGGG + Intergenic
1102514528 12:113437419-113437441 ATGGATAGATGGACAGTGGATGG + Intronic
1102598823 12:114013126-114013148 ATGGAGAGAGGGGAGGGGGATGG + Intergenic
1102633363 12:114301211-114301233 AAGGAGATCTGGAATGGGGCAGG + Intergenic
1102682264 12:114698764-114698786 AGGGAGAGATGGAGAGGGGAAGG - Intergenic
1103004350 12:117409356-117409378 ATGGAGGGGTGGAAGGTGGATGG + Intronic
1103038219 12:117673445-117673467 ATGGACAGATGGAAAGAGGAAGG + Intronic
1103166251 12:118773088-118773110 ATGGGGAGCGTGAAGGGGGATGG + Intergenic
1103175453 12:118859473-118859495 ATTGAGAACTGGATAGTGGAAGG - Intergenic
1103768397 12:123299993-123300015 CTAGAGAGATGGAAAGGGGTGGG + Intronic
1103948804 12:124540890-124540912 GTGGAGAGCTGGAGGGGGGTGGG + Intronic
1103949165 12:124541932-124541954 GTGGAGAGCTGGAAGGGGATGGG + Intronic
1104095923 12:125557918-125557940 AAGGATTACTGGAAAGGGGAAGG + Intronic
1104096813 12:125565602-125565624 GTGGGGAGCTGGAAGGGGGATGG + Intronic
1104143132 12:126007153-126007175 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1104235970 12:126936917-126936939 GAGGAGAGCTGGAGAGAGGATGG + Intergenic
1104265862 12:127231966-127231988 AAGGAGAGCTGGAAAGGGGATGG - Intergenic
1104285148 12:127418251-127418273 GAGGAGAGCTGGAAAGGGGTTGG - Intergenic
1104469572 12:129018678-129018700 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
1104550317 12:129750692-129750714 AGGGAAAGCTGGGAAGGGGTTGG + Intronic
1104754193 12:131258621-131258643 ATGGGGAGTCGGAAAGCGGAAGG + Intergenic
1104803158 12:131568543-131568565 ATGGATGGATGGATAGGGGATGG - Intergenic
1105246016 13:18650878-18650900 AAAGGGAGCTGGAAAGGGGATGG + Intergenic
1105308178 13:19183531-19183553 ATGGCCACCAGGAAAGGGGAAGG + Intronic
1105639735 13:22249974-22249996 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1105972984 13:25447827-25447849 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1106030003 13:25991455-25991477 ATGGCGGGATGGAAAGGGTAGGG - Intronic
1106942294 13:34792309-34792331 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1107294389 13:38894320-38894342 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1107698592 13:43024258-43024280 CTGTAGAGCTGGAAAAAGGAAGG + Intronic
1107748894 13:43543128-43543150 ATGGGGACATGGAATGGGGAAGG + Intronic
1107767846 13:43756496-43756518 AGGGAGAGAGGGAAAGGAGAGGG + Intronic
1108104850 13:46997833-46997855 ATGAGGAGCTAGAAAGAGGACGG + Intergenic
1108126390 13:47248891-47248913 ATGGAGAGGTGGAAGGGAGGTGG - Intergenic
1108158984 13:47618500-47618522 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
1108159056 13:47618897-47618919 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108316556 13:49242687-49242709 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1108487363 13:50940550-50940572 ATGGAGAGATGGAATGTGGGAGG + Intronic
1108799810 13:54081728-54081750 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1108846139 13:54679887-54679909 ATGTGGAGCTGGACAGGGGATGG - Intergenic
1109184440 13:59252180-59252202 AATGGGAGCTGGAAAGGCGATGG + Intergenic
1109217479 13:59606067-59606089 ATGGAGACCTGGAGAGATGAGGG + Intergenic
1109300723 13:60587355-60587377 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109470680 13:62799779-62799801 GCGGAGAGCTGGAAAGATGATGG + Intergenic
1109756421 13:66766625-66766647 ATGTAGAGTTGGGAAGGGAAAGG + Intronic
1109837268 13:67876497-67876519 TTTGAAAGCTGGAAAGGGCAAGG + Intergenic
1110003708 13:70238612-70238634 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1110072254 13:71191734-71191756 ATAGGCAACTGGAAAGGGGATGG + Intergenic
1110148770 13:72225052-72225074 ATTGAGAGCTGGCAAAGTGAAGG - Intergenic
1110175785 13:72553948-72553970 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110582882 13:77152721-77152743 AAGGGGAGCTAGAAAGGGCATGG - Intronic
1110592016 13:77274472-77274494 ATGAAGAGAGGGAAAGGGAAGGG + Intronic
1110714305 13:78683988-78684010 ATTGGGAGCTGGAAAGGGGATGG - Intergenic
1110938313 13:81319295-81319317 AAGGAGAGCTGAAAAGGGGATGG - Intergenic
1111034898 13:82659609-82659631 AAAGGGAGCTGGAAAGGGGATGG - Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111168290 13:84491699-84491721 AAGGGGAGCTGAAAAGGAGATGG - Intergenic
1111182551 13:84687611-84687633 AAGGGAAGCTGAAAAGGGGATGG + Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111451818 13:88428810-88428832 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1111453859 13:88453927-88453949 ATGGGGAGCTGGAAAGGGAATGG + Intergenic
1111610738 13:90603502-90603524 ATGAGGAGCTGGAAATGGGAAGG + Intergenic
1111668178 13:91295931-91295953 ATGGGGAGCTGCAAAGGGAAAGG - Intergenic
1111726254 13:92013287-92013309 GAGGGGAGCTGGAGAGGGGATGG + Intronic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112171493 13:96977180-96977202 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1112259765 13:97867666-97867688 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1112982620 13:105404538-105404560 ATGGAGAGAGGGACAGGGGAAGG + Intergenic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113413634 13:110111108-110111130 TGGGAGAGCTGCCAAGGGGATGG - Intergenic
1113582824 13:111440788-111440810 ATGGAGAGGTGGGAAGGGGTGGG - Intergenic
1113591313 13:111503261-111503283 ATGGAGTGCTGGAATGAGAAGGG - Intergenic
1113885948 13:113658471-113658493 AAGGAGAGGAGGGAAGGGGAAGG - Intergenic
1114178372 14:20343763-20343785 ATAGGGAGCTGGAAGGGGAAGGG - Intronic
1114345450 14:21789816-21789838 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
1114358096 14:21937249-21937271 AGGGAGAGATGGAGGGGGGAGGG - Intergenic
1114378408 14:22174295-22174317 ATGAAGAGATGCAAAGGGCAAGG + Intergenic
1114517098 14:23307177-23307199 GTGGAGCCCTGGAAAGGGGAGGG - Exonic
1114547419 14:23513080-23513102 TTGGAGAGCTGGCAGGCGGAGGG - Intergenic
1114574472 14:23699848-23699870 AAGGGGAGCTGAAAAGTGGATGG + Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115379772 14:32722719-32722741 ATGGGGAGCTGGGAAGGCGATGG - Intronic
1115899563 14:38129629-38129651 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1116035930 14:39627096-39627118 AAAGGGAGCTGGAAAGGAGATGG - Intergenic
1116075056 14:40100819-40100841 AGGGAGGGCAGGAGAGGGGAAGG - Intergenic
1116075064 14:40100839-40100861 AGGGAGGGCAGGAGAGGGGAAGG - Intergenic
1116121122 14:40723210-40723232 ATGGGGAGCTAAAAAGGGGATGG + Intergenic
1116523800 14:45880446-45880468 AAGGGGAACTGGAAGGGGGATGG - Intergenic
1116526352 14:45910588-45910610 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1117450564 14:55845706-55845728 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117834249 14:59785792-59785814 ATGGAAGGGTGGAAAGGGCAGGG - Intronic
1117943997 14:60998483-60998505 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1117969425 14:61237422-61237444 ATGAAGACCTGGAAAGGGAAAGG - Intronic
1118062188 14:62151632-62151654 ATGGAAACCAGGAAATGGGAAGG - Intergenic
1118100477 14:62595217-62595239 TTTGAGAGCTGGAAAACGGAAGG - Intergenic
1118474289 14:66102356-66102378 ATGGGGAGCTGGAAAGGTGATGG - Intergenic
1118817851 14:69325416-69325438 ATGGAGGGCTGCAAAAAGGAAGG - Intronic
1118895064 14:69939058-69939080 ACGGAGAGTTTGAAAGGGGTGGG - Intronic
1118911113 14:70062908-70062930 AGGGACAGCTTGGAAGGGGAAGG + Intronic
1119021680 14:71121584-71121606 GAGGGGAGCTGGAGAGGGGACGG - Intergenic
1119101721 14:71885999-71886021 AGGGAGAGAAGGAAAGGGAAGGG - Intergenic
1119137954 14:72238067-72238089 AAAGGGAGCTGGAAAGGGGATGG + Intronic
1119252472 14:73168640-73168662 ATGGGGAGTTGAAAAAGGGATGG - Intronic
1119281984 14:73417106-73417128 TGGGGAAGCTGGAAAGGGGATGG - Intronic
1119562674 14:75603457-75603479 AAGGGGAGCTGGAAAGCAGATGG - Intronic
1119821311 14:77618405-77618427 TTGGAGAGCTGGAACTGAGAAGG + Intergenic
1119855453 14:77897088-77897110 CTGGAAAGATGGGAAGGGGAAGG + Intronic
1119913314 14:78371372-78371394 AAGGGGAGGTGGAAGGGGGATGG - Intronic
1120095415 14:80382397-80382419 AGAGAGAGCTAGAAAGGGCACGG + Intronic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1120218376 14:81704993-81705015 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1120255005 14:82107378-82107400 CTGGAGAGATGGAAAGTGGGAGG + Intergenic
1120387555 14:83865131-83865153 GGGGAGAGATGGGAAGGGGACGG - Intergenic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1120523277 14:85549063-85549085 ATGAAGAGCTGGAAAGGGGATGG - Intronic
1120614691 14:86688814-86688836 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
1120685360 14:87531111-87531133 ATGAGGAGCTGAAAAGGGGATGG - Intergenic
1120806129 14:88752897-88752919 ATGGCGAACTGGAGAGGGGATGG - Intronic
1120871853 14:89344974-89344996 ATCTAGATCTGGAAAGTGGAAGG - Intronic
1120939197 14:89930455-89930477 ATGCACAGCTGCAAGGGGGAAGG - Intronic
1121172709 14:91868157-91868179 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1121451682 14:94012256-94012278 GGGGAGAGGAGGAAAGGGGAGGG - Intergenic
1121451693 14:94012281-94012303 GGGGAGAGGAGGAAAGGGGAGGG - Intergenic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1121737468 14:96228463-96228485 GTGGGGAGCTGGAAAGGGGATGG + Intronic
1122006064 14:98704806-98704828 AGGGAGAGCTGGAAGAAGGAGGG - Intergenic
1122196030 14:100086547-100086569 ATGGTGTACTGGAAAGGGCATGG + Intronic
1122444821 14:101761064-101761086 AGGGAGAGGAGGGAAGGGGAGGG + Intergenic
1122641693 14:103163788-103163810 AAGGAGAACTGGCAAGGGGATGG - Intergenic
1122643326 14:103175353-103175375 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1123127940 14:105962789-105962811 TTGGAGAACTTGAAAGGAGAAGG + Intergenic
1123765152 15:23470839-23470861 AAGGGGAGCTGAAAGGGGGAGGG + Intergenic
1123873598 15:24600859-24600881 AAGGAGAGCTGAAGAGGGAACGG - Intergenic
1125121223 15:36161103-36161125 ATGGAGAGCAGGAAAGAACAAGG + Intergenic
1125446899 15:39767795-39767817 ATGGGGAGCTGGAACGGGGATGG - Intronic
1125777777 15:42233643-42233665 ATGAAAGGGTGGAAAGGGGATGG - Intronic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1126688277 15:51267090-51267112 ATGAAAAGCAGGAAACGGGAGGG - Intronic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1127069729 15:55277267-55277289 CTGGAGAGCAGGAAATGGGCTGG + Intronic
1127221391 15:56884872-56884894 AGGGAGAGGAGGGAAGGGGAGGG + Intronic
1127867777 15:63045744-63045766 AGGGAGCGCTGGAATGGGGTGGG + Intronic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128302010 15:66571868-66571890 GTGGTGAGGAGGAAAGGGGAAGG + Intergenic
1128479853 15:68027837-68027859 AAAGGGAGCTGGAAAGGGGACGG + Intergenic
1128570698 15:68731050-68731072 AGGAAGAGCTGGAAAGTGAAGGG + Intergenic
1129117312 15:73371779-73371801 AGGCAGTGCTGGAAAGGAGAGGG - Intergenic
1129235613 15:74222099-74222121 TTGGAGGGCTGGAAAGGGCGGGG + Intergenic
1129615362 15:77094896-77094918 AGGGAGCGCTGAAAACGGGAAGG - Intergenic
1129789986 15:78334653-78334675 TTGGAGAGCAGGACAGGGGCTGG - Intergenic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130134332 15:81169427-81169449 AAGGGGAGCTGAAAAGGGGATGG - Intronic
1130420803 15:83745200-83745222 AAAGGGAGCTGGAAAGGGGATGG - Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130721201 15:86387051-86387073 ATGGAAAGCAGAAAGGGGGATGG + Intronic
1130787311 15:87114581-87114603 AAGGGAGGCTGGAAAGGGGATGG - Intergenic
1130803432 15:87291956-87291978 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1130895641 15:88168606-88168628 ATGGACAGCTGGCACAGGGAGGG + Intronic
1131365696 15:91837399-91837421 ATAGGGAGCTGGAGAGGGGATGG + Intergenic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1131881538 15:96867726-96867748 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1132038478 15:98505537-98505559 ATGGAGGGCTGGAAGCGGGTGGG - Intronic
1132040941 15:98524213-98524235 ATGGTGGGCTGGGGAGGGGAGGG - Intergenic
1132207495 15:99996342-99996364 CTAGAGTACTGGAAAGGGGAGGG + Intronic
1132421447 15:101673307-101673329 GTGGGGAGCTGAAAAGGGGATGG - Intronic
1132621940 16:871883-871905 ATGAACAGCAGGAGAGGGGAGGG + Intronic
1132659882 16:1056632-1056654 AGGGAGAGCTGGAGAGGGGGTGG + Intergenic
1132659901 16:1056688-1056710 AGGGGGAGCTGGAGAGGGGGTGG + Intergenic
1132659956 16:1056855-1056877 AGGGGGAGCTGGAGAGGGGGTGG + Intergenic
1133000853 16:2850700-2850722 AAGGAGGGCTGGAGAGGGGAGGG + Intergenic
1133207990 16:4245516-4245538 GTTCAGAGCTAGAAAGGGGAAGG + Intergenic
1133362966 16:5188469-5188491 AGGGAGAGAGGGAAAGGGGAAGG + Intergenic
1133493901 16:6297878-6297900 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1133647768 16:7780582-7780604 AGGGAGAGAAGGAGAGGGGAAGG - Intergenic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1133816786 16:9203712-9203734 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1133903246 16:9996786-9996808 ATGGAGAGATGAATAGGGGTGGG + Intronic
1133929153 16:10218102-10218124 ATGGATAGAAGGAAGGGGGAAGG - Intergenic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134365981 16:13579560-13579582 CAGGGGAGCTGGAGAGGGGACGG + Intergenic
1134602330 16:15543118-15543140 AAGGGGAGCTGGAAAGGGGATGG + Intronic
1134799615 16:17071776-17071798 AGGGAGGGGAGGAAAGGGGAGGG - Intergenic
1134871648 16:17657281-17657303 AAAGAGAACTGGATAGGGGAGGG + Intergenic
1134873680 16:17676191-17676213 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135672511 16:24387296-24387318 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1135678393 16:24436695-24436717 ATGGGGAGTTGGAAAGGAGATGG - Intergenic
1135860274 16:26049965-26049987 ATGGACAGCTGGACAGGGGGAGG - Intronic
1136539959 16:30923685-30923707 AGGGGGAGAGGGAAAGGGGAAGG - Intronic
1137764931 16:50970788-50970810 ATTGAGGACTGGGAAGGGGAAGG + Intergenic
1137964153 16:52914305-52914327 ATAGGGAGCTGGATGGGGGATGG - Intergenic
1138293438 16:55867471-55867493 CTGGAGAACTGGAAAATGGAGGG - Intronic
1138328421 16:56193300-56193322 AGGTAGAGGTGGAAGGGGGAGGG + Intronic
1138603555 16:58072499-58072521 AGGGAGGGCTGGAATGTGGAGGG + Intergenic
1138719688 16:59065069-59065091 ATGATGAGCAGGAAAGGGAAAGG + Intergenic
1138902978 16:61296772-61296794 AAGGGAGGCTGGAAAGGGGATGG + Intergenic
1138977919 16:62230545-62230567 ATGGGGAGCTGGACAGGGGGTGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1139391581 16:66609103-66609125 ATGGAGAGCGGGAAGGGAGCAGG + Intronic
1140250172 16:73288214-73288236 GTGGAGAGGTGGGAAGGAGATGG + Intergenic
1140324790 16:73991217-73991239 AAGGGGAGTTGGAAAGGGGAGGG + Intergenic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140461749 16:75145729-75145751 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1140564604 16:76026997-76027019 ATGGGGAGCTAGAAAGGGAATGG - Intergenic
1140602284 16:76491506-76491528 CTGGAGAGCTGGAAATGAGGGGG - Intronic
1140985652 16:80156000-80156022 AGTGAGACCTGGAGAGGGGAGGG + Intergenic
1141019621 16:80482996-80483018 TTGGGGAGCTGCAGAGGGGATGG + Intergenic
1141677793 16:85526610-85526632 GTGGAGAGCAGGGATGGGGAGGG + Intergenic
1141856373 16:86683819-86683841 ATGGAGAGGTGGAGAGAGGGAGG - Intergenic
1141887827 16:86904908-86904930 GGGGAGAGCTGGAGCGGGGAAGG - Intergenic
1142049266 16:87947359-87947381 CTGGAGTGCTGGAAAAGGAATGG - Intergenic
1142301756 16:89262718-89262740 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
1142419538 16:89961899-89961921 AGGGAGAGCAGGAAGGGGGTTGG + Intronic
1142755753 17:2015490-2015512 TTGGAGAGGTGGCAAGAGGAGGG + Intronic
1142759481 17:2034658-2034680 ATGGGGAGCAGGGGAGGGGAGGG - Intronic
1143007862 17:3848497-3848519 ATCGCGAACAGGAAAGGGGATGG - Intergenic
1143047648 17:4095059-4095081 CTGGAGAGCTGGGAAAGGGCAGG - Intronic
1143129946 17:4671868-4671890 AGGGAGAGGTGGAGAGGGAAGGG - Exonic
1143352785 17:6301029-6301051 ATGTAGTGCTGGCAAGGGCAGGG + Intergenic
1143704450 17:8687341-8687363 GGGGAGAGGAGGAAAGGGGAGGG - Intergenic
1143706777 17:8703546-8703568 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1143865494 17:9919819-9919841 CTGGAAAGCTGGAAAAGGGATGG + Intronic
1144077481 17:11732467-11732489 GTGGAGAGGAGGAGAGGGGAGGG - Intronic
1144163208 17:12581848-12581870 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144365742 17:14542191-14542213 AGGGAAAGAAGGAAAGGGGAGGG - Intergenic
1145289171 17:21529622-21529644 ATGGGGAGCTGGAAGTGGGGAGG - Exonic
1145398870 17:22515492-22515514 AAGGAGAGGAGGGAAGGGGAGGG + Intergenic
1146272136 17:31491451-31491473 AGGAAGAGCAGGGAAGGGGAGGG + Intronic
1146405540 17:32533665-32533687 CTGGAGAGCTGGGAAGGAGCAGG - Intronic
1146824051 17:36008287-36008309 ATGGGGAGCTGGAGAATGGATGG - Intergenic
1146824667 17:36012199-36012221 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
1147230177 17:39011996-39012018 AAGGGGAGCTGAAATGGGGATGG - Intergenic
1147591771 17:41688671-41688693 TAGGAGAGCTGGGAGGGGGAGGG - Intergenic
1147862172 17:43530071-43530093 ATGGAGGGCTTGGCAGGGGAAGG + Intronic
1147895658 17:43749785-43749807 AGGGAGTGCTGGCAAGGAGATGG - Intergenic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148486804 17:47996052-47996074 AAGGAGAGCTGAAAAGAAGAGGG - Intergenic
1148488090 17:48004134-48004156 ACGGGGAGAAGGAAAGGGGAAGG - Intergenic
1148488393 17:48006298-48006320 ATGGAAGGCTGGAAAAGAGATGG + Intergenic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148901899 17:50884788-50884810 GGGGAGAGGTGGAAAGAGGAAGG - Intergenic
1148902330 17:50887766-50887788 ATGGAGAGTTGGGAGGAGGAAGG + Intergenic
1148957582 17:51366342-51366364 AAGGAAGGCTGGAAAGGGGATGG - Intergenic
1149026667 17:52035356-52035378 AAGGGGAGCTGAAAAGGGGACGG - Intronic
1149067356 17:52496256-52496278 AAAGGGAGCTGAAAAGGGGATGG + Intergenic
1149102947 17:52928009-52928031 ATGGGGAGATGGAAGGGGGTTGG + Intergenic
1149128579 17:53266799-53266821 ATGGAAAGATGAAAGGGGGAGGG - Intergenic
1149144074 17:53468769-53468791 TTGAAGATCTGGAGAGGGGAGGG + Intergenic
1149329700 17:55568082-55568104 TTTGCCAGCTGGAAAGGGGAAGG + Intergenic
1149404059 17:56329039-56329061 GAGGATTGCTGGAAAGGGGAGGG - Intronic
1149414948 17:56449380-56449402 ATGGAGAGAGGGAGAGGGAAAGG - Intronic
1149637751 17:58184306-58184328 AGGGGAAGCAGGAAAGGGGAAGG - Intergenic
1149717288 17:58804505-58804527 ATGGAGATAGGGAAGGGGGATGG + Intronic
1149722884 17:58863722-58863744 CTGGGGTGCTGGAAAGGGGATGG + Intronic
1149894942 17:60422097-60422119 AGGGAGAGCTGAAAGGGAGAAGG - Intronic
1149989246 17:61372032-61372054 ATGGAAAGATGGAAGGGTGACGG - Intronic
1150156326 17:62856643-62856665 TTGTAGAGCTGGAAAAGAGAGGG + Intergenic
1150398048 17:64836573-64836595 TTGGGGAGCTGGACAGGGGATGG + Intergenic
1150535677 17:66037327-66037349 AAGGAGAGCTGGAGAGTGGATGG - Intronic
1150686460 17:67325106-67325128 AAGGGGAGGTGAAAAGGGGAGGG - Intergenic
1150854722 17:68741035-68741057 ATAGGGAGCTGGAAGGGGGATGG - Intergenic
1150859948 17:68790936-68790958 ATGAGAAACTGGAAAGGGGAAGG + Intergenic
1150931524 17:69590241-69590263 ATGGGGAGCTGGGAAGGGGATGG + Intergenic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151018498 17:70584807-70584829 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1151377904 17:73704013-73704035 AAGGAGAGAGGGAAGGGGGAAGG - Intergenic
1151429822 17:74054961-74054983 AAGGAGAGAGAGAAAGGGGAGGG - Intergenic
1151511288 17:74561805-74561827 AGTGAGACCAGGAAAGGGGAAGG - Intergenic
1151533200 17:74720888-74720910 AAGGGGAGCTGGAAAAGGGATGG + Intronic
1151573090 17:74936782-74936804 CTGGAGAGCTGGGAAGGGTCGGG - Intronic
1151989450 17:77564835-77564857 AAGGAGAGCTGGGAAGGAGATGG - Intergenic
1152006589 17:77686004-77686026 ATAGAGAGATGGAGAGTGGATGG - Intergenic
1152113183 17:78368595-78368617 ATGGAGAGCTGGCAGAGGCAGGG + Intergenic
1152168511 17:78726970-78726992 AGAGAGAACTGGAAAGAGGATGG - Intronic
1152243030 17:79170093-79170115 ATGGAAAGCAGGAAAGGAGGAGG + Intronic
1152256879 17:79245038-79245060 AGGGAGAGGAGGGAAGGGGAGGG - Intronic
1152278392 17:79371408-79371430 ACAGGGAGCAGGAAAGGGGAGGG - Intronic
1152442575 17:80317973-80317995 GAGGGGAGCTGGAGAGGGGATGG + Intronic
1152807224 17:82361865-82361887 CAGGAGAGCTGGAAAGGCAAAGG - Exonic
1152840664 17:82566044-82566066 ATGGAGAGGTGGCCAGGGGCTGG + Intronic
1152843054 17:82582304-82582326 GTGGAGAGCTGGCAACAGGAGGG - Intronic
1152948453 17:83211586-83211608 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152948468 17:83211635-83211657 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152980012 18:267946-267968 ACGGTGAGCTGTAGAGGGGAGGG - Exonic
1153369192 18:4294832-4294854 ATGGGAAACTGGACAGGGGATGG + Intronic
1153411920 18:4802978-4803000 ACAGGGAGCTGGAAAGGGGATGG + Intergenic
1153681457 18:7504823-7504845 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1154070193 18:11146813-11146835 TTGGAGAGCGGGATGGGGGATGG + Intronic
1154154175 18:11930840-11930862 ATGAAGAGCTGCATAGGGCAAGG + Intergenic
1154155925 18:11944057-11944079 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1154309875 18:13259180-13259202 AGGGAGAGGAGGAGAGGGGAGGG - Intronic
1154442903 18:14408786-14408808 AAAGGGAGCTGGAAAGGGGATGG - Intergenic
1154505899 18:15040574-15040596 ATGGAGAACAGGAATGGGAATGG + Intergenic
1155394907 18:25376959-25376981 ATGAGGAGCTGGGAAGGGGATGG - Intergenic
1155561349 18:27080732-27080754 AGGGAGATCTGGAAAGAAGATGG + Intronic
1155637790 18:27975860-27975882 GAGGGGAGCTGGAAAGGGGATGG + Intronic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1155889976 18:31255599-31255621 ATGGAGTCCTGGAAGAGGGAAGG - Intergenic
1156309953 18:35912554-35912576 GTGAAGGGCAGGAAAGGGGAAGG - Intergenic
1156311529 18:35926830-35926852 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1156374552 18:36501588-36501610 ATAGAGATCTGGAGAGAGGAAGG + Intronic
1156400644 18:36736508-36736530 AAGGAGAGCTGGAAAGGGGATGG + Intronic
1156651670 18:39233523-39233545 GAGGGGAGCTGGAAAGGGAATGG + Intergenic
1156684389 18:39627223-39627245 ATGTAAAGCTGCAGAGGGGATGG + Intergenic
1156713514 18:39977351-39977373 AAGTGGAGCTGAAAAGGGGATGG + Intergenic
1156895193 18:42238299-42238321 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
1156911642 18:42417552-42417574 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1157014792 18:43699007-43699029 ACGGGGAGCTAGAAAGGCGATGG + Intergenic
1157299845 18:46471860-46471882 ATGGAGAGTTGGCGAGTGGATGG - Intergenic
1157679540 18:49593694-49593716 ATGGAAAGCCAGAAAAGGGAAGG + Exonic
1157859228 18:51125759-51125781 ATGGGGAGCTAGAAAGAGAATGG + Intergenic
1157863961 18:51165223-51165245 ATGGAGTGCTGGCAAGGACAGGG - Intergenic
1157958590 18:52126666-52126688 AAGGGGAGCTGGAAAGGGGTTGG - Intergenic
1158057902 18:53303937-53303959 ATGGGAAGCTAGAAAGGGGGTGG + Intronic
1158184820 18:54759875-54759897 ATAAGGAGCTGGAAAGGGGATGG - Intronic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158196133 18:54886994-54887016 AGGGAGAGTTGGCGAGGGGAGGG - Intronic
1158443898 18:57502105-57502127 AAGGAGAGGAGGAAAGGAGACGG + Intergenic
1158968542 18:62644671-62644693 AAGGGGAGCTGGAAAGAGGATGG - Intergenic
1159030523 18:63226060-63226082 AAGGGGAGCTGAAAAGGGGACGG + Intronic
1159258245 18:65976738-65976760 ACGGAGAGCTGAAAAGGAAATGG + Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159447392 18:68557524-68557546 GTGGGGAATTGGAAAGGGGATGG + Intergenic
1159470585 18:68850342-68850364 CGGGAGAGCTGGGAAGTGGAAGG + Intronic
1159666106 18:71162216-71162238 AAGGGGAGCTGAAAAGGGGAGGG - Intergenic
1159726578 18:71967858-71967880 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1159777504 18:72620389-72620411 AAGGGGAGCTGGAAAGGAAATGG + Intronic
1160127468 18:76189597-76189619 ATGGGGAGATGGAAAGTGGATGG - Intergenic
1160149454 18:76388113-76388135 ATGAGGAGCTGGAAAGGGGATGG - Intronic
1160317344 18:77859889-77859911 CTCTAGAGCTGGCAAGGGGAAGG - Intergenic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1160594179 18:79962957-79962979 ATGGAGAGTTGGAACAGGCAAGG - Intergenic
1160914987 19:1492050-1492072 CTAGAGATTTGGAAAGGGGAAGG - Intronic
1161329116 19:3678061-3678083 ATGGAGAGATGGAAGGAGAATGG + Intronic
1161948873 19:7456151-7456173 GTTGAGACCTGGAAAGGTGATGG + Intronic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1162199882 19:9012123-9012145 ATGGAGAGAAGGGAAGGGAAGGG + Intergenic
1162222465 19:9189469-9189491 AAGGGAAGCTGGAAAAGGGATGG - Intergenic
1162335798 19:10059540-10059562 TGGGAGAGATGGCAAGGGGAGGG + Intergenic
1162344279 19:10110619-10110641 AGGCAGAGCTGGGAAGGGCAGGG + Intronic
1163090697 19:15017896-15017918 AACAAGAGCTGGAAAGGGGCCGG + Intronic
1163736424 19:18984077-18984099 GTGGAGAGCCAGAAAGGAGAGGG + Intergenic
1163823865 19:19511929-19511951 AGGGAGAGAGGGAAAGGAGATGG - Intergenic
1164158592 19:22611597-22611619 ATGGAGCTCTCTAAAGGGGAAGG - Intergenic
1164678931 19:30121247-30121269 ATGGAGAAATGGATGGGGGATGG - Intergenic
1164839607 19:31382546-31382568 TTGGAGAGAGGGACAGGGGATGG + Intergenic
1165030656 19:32995900-32995922 AAGGAGAGCTGCACAGGGTAGGG - Intronic
1165300854 19:34967848-34967870 AAGAGGAGCTGAAAAGGGGATGG - Intergenic
1165790275 19:38487254-38487276 ATGGAGAGAAGGATAGGGAACGG - Intronic
1166002652 19:39887007-39887029 CTGCAGAGCTGGAAAGGGAAAGG + Intronic
1166005438 19:39903259-39903281 CTGCAGAGCTGGAAAGGGAAAGG + Intronic
1166317250 19:41996171-41996193 ATGGAGACTGGGAAAGGGGGAGG + Intronic
1166324117 19:42038623-42038645 CTGGAGGGCTGGAAAGGGCACGG + Intronic
1166851912 19:45765313-45765335 ATGGAGACCTGGACAGGAGGTGG + Exonic
1166948043 19:46409150-46409172 AGGGAGAGAGGGAGAGGGGAGGG + Intergenic
1166948054 19:46409179-46409201 AGGGAGAGAGGGAGAGGGGAGGG + Intergenic
1166948065 19:46409208-46409230 AGGGAGAGAGGGAGAGGGGAGGG + Intergenic
1166972898 19:46582225-46582247 ATAGATAGCTGGAACTGGGACGG - Intronic
1167019260 19:46861550-46861572 ATGGAGGGGTGGAAGGGGGAAGG - Intergenic
1167044321 19:47040942-47040964 AGGGAGAGATGGGAAGGGGGTGG - Intronic
1167414080 19:49361388-49361410 ACGGAGACCTAGAAAGGGCAGGG + Exonic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167642460 19:50689113-50689135 AATGGGGGCTGGAAAGGGGAAGG - Intronic
1168098259 19:54127754-54127776 ATGGGGAGAGGGAAAGGAGAAGG - Intronic
1168167067 19:54556083-54556105 ACCCAGAGCTGGAAAGGGCAAGG + Intergenic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1202645244 1_KI270706v1_random:133234-133256 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925488003 2:4357764-4357786 ATGGGGAGCAGGAAAGAGCAAGG - Intergenic
925610123 2:5695861-5695883 ATGGGGAGCTGGAGATGGAAAGG - Exonic
925675926 2:6360910-6360932 GTAGGGAGCTGGAAAGGGGGAGG + Intergenic
925706324 2:6687083-6687105 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
925755313 2:7127941-7127963 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755418 2:7128135-7128157 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755441 2:7128176-7128198 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755464 2:7128217-7128239 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755471 2:7128230-7128252 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755494 2:7128271-7128293 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925800983 2:7600042-7600064 CAGGAGGGCTGGAAAAGGGATGG - Intergenic
925886184 2:8395239-8395261 AAGGGGAGTTGGAAAGAGGAGGG - Intergenic
926162920 2:10501165-10501187 AGGGTGAGCAGGAAAGTGGATGG - Intergenic
926269665 2:11355708-11355730 AGGGAGAGCTGGAAAGAGATTGG + Intergenic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926389064 2:12368720-12368742 TTGGAGAGGTGGAAGGGGAAGGG + Intergenic
926458401 2:13097724-13097746 AGGGAGGGGTGGAAAGGGAAAGG - Intergenic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
926468900 2:13228022-13228044 AAGGGGAGCTCGAAAGGGGTTGG + Intergenic
926528518 2:14012128-14012150 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
926543012 2:14204591-14204613 AAGGGGACCTGAAAAGGGGATGG - Intergenic
926735007 2:16067049-16067071 ATGGAAAGGTGGAAACTGGAAGG + Intergenic
927078792 2:19607538-19607560 CTGGATAGTTGGAGAGGGGAAGG - Intergenic
927322398 2:21762578-21762600 ATGGGGAGCTGGAACAGGGTTGG + Intergenic
927485471 2:23485745-23485767 TTGCACAGCTGGAAAGGGGCAGG - Intronic
927684073 2:25158725-25158747 GGGGAGAGCTTGGAAGGGGAAGG - Exonic
927865342 2:26584295-26584317 ATGGAGAGTTGCAAAGCGCAGGG - Intronic
928059302 2:28094695-28094717 ATAGAGAACCGGAAAGGGAATGG - Intronic
928075772 2:28263162-28263184 AAGGAGAGGAGGAGAGGGGAGGG + Intronic
928110987 2:28508677-28508699 CTGGTGAGCTTGGAAGGGGAGGG - Intronic
928248362 2:29652053-29652075 ACAGAGAGCTGGTAAAGGGAAGG + Intronic
928441440 2:31295542-31295564 ATGCAGAGCTGAAAAGGGGATGG - Intergenic
928494026 2:31813456-31813478 ATGGGGAGCTAGAAAGTGGATGG + Intergenic
928528450 2:32165742-32165764 AGGGACAGCCGGGAAGGGGACGG + Intergenic
928664492 2:33537119-33537141 ATGGGGAGCTGGAAAGGGGATGG + Intronic
928860044 2:35846421-35846443 AAGGGGAGCTGAAAAGGGGACGG + Intergenic
928869662 2:35961502-35961524 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
929385709 2:41403722-41403744 AGGGAGAAAAGGAAAGGGGAAGG + Intergenic
929726006 2:44428240-44428262 ATGGAGAGTTGGAAATGGGGTGG + Intronic
929886022 2:45879300-45879322 AAGGGGAGCGGGAAAGGGGATGG - Intronic
929906982 2:46054972-46054994 AAGGGGAGCTGAAAAGGGGATGG - Intronic
930288540 2:49465396-49465418 AAGGGGAGAGGGAAAGGGGAAGG - Intergenic
930288548 2:49465415-49465437 AAGGGGAGAGGGAAAGGGGAAGG - Intergenic
930320106 2:49843728-49843750 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
930393380 2:50789015-50789037 AGGGAGACCAGGAAAAGGGATGG + Intronic
930525523 2:52524825-52524847 GAGGGGAGCTGAAAAGGGGATGG - Intergenic
930527272 2:52545662-52545684 AAGGGGAGCTGAAAAGGTGACGG - Intergenic
930533201 2:52615461-52615483 ATGGGAAGCAGGAAAGGGGATGG - Intergenic
931131465 2:59341159-59341181 CTGGAGATCTGGAAAGAGGGTGG + Intergenic
931458669 2:62432188-62432210 AAGGGGAGCTGAGAAGGGGAGGG - Intergenic
931462947 2:62463995-62464017 AAGGGAAGCTGAAAAGGGGATGG - Intergenic
931938946 2:67230891-67230913 AAGGGGAGCTGAAAAGGGAATGG - Intergenic
932369344 2:71174567-71174589 GTGGAGAGCTGCAGAGGGGAAGG + Intergenic
932753123 2:74385102-74385124 ATGAGGAGCTGGAGAAGGGAAGG - Intronic
932815725 2:74860151-74860173 ATGGAGACTTGGAAGGGTGAGGG + Intronic
932827269 2:74953025-74953047 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
933119659 2:78521051-78521073 ATAGAGAGGAGGAAAAGGGAAGG + Intergenic
933250632 2:80024964-80024986 AAGGGGAGCTGGAAGGGGCAAGG + Intronic
933425949 2:82112540-82112562 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
933437246 2:82263275-82263297 ATGAGGAGCTGGAAGGGGCATGG + Intergenic
933475958 2:82790719-82790741 AAGGGGAACTGAAAAGGGGACGG + Intergenic
933544709 2:83695446-83695468 AAGGGAGGCTGGAAAGGGGATGG + Intergenic
933573580 2:84041071-84041093 ATGGAGTGATGGGGAGGGGAAGG - Intergenic
933710256 2:85320079-85320101 ATGGGAAGCTGGAAAGTCGAGGG + Intronic
934507649 2:94906820-94906842 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934556137 2:95287990-95288012 GTGAACAGATGGAAAGGGGAGGG + Intronic
934750700 2:96792434-96792456 AAGGGGAGCGGGGAAGGGGAAGG - Intronic
934791760 2:97068090-97068112 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
934943093 2:98516469-98516491 AGGGAGAGGTGGAAAGGGGTAGG + Intronic
934969363 2:98750589-98750611 ATAGGGAGTTGGAAAGAGGATGG - Intergenic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935175903 2:100648524-100648546 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
935729861 2:106056305-106056327 AAGGGAGGCTGGAAAGGGGATGG + Intergenic
935836188 2:107056826-107056848 ATTGATGTCTGGAAAGGGGATGG + Intergenic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936564362 2:113571665-113571687 CAGGAGAGCTGGACAGAGGAAGG + Intergenic
936647544 2:114389053-114389075 ATGGGGAGCTGGAAATGGGATGG - Intergenic
936657621 2:114506337-114506359 AAGGGGAGCTGGAAAGGGGATGG - Intronic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
937478358 2:122235334-122235356 ATGGACACCTTAAAAGGGGAGGG - Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937538729 2:122923415-122923437 ATCGGGAATTGGAAAGGGGATGG + Intergenic
937840401 2:126519068-126519090 ATGAAGAGCTGGAAAGGGGATGG - Intergenic
937955632 2:127420411-127420433 GTGGAGACCAGGAAAGGGGTTGG - Intronic
938150701 2:128879967-128879989 AAGGGGAGTTGGAAAGGGGATGG + Intergenic
938170955 2:129076291-129076313 ATGCCTAGCTGGAAAGGGGAAGG - Intergenic
938299582 2:130200652-130200674 ATGGCCAACAGGAAAGGGGAAGG + Intergenic
938397298 2:130961114-130961136 ATGGTCAGCTGGGAAGGAGAGGG - Intronic
938457128 2:131473834-131473856 ATGGACAACAGGAAAGGGGAAGG - Intronic
938509543 2:131926108-131926130 ATGGGGAACTGAAAAAGGGATGG - Intergenic
938549962 2:132370814-132370836 ATGGGGTGCTGGAAGGGAGATGG + Intergenic
938699526 2:133863577-133863599 ATGGGGAGCTGCAAAGGGGATGG + Intergenic
938787771 2:134648141-134648163 AAGGAGAGCTGAAAAAGGGATGG + Intronic
939010102 2:136836561-136836583 ATGGGGATCTAGAAAGGTGATGG - Intronic
939101317 2:137897747-137897769 AAGGGGAGCTGGAATGGGGGTGG + Intergenic
939245089 2:139613162-139613184 ATGGGGTGCTGGAAAGGGGATGG - Intergenic
939340974 2:140895733-140895755 ATGGAGAGCTGAAAAGGGGATGG + Intronic
939356915 2:141114436-141114458 AAGGGAAGCTGGAAAGGGGATGG + Intronic
939384273 2:141475826-141475848 ATGAGAAGCTGGAAAAGGGATGG - Intronic
939417860 2:141924337-141924359 ACAGGGAGCTGGAAAAGGGATGG - Intronic
939460107 2:142488295-142488317 AAGGGGAGCTGGAAAGGGGGTGG - Intergenic
939500266 2:142975334-142975356 ATGAGGAACTGGAAAGGGGATGG - Intronic
939583975 2:143984827-143984849 AAGGGGAGCTGGAAAGTGGGTGG - Intronic
939590843 2:144061954-144061976 ATGGAAAGCTGGAGAGGGGATGG - Intronic
939829376 2:147053937-147053959 ATGGGGAGCTGGAAGTGGGATGG - Intergenic
940020350 2:149149790-149149812 ATGGAGATAAAGAAAGGGGAAGG - Intronic
940173140 2:150850061-150850083 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
940240725 2:151560533-151560555 GTGGAGAGCAGGGGAGGGGAGGG + Intronic
940481790 2:154241433-154241455 TTGGAGATCAGGAAAGGGAATGG - Intronic
940653084 2:156456765-156456787 AGGGAATGCTGGAAAGGGGAGGG + Intronic
940655369 2:156481461-156481483 ATTAAAAGCTGGAAAGGGGAGGG - Intronic
940658698 2:156520057-156520079 ATGGGGAGCTGGAAAGGGGATGG + Intronic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
940859991 2:158761534-158761556 CTGGGGAGCTGGGATGGGGAGGG + Intergenic
941717529 2:168779713-168779735 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
941858093 2:170250776-170250798 ATGAGGAGCTGGACAGGGGATGG + Intronic
941880578 2:170476487-170476509 ATGGAGAGCTGGAATGGGGATGG + Intronic
941998148 2:171621057-171621079 ATGGGGAATTTGAAAGGGGATGG + Intergenic
942105503 2:172629526-172629548 ATAGGGGGCTGGAAAGGGGATGG - Intergenic
942173341 2:173308379-173308401 ATGGGGATCTGGAAAGAGAATGG - Intergenic
942224100 2:173799618-173799640 ATGGAGTTATGGAAAAGGGAGGG - Intergenic
942306934 2:174617878-174617900 ATGCAGAGGTGGAAAGGGTGTGG + Intronic
943151285 2:184116499-184116521 TTGGAGAGGTGGAGAGGTGATGG + Intergenic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943377741 2:187100770-187100792 AAGAAGAGAAGGAAAGGGGAGGG - Intergenic
943382590 2:187170472-187170494 AAGGGGAGCTGAAAAGGAGATGG + Intergenic
943474789 2:188340812-188340834 AAGGGGAGTTGGAAAGGGGAGGG + Intronic
943521016 2:188949399-188949421 ATGAGGAGCTGGAAGTGGGAAGG - Intergenic
943628186 2:190221877-190221899 AAGGGGAGCTGTAAAGGGAATGG - Intronic
943746036 2:191463631-191463653 ATGCAGAGCTGGAAAGCGGATGG + Intergenic
943749191 2:191494081-191494103 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
943834384 2:192500568-192500590 AAGGGGAGCTGAAAAGGAGATGG - Intergenic
944001383 2:194842675-194842697 AAGGGGAGCTGAAAAGGAGATGG - Intergenic
944024146 2:195143389-195143411 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
944058688 2:195548699-195548721 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
944159529 2:196643771-196643793 AAGCAGTGCTGGAGAGGGGAAGG - Intronic
944199484 2:197090895-197090917 AAGGGGAGCTGAAAAGGGGATGG - Intronic
944454426 2:199878552-199878574 AAAGGGAGCTGGAAAGGGGACGG + Intergenic
944656154 2:201878427-201878449 ATGGAGGGCAGGAAAGAGGCAGG - Intronic
944891068 2:204117835-204117857 AAGGGGAGCTGGAAAGGGGGTGG + Intergenic
945047979 2:205798692-205798714 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
945128694 2:206542359-206542381 GTTAAGAGCTGTAAAGGGGAAGG + Intronic
945148954 2:206767771-206767793 AAGGAGAGAAGGGAAGGGGAAGG + Intronic
945471147 2:210229006-210229028 AAGGGAAACTGGAAAGGGGATGG + Intergenic
946191872 2:218011722-218011744 GTGGGGAGCTGCAATGGGGACGG - Intergenic
946215953 2:218183790-218183812 ATGGGGAGTTGAAAAGGGGATGG + Intergenic
946487663 2:220116428-220116450 AAGGAAAGCTGGAAATGGAAAGG + Intergenic
946609397 2:221441440-221441462 ATGGGGAGCTGGAAAGGGGAAGG - Intronic
946811539 2:223530776-223530798 GAGGAGAGCTGGAGAGAGGATGG - Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947571458 2:231238901-231238923 CTGGGGAGCTGGAAAGGGCTGGG - Intronic
947815469 2:233033747-233033769 ATGGTGAGCTGGACTGGGGTGGG + Intronic
947851692 2:233293646-233293668 AAGGAGAGTAGGGAAGGGGAAGG - Intronic
948008258 2:234629063-234629085 ATGGGGAGCTGGGAGGGGGATGG - Intergenic
948334642 2:237198189-237198211 ATGGTGAGATGAAAAGGGTATGG - Intergenic
948620215 2:239229887-239229909 AAAGAGACCTGGAAAGGGCATGG + Intronic
948916730 2:241038072-241038094 ATGGAGAGCAGGAATTGGGGGGG - Intronic
949074065 2:242044163-242044185 ATGAACATCTGGAAAGGAGAAGG + Intergenic
1169178619 20:3542548-3542570 AAGGGGAGGTGGAAGGGGGAAGG - Intronic
1169213433 20:3779891-3779913 GTGGAGATGCGGAAAGGGGAAGG + Intronic
1169292283 20:4362982-4363004 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1169554275 20:6732990-6733012 ATGGTGAGTGGGGAAGGGGATGG + Intergenic
1169733593 20:8812717-8812739 TGGGAGAGCTGAAAATGGGAAGG + Intronic
1169938826 20:10915092-10915114 ATGGAGACTTGGAAGGGTGAGGG + Intergenic
1170385855 20:15815993-15816015 ACGGAGAGATGGACTGGGGAAGG - Intronic
1170442127 20:16389817-16389839 ATGAAGAGCTGGAAACCTGATGG - Intronic
1170503240 20:16996554-16996576 ATGGAGGGAAGGAAAGAGGATGG - Intergenic
1170528651 20:17267096-17267118 ATGGGGAGCTGGATTGGGCACGG - Intronic
1170667358 20:18398405-18398427 AAGCAGAGCAGGAAAGGGAAAGG + Intronic
1170679590 20:18514208-18514230 ATGTAGAGCTGGAAGACGGAGGG + Intronic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1171211566 20:23321011-23321033 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1171465316 20:25323872-25323894 AAGGACAGCAGGAAAGGGGATGG + Intronic
1171895207 20:30752154-30752176 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1172014205 20:31863334-31863356 TAGTACAGCTGGAAAGGGGAAGG + Intronic
1172015626 20:31870797-31870819 AGGCAGAGCCGGAAGGGGGACGG - Intronic
1172080797 20:32339067-32339089 CTGGAGTGATGGAATGGGGATGG + Intergenic
1172237011 20:33384415-33384437 AGGGAGAGCTGGAAGGGGAGAGG + Intronic
1172396202 20:34607511-34607533 ATGGAGAGCTGGAAAGGGGATGG - Intronic
1172593269 20:36132280-36132302 CTGGAGAGCTGGAAAAGGCCAGG - Intronic
1172794368 20:37527082-37527104 AAGGAGATTTGGAAAGGGGAAGG + Intronic
1172898328 20:38316220-38316242 ATGGAGGGAAGAAAAGGGGAAGG - Intronic
1173059518 20:39648121-39648143 ATGGGAAGCTGGAAGGTGGAGGG + Intergenic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173871519 20:46344995-46345017 ATGGAGAGATGGATAATGGATGG - Intergenic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1173902275 20:46599762-46599784 ATGCAGACATGGAAAGGGTAGGG - Intronic
1174028786 20:47603652-47603674 ATGAGGAGCTGGAAAGGGGATGG + Intronic
1174102257 20:48136766-48136788 AAGGGAGGCTGGAAAGGGGATGG - Intergenic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174265800 20:49331038-49331060 ATGGAGAGTTGACAAGTGGATGG - Intergenic
1174664680 20:52246953-52246975 ATGAAGAGATGGATAGGGCAAGG + Intergenic
1175168407 20:57062700-57062722 ATGGGGACCTGGAAAGGGAATGG + Intergenic
1175200465 20:57273338-57273360 CTGGGGAGCTGGAGAGGGCATGG + Intergenic
1175287079 20:57844187-57844209 ATGGAAAGCTGAAAGGGGGTGGG + Intergenic
1175651169 20:60724523-60724545 ATGGAGGGAAGGAAGGGGGAAGG + Intergenic
1175814496 20:61876459-61876481 CCGGAGAACTGGGAAGGGGAAGG + Intronic
1175840290 20:62022267-62022289 ATGGAGAGGTGGGAAGGGTCAGG + Intronic
1175898863 20:62352180-62352202 ACGGAGAGGTGGGTAGGGGAGGG - Intronic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1176453182 21:6882418-6882440 AAAGGGAGCTGGAAAGGGGATGG + Intergenic
1176606641 21:8839508-8839530 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1176783940 21:13232454-13232476 ATGGGGAACTGAAAAAGGGATGG + Intergenic
1176831355 21:13747466-13747488 AAAGGGAGCTGGAAAGGGGATGG + Intergenic
1176980493 21:15375897-15375919 ATGGGGAGCTGGAAATGGGATGG - Intergenic
1176981013 21:15381046-15381068 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1176981525 21:15386790-15386812 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1177024932 21:15911378-15911400 ATGGAGGGCTGGGAGAGGGATGG - Intergenic
1177123822 21:17170796-17170818 ATGGATACTTGGAAAGGCGAAGG - Intergenic
1177491433 21:21830915-21830937 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1177542465 21:22512568-22512590 ATTGTGTGCTGGAAAGGGGAAGG + Intergenic
1177605055 21:23367250-23367272 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
1177647443 21:23917696-23917718 ATGGGGAGCTGGAAGGGGGCTGG - Intergenic
1177794929 21:25765485-25765507 ATGAAGGGATGGAAAGGGGAAGG - Intronic
1177801581 21:25833693-25833715 AAGGGGACCTGGAAAGGGGATGG - Intergenic
1177864759 21:26499786-26499808 AAGGAAAACTGGAAAGGGAAAGG + Intronic
1177968460 21:27759089-27759111 GAGGGGAGATGGAAAGGGGATGG - Intergenic
1177981988 21:27926287-27926309 ATGGGGAACTGAAAAAGGGATGG + Intergenic
1177991355 21:28039455-28039477 ATGGAGAACAGGAATGGGAATGG - Intergenic
1178087048 21:29122515-29122537 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178164877 21:29962122-29962144 ATGGGGAGCTGGGAAAGGGATGG + Intergenic
1178199831 21:30390911-30390933 GTGGGGAGCTAGAAGGGGGATGG - Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178275627 21:31234305-31234327 AAAGAGAGCAGGAGAGGGGAAGG + Intronic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178638618 21:34327656-34327678 ATGGAGATGTACAAAGGGGAGGG - Intergenic
1178782108 21:35613532-35613554 TTGGAGAGCTTGAAAGTGAAGGG + Intronic
1179237881 21:39563479-39563501 AAGGAGGGAGGGAAAGGGGAAGG - Intronic
1179329115 21:40381288-40381310 ATAGAGATATGGAAAGGGGAAGG + Intronic
1179389608 21:40975709-40975731 CTGGAAAGCTGGACTGGGGAAGG + Intergenic
1179579484 21:42331893-42331915 ATGGAGAAGTGATAAGGGGAAGG + Intergenic
1180012257 21:45058731-45058753 ATGGGGACATGGAATGGGGAGGG + Intergenic
1180042992 21:45289678-45289700 AAAAAGAGCTGGAAAGGGAAGGG + Intergenic
1180140914 21:45892965-45892987 AGGGAGTGCTGGAGAGGGGAGGG + Intronic
1180356715 22:11849210-11849232 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1180381546 22:12143121-12143143 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1180879779 22:19195638-19195660 ATACAGAGCTGGAGAGGGGTGGG + Intronic
1180953135 22:19729776-19729798 ACGGAGAGCCGGCAAGAGGAGGG - Intergenic
1181049472 22:20231769-20231791 ATGGAGAGCTGGAGAGCAGCTGG + Intergenic
1181161716 22:20963706-20963728 ATGGAGGGCTGGAAGCAGGAGGG - Intergenic
1181175343 22:21031986-21032008 CTGGAGAGCTGGAATGGGGCAGG + Intronic
1181447762 22:22991407-22991429 AGGGAGAGAGGGAGAGGGGAAGG + Intergenic
1182122066 22:27794662-27794684 AGGAAGGACTGGAAAGGGGATGG + Intronic
1182460306 22:30478870-30478892 ATGGGGAGCTGGAACAGGGATGG - Intergenic
1182515465 22:30856208-30856230 ATGGAGAGATGGAGGGGTGAAGG - Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1182943169 22:34297672-34297694 AAGGAGAGCAGGCCAGGGGAGGG - Intergenic
1183078859 22:35443628-35443650 TTGGAAAGGTGGAAAGGTGAGGG - Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183309408 22:37101343-37101365 TGGGAGAGCAGGAAAGGGAAAGG + Intronic
1183615616 22:38943467-38943489 AAGGAGACCAGAAAAGGGGAAGG - Intergenic
1184205347 22:42998952-42998974 ATGGGGAGCTGGAGATGGGATGG - Intronic
1184285486 22:43468758-43468780 ATGGAGAGCTGACCAGGGCAGGG + Intronic
1184293046 22:43508502-43508524 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293214 22:43509056-43509078 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293321 22:43509408-43509430 ATGGATAGATGGATGGGGGATGG - Intergenic
1184302056 22:43567158-43567180 ATAGAGAGCTGGGAGGAGGAGGG - Intronic
1184379656 22:44137352-44137374 AGGGAGAGCTGGAAAAGGGGAGG + Intronic
1184437554 22:44488789-44488811 AAGGAAAGGAGGAAAGGGGAGGG + Intergenic
1184519996 22:44987795-44987817 ATAGAGAGAAGGAAGGGGGAGGG - Intronic
1185015269 22:48339199-48339221 ACAGAGACCTGGAGAGGGGATGG + Intergenic
1185076637 22:48686749-48686771 ATGGATAGATGGGTAGGGGATGG + Intronic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
949318803 3:2786106-2786128 AGCGGGGGCTGGAAAGGGGATGG - Intronic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949464758 3:4333027-4333049 ATGGGGAGCTGGATAGGGGATGG - Intronic
949631213 3:5928916-5928938 AAGGGGAGCTGAAAAGGGAATGG - Intergenic
949675439 3:6447920-6447942 GAGGGGAGCTGGGAAGGGGACGG + Intergenic
949684208 3:6549505-6549527 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
949740637 3:7229694-7229716 ATGGAGAGCGGGGTTGGGGAAGG - Intronic
949802107 3:7915266-7915288 ATGGGGAGCTGGACAGGGGATGG - Intergenic
950085425 3:10254224-10254246 GTGGAGAGCTGTAACAGGGATGG + Intronic
950204440 3:11067920-11067942 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
950254477 3:11493172-11493194 GAGGGGAGCTGGAAAGGGGGTGG + Intronic
950330826 3:12154908-12154930 GGGAAGGGCTGGAAAGGGGAAGG - Intronic
950664828 3:14488745-14488767 AGGGAGAGAAGGAAAGGGGGAGG - Exonic
950698955 3:14726878-14726900 CTGGAGAGGGGCAAAGGGGAGGG - Intronic
950930412 3:16783564-16783586 ATGGGTAGCTGGAGAGGGGATGG - Intergenic
950978919 3:17280645-17280667 AAGGGGAGCTGAGAAGGGGATGG - Intronic
950997469 3:17518511-17518533 AAGGGGAGCTGGAAAGGAGATGG - Intronic
951004353 3:17599455-17599477 ATGGGGAGCTGGAAAGGGGATGG - Intronic
951251147 3:20395507-20395529 AAGAAGAGCTGAAAAGGGGATGG - Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951501331 3:23390434-23390456 AAGGGGAGCTGGAAAGGGGATGG - Intronic
951547635 3:23844476-23844498 ATGGAGAGCTGGAAACGATCTGG - Intronic
951576863 3:24123154-24123176 ATTCAGAGATGGAAGGGGGAAGG + Intronic
951651379 3:24955173-24955195 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
951651830 3:24959341-24959363 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
951669732 3:25167156-25167178 ATGTAGAGCTGAAAAGGTTAAGG + Intergenic
951731616 3:25816014-25816036 ATGGGGAGCTGGACAGGGGATGG - Intergenic
952000565 3:28781115-28781137 ATGGAGAGAGGGCAAGAGGAAGG + Intergenic
952039212 3:29241318-29241340 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
952109775 3:30109118-30109140 ATGGGGAACTGCAAAGGGGATGG - Intergenic
952512978 3:34075914-34075936 ATGGAATGCTGGGCAGGGGAGGG + Intergenic
952561765 3:34603630-34603652 AAGGGGATCTGGAAGGGGGATGG - Intergenic
952962494 3:38601407-38601429 ATAGAAAGCTGCTAAGGGGAGGG - Intronic
953119952 3:40030100-40030122 AGGGAGAGAGGGAGAGGGGAGGG + Intronic
953285474 3:41602383-41602405 AAGGAGAATTGGAAGGGGGAAGG + Intronic
953506429 3:43490220-43490242 TTGGAGATCTGAGAAGGGGAAGG - Intronic
953547069 3:43871512-43871534 ATGGAGAGCTGGAAATGCCTGGG - Intergenic
954294001 3:49664170-49664192 GAGAAGAGCAGGAAAGGGGAAGG - Intronic
954327571 3:49871907-49871929 TTTGAGAGCTGGACATGGGAAGG + Intergenic
954361200 3:50123789-50123811 TGGCAGAGCTGGAGAGGGGAAGG + Intergenic
954394900 3:50288298-50288320 CTGGGGAGCTGGGAAGGGAAAGG + Intronic
954573941 3:51664462-51664484 ATGGAGCTCTCTAAAGGGGAAGG - Exonic
954577827 3:51686527-51686549 GAGAAGACCTGGAAAGGGGAGGG + Intronic
955049396 3:55394665-55394687 GTGGGGTGCGGGAAAGGGGAAGG + Intergenic
955077209 3:55624998-55625020 ATGGAGAGATGGAAATGGATGGG - Intronic
955104866 3:55888321-55888343 CTTGAGAGTGGGAAAGGGGAAGG - Intronic
955588971 3:60514045-60514067 ATGGGGAGCTGGAAAGGGAATGG - Intronic
955609172 3:60739112-60739134 ATGGGGAGCTGGCTGGGGGATGG - Intronic
955841836 3:63120773-63120795 TTGGAGAGGTGGAAAGGTCATGG + Intergenic
955949631 3:64229381-64229403 ATGAAGAGCTGTAATGAGGAAGG + Intronic
955969684 3:64425863-64425885 GGGGAGAGCTGGATGGGGGAGGG - Intronic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
956966717 3:74470384-74470406 GTGGTGAGCTGGAATGGAGAAGG - Intronic
957244706 3:77702378-77702400 GTGGAGAGCTGGAAAGGGGATGG - Intergenic
957297911 3:78355519-78355541 GTGAAGAGCTGAAAAGGGGATGG + Intergenic
957586530 3:82139413-82139435 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
957591463 3:82204913-82204935 ATGAGGAACTGGAAAGGAGATGG + Intergenic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
957824495 3:85423069-85423091 ATGGGGAATTGGAGAGGGGATGG + Intronic
957984964 3:87562462-87562484 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958023675 3:88026268-88026290 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
958100220 3:88999360-88999382 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
958168956 3:89914834-89914856 ATGAGGAGGTAGAAAGGGGATGG + Intergenic
958506397 3:94984249-94984271 GTGGAGTGGGGGAAAGGGGAAGG - Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958529545 3:95309220-95309242 ATGGGGAGCTGAAAAGGGAACGG - Intergenic
958880224 3:99660951-99660973 ATGCAGTGCTGGAAAGGGAATGG + Intronic
959065213 3:101648982-101649004 ATGGGGAGCTGGAAAGGGGATGG + Exonic
959164387 3:102758731-102758753 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
959375512 3:105584334-105584356 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
959486634 3:106934500-106934522 GTGGGGAACTGGAAAGGGGATGG - Intergenic
959694186 3:109231873-109231895 ATGGGGAGCTGGAAAGTGGATGG - Intergenic
959723314 3:109516099-109516121 AAGGGGAGCTTGAAAGGGGGTGG + Intergenic
959735699 3:109655293-109655315 AAAGGGAGCTGGAAAGGGTATGG - Intergenic
959773245 3:110125324-110125346 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
959946850 3:112134157-112134179 AAGGGGAGCTGCAAAGGGGATGG - Intergenic
960358178 3:116678771-116678793 ATGGAGAGCTGGAATGGGGATGG - Intronic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960508970 3:118525615-118525637 ATGGGGAACTGGAAAAGGGATGG + Intergenic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
961169505 3:124786619-124786641 AGGGAGCCCTGGAAAGAGGAAGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
962119610 3:132548072-132548094 AGGGGGAGCTGAAGAGGGGATGG - Intergenic
962412972 3:135157392-135157414 AGGGAAAGCTGTAAAGGGAAAGG - Intronic
962478809 3:135780715-135780737 ATGGAGAGCTAGCAAGATGAGGG - Intergenic
962849292 3:139295853-139295875 ATGGAAAGGTGGAAGGGAGAAGG - Intronic
963025954 3:140918975-140918997 ATGGAGACTTGTTAAGGGGATGG - Intergenic
963102832 3:141622727-141622749 ATGGGGAGCTGAAAGGGGGATGG - Intergenic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963249535 3:143090329-143090351 ATATAGAGAAGGAAAGGGGAGGG - Intergenic
963451700 3:145490420-145490442 AAGGGGAGCTGAAAAGAGGATGG - Intergenic
963462918 3:145639862-145639884 AGGGAAAACTGGTAAGGGGATGG + Intergenic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
963762202 3:149295276-149295298 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
963858438 3:150280712-150280734 AAGGGGAGCTGCAAAGGGGACGG - Intergenic
964136577 3:153351532-153351554 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
964181732 3:153895704-153895726 ATGGAGTGCTGGAAATAGCATGG - Intergenic
964247453 3:154669976-154669998 ATGGGGAGCTGGAAAGGGCATGG - Intergenic
964555795 3:157936613-157936635 AGGGACAGCTGGAATGTGGAGGG - Intergenic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
964917826 3:161857586-161857608 ATGGAGAACTGGAAGGGACAAGG - Intergenic
964920546 3:161890770-161890792 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
964934898 3:162072189-162072211 ATGGGGGGCAGGAAAAGGGAAGG + Intergenic
965085319 3:164088750-164088772 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
965208424 3:165751643-165751665 ATGGAGAGCTGGAAAGGGAATGG - Intergenic
965299714 3:166994822-166994844 ATGGAGAGATGAAAAGGAAATGG + Intergenic
965300827 3:167002553-167002575 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
965535010 3:169814206-169814228 ATGGGGAGCCAGAAAGGGAATGG + Intergenic
966033304 3:175377885-175377907 AAGAGGAGCTGAAAAGGGGATGG - Intronic
966348126 3:179001278-179001300 ATGGGGAACTGGAAAGTGTATGG + Intergenic
966473295 3:180316966-180316988 ATGGAGAGCAGGACAGGGAGAGG - Intergenic
966924748 3:184636942-184636964 AAGGAGAGCTAGAATTGGGAGGG - Intronic
967070892 3:185961443-185961465 TTGGGGAGCTAGACAGGGGATGG + Intergenic
967149100 3:186631800-186631822 AGAGAGAGCTAGAAAGTGGAAGG - Intergenic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967223006 3:187264982-187265004 ACTGAGAGCTAGAAAGGAGATGG - Intronic
967311074 3:188106771-188106793 ATGAAGAGATGACAAGGGGATGG - Intergenic
967448767 3:189598289-189598311 AGGGACAGCAGGAGAGGGGAGGG + Intergenic
967492307 3:190107588-190107610 TTGGAGAACTGTAAAAGGGAAGG + Intronic
968295975 3:197576923-197576945 ATGGAGCTCTGGGACGGGGAAGG + Intergenic
968295992 3:197576992-197577014 ATGGAGCTCTGGGATGGGGAGGG + Intergenic
968598563 4:1498080-1498102 ATGGGAAGCTGGAAAAGAGACGG + Intergenic
968792147 4:2672892-2672914 ATGGAGCACTGGGGAGGGGAGGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968885421 4:3328225-3328247 ATGGAGACTTGGAAAGGTGAGGG + Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969166743 4:5322681-5322703 GGGGAGGGCTGGAAAGGGAAAGG - Intronic
969198022 4:5578655-5578677 ATGGAGGGAGGGAAAAGGGAAGG + Intronic
969232818 4:5843346-5843368 ATGCAGGGCTACAAAGGGGAAGG - Intronic
969424852 4:7118201-7118223 ATGGAGAGATGGATGGGAGATGG + Intergenic
969522100 4:7684377-7684399 AGGGAGAGCTTGAAAGGGAAGGG - Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970150632 4:13086235-13086257 GTGTAGAGATGGAAATGGGAGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970479452 4:16458561-16458583 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
970578499 4:17451298-17451320 ATGGGGAATTGGAAAGGGGGTGG + Intergenic
970756151 4:19429108-19429130 AAAGGGAGCTGAAAAGGGGATGG + Intergenic
970926289 4:21456262-21456284 TTGGTGAACTGGAAAGGGCAAGG - Intronic
970943321 4:21661183-21661205 ATGGGGAGCTGGAAAGGAGATGG - Intronic
971076103 4:23151652-23151674 AAGGGGAGCTGAAAAGGTGATGG - Intergenic
971387996 4:26159254-26159276 ATGGAGGCCTGGAAAGGTGAAGG + Intergenic
971427330 4:26529510-26529532 AAGGGGAGCAGGAAAGGGGATGG + Intergenic
971427481 4:26530563-26530585 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
971502062 4:27328366-27328388 ATGGGAAGCTGGAAGGGGGATGG + Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
971730289 4:30370379-30370401 AAGGAGAGCTGGAAAAGGGATGG - Intergenic
971742677 4:30540152-30540174 ATGGGGATCTGGAAAGGGGATGG + Intergenic
971787505 4:31123812-31123834 ATGGGGGTCTGGAAAGAGGATGG + Intronic
971796823 4:31238931-31238953 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
971831513 4:31701631-31701653 ATGGGGAGCTGGGAAGGGAGTGG - Intergenic
971840239 4:31842198-31842220 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
971873692 4:32276384-32276406 ATGGGAAGCTGCAAAGGGGGTGG + Intergenic
971947966 4:33306007-33306029 ATGGGGAGCTAGAAAAGAGATGG - Intergenic
972066536 4:34953131-34953153 AAGGGGAGCTGAAAAGGGGCTGG - Intergenic
972357503 4:38294344-38294366 TTGGAAAGCTTGAAAGGGGATGG + Intergenic
972759339 4:42087803-42087825 ATGGCAAGTGGGAAAGGGGAAGG - Exonic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
973001749 4:44960910-44960932 AGGGAGATGGGGAAAGGGGAAGG - Intergenic
973068015 4:45821703-45821725 ATGGGGAGCTGGAGAGGGAATGG + Intergenic
973141041 4:46768259-46768281 ATGGGGAGCTGGAAAGGAAATGG + Intronic
973193125 4:47409377-47409399 ATGGGGAGCTGGAAAGAGGCTGG + Intronic
973253559 4:48085808-48085830 ATGGGGAGCTGGAAATGGGATGG - Intronic
973371471 4:49251649-49251671 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
973389537 4:49543662-49543684 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
973609927 4:52626240-52626262 AAAGAGATCTGGAAAGGAGAAGG + Exonic
973617207 4:52691019-52691041 AAGAAGACCTGGAAAGGGAAAGG - Intergenic
973696247 4:53493831-53493853 GTGGAGAGCTGAAAAGAGAAGGG - Intronic
974169302 4:58245561-58245583 ATGGGGAGCTTAAAGGGGGATGG - Intergenic
974327368 4:60431545-60431567 ATGGAGTGGATGAAAGGGGATGG - Intergenic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
974505912 4:62771956-62771978 AAGAAGAGCTGGAAGGGGTATGG - Intergenic
974752308 4:66156582-66156604 AAGGGGAGCTGAGAAGGGGATGG - Intergenic
974978122 4:68917479-68917501 ATGGGGAGCTGGAATGGTGATGG + Intergenic
974987130 4:69042017-69042039 ATGGAGAGCTGGGATGGTGATGG - Intronic
975060096 4:69986200-69986222 GTGAGGAGCTGGAAAAGGGATGG + Intergenic
975246989 4:72130961-72130983 ATAGAGAGCTGGAACGGGGATGG + Intronic
975580909 4:75906346-75906368 ATGGGGAGCTGGAACGGGGACGG - Intergenic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
975707785 4:77128121-77128143 AAGGGGAGCTGGAATGGGGATGG + Intergenic
975904806 4:79196646-79196668 ATGGACATCTGAAGAGGGGAGGG - Intergenic
976042031 4:80898264-80898286 ATGGGGAGTTGAAAAGGGGATGG + Intronic
976190856 4:82485227-82485249 AGGGAGTGCTGGGAAGGGGACGG + Exonic
976658086 4:87510592-87510614 GAGGTGAGCTGGAAAGGGAATGG - Intronic
976802344 4:89006785-89006807 AAGGAGAGCTAGACAGGGGATGG + Intronic
976883602 4:89960483-89960505 AGGGTGAGCTGGAAAGGGGATGG + Intergenic
977040029 4:92003970-92003992 ATGGAAAGCAGAAAAAGGGAGGG + Intergenic
977249728 4:94676380-94676402 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
977338706 4:95730113-95730135 AAGGGGAGCTGAAATGGGGAGGG + Intergenic
977357847 4:95969323-95969345 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
977359519 4:95984613-95984635 ATGGGGTGCTGAAAAGGGGATGG + Intergenic
977441200 4:97070342-97070364 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
977507964 4:97925986-97926008 TTGGAAAGCTGAAAAGGTGAAGG - Intronic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977827596 4:101552033-101552055 AGGGGGAGCTGAAAAGGGGATGG - Intronic
977928264 4:102725733-102725755 ATGGAAAGATGGAAATGAGATGG + Intronic
977974542 4:103249007-103249029 AGGGAGGGTTGGAGAGGGGAGGG - Intergenic
978111114 4:104964628-104964650 ATGAAAAGCAGGAAAGAGGAAGG - Intergenic
979392256 4:120141143-120141165 ATGGAGAGCTGGAAGAGGGATGG - Intergenic
979727604 4:123982842-123982864 GTGGGGAGCTGGAAAAGGGATGG + Intergenic
979728403 4:123992247-123992269 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
979858546 4:125664824-125664846 AAGGGGAGCTGGAAAGGGTATGG + Intergenic
979863073 4:125718596-125718618 ATGGAGAGATGCACAGAGGAAGG - Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
980006148 4:127544562-127544584 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
980097039 4:128501894-128501916 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
980097313 4:128504692-128504714 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
980495445 4:133584360-133584382 AAGGAGGACTGGAAAGGGAATGG - Intergenic
980496558 4:133592384-133592406 AAGAGGAGCTGGGAAGGGGATGG - Intergenic
980534081 4:134092383-134092405 ATAGGGAGCTTGAAAGGGGATGG - Intergenic
980554610 4:134387052-134387074 ATGGGGAGCTGGAAAAGGGATGG - Intergenic
980734809 4:136870761-136870783 ATTGAGATGCGGAAAGGGGAGGG + Intergenic
980855816 4:138438535-138438557 ATGGAGATCTAGAAAAGGGAAGG - Intergenic
980871459 4:138615753-138615775 ATGGGGACCTGGAAAGGGGATGG - Intergenic
980908783 4:138975277-138975299 AGGAAGACCTGGAAAGGGAAGGG - Intergenic
980978069 4:139629966-139629988 ATGGAGAGCTGGATGCTGGAAGG + Intergenic
981103447 4:140855304-140855326 ATGGGGAGCTGGACAGGAGATGG + Intergenic
981297308 4:143146935-143146957 AAGGGGAGCTGAAAAGGAGATGG - Intergenic
981362769 4:143866549-143866571 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
981373502 4:143987349-143987371 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
981382603 4:144090620-144090642 ATGGAGAGTTGGAAAGGGGATGG - Intergenic
981592247 4:146376602-146376624 ATGGGGAGCTGGAAAGGGGATGG - Intronic
981599653 4:146471955-146471977 ATGGAGAACAGGAAATGGGTGGG - Intronic
981786052 4:148480881-148480903 TTGGAGAGCTAGAATGTGGAGGG - Intergenic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982120479 4:152138523-152138545 AGGGAGATTTGGAAAGGGCAAGG + Intergenic
982200501 4:152955847-152955869 AAGAAGAGTGGGAAAGGGGAGGG - Intronic
982325809 4:154127277-154127299 GTGGGGAGCTAGAAAGGGGATGG + Intergenic
982412551 4:155095189-155095211 ATGCAGAGCTGGCTAGGAGACGG - Intergenic
982671053 4:158320428-158320450 AAGGGGAGCTGAAAAGGGGATGG + Intronic
982737366 4:159020269-159020291 ATGGAGAGATGGGTAGGGGGTGG + Intronic
982810813 4:159824024-159824046 ATGGAGATCTTGAAGGGTGAGGG - Intergenic
982918461 4:161244615-161244637 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
983070094 4:163257401-163257423 ATGGGGAGTTGGAAAGGGGTTGG + Intergenic
983141473 4:164154924-164154946 ATGGGGAGCTGGACAGGGAATGG + Intronic
983172532 4:164552112-164552134 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
983651495 4:170040707-170040729 GTGGAGAGCTGGGAAGATGATGG + Intergenic
983697872 4:170554634-170554656 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
983810195 4:172051473-172051495 AGGGGGAGCTGGAATGGGGATGG + Intronic
983987173 4:174073535-174073557 AAGGGGAGCTGAAAAGGGGATGG + Intergenic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984105554 4:175541175-175541197 GAGGGGAGCTAGAAAGGGGATGG + Intergenic
984129543 4:175856694-175856716 ATGGGGACCTGGAAAGGGGATGG + Intronic
984190218 4:176596614-176596636 CTGGAGAGAGGGATAGGGGAAGG - Intergenic
984245315 4:177268484-177268506 ATAGAGAGTTGGAAAGGGGATGG - Intergenic
984245934 4:177275333-177275355 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
984278011 4:177633717-177633739 ATGGGGAATTGGAAAGGAGATGG - Intergenic
984300572 4:177912119-177912141 AAGGGGAGCTGGAAAGGGGATGG + Intronic
984417217 4:179477203-179477225 GTGGGGAGCTGGAAATGGGATGG - Intergenic
984543811 4:181074437-181074459 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
984718817 4:182951668-182951690 ATGCGGAGCTGGAAAGAGGATGG + Intergenic
985023076 4:185712353-185712375 AAGGGGAGCTGAACAGGGGATGG - Intronic
985048907 4:185970360-185970382 AAGGGGAGCTGAAAAGGGGACGG + Intergenic
985138307 4:186812044-186812066 ATGGGGAGCTGAAAGGTGGATGG + Intergenic
985228143 4:187784675-187784697 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
985269906 4:188184041-188184063 ATGGGGAGGTGGAGAGGGGATGG - Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985511689 5:317419-317441 AGGGAGAGCTGAAAGGGCGAAGG - Intronic
985835911 5:2271735-2271757 GAGGAGAGCTGGTCAGGGGAGGG + Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986292974 5:6415196-6415218 ATGCAGAGATGCAGAGGGGAAGG - Intergenic
986588699 5:9346281-9346303 AAGGGGAGCTGGAAAGGGGATGG - Intronic
986669767 5:10132515-10132537 GAGGACAGCTGGAAAGAGGATGG + Intergenic
986689548 5:10302899-10302921 AAAGAGACCTGGAAAGGGAAGGG - Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987190225 5:15469921-15469943 ATGGGGAGCTGGTAAGGGGATGG + Intergenic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987251133 5:16102616-16102638 ATGGGGAGCTGGAAATGGGTTGG - Intronic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987268448 5:16280081-16280103 ATGGAGAGCTGGAAAGGAGATGG + Intergenic
987271584 5:16314736-16314758 ATGGGGACCTGGACAGGGGATGG - Intergenic
987504836 5:18754368-18754390 ATGGGGAGCTGGAAGTGGGATGG + Intergenic
987570762 5:19654797-19654819 AATGGGAGCTGGAAAGGAGATGG + Intronic
987715057 5:21557734-21557756 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
987926597 5:24350209-24350231 ATGGGGAACTGGAAAAGGGATGG + Intergenic
988037902 5:25851731-25851753 ATGGGCAGCTGAAAAGGGGAAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988231359 5:28483836-28483858 AAGGAGAGCTGGAAAGGTGATGG + Intergenic
988355051 5:30162845-30162867 AAGAGGAGCTGGAAAGGGCATGG + Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988603590 5:32661662-32661684 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
988776519 5:34482303-34482325 GTGGGGAGCTGGGAAGGGGATGG - Intergenic
988922845 5:35960800-35960822 ATGGGGAGCTGGAAAGGAGACGG + Intronic
989207741 5:38828188-38828210 ATGGAGACCTGAAAAGAGGCGGG - Intergenic
989387450 5:40867635-40867657 AAGGGGAGCTGGAAACGGGATGG + Intergenic
989457152 5:41657555-41657577 ATGAAGAGATGGATAGGGCAAGG + Intergenic
989525142 5:42444834-42444856 ATTTGTAGCTGGAAAGGGGAAGG - Intronic
989541736 5:42626419-42626441 ATGAAGAGATGGATAGGGTAAGG + Intronic
989547937 5:42696332-42696354 ATGCAGAGCTGCAAAGGTGGTGG + Intronic
989558597 5:42825591-42825613 ATGGGGAGCTGGAAAGCGGATGG - Intronic
989687808 5:44110067-44110089 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990128405 5:52548322-52548344 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
990176545 5:53114478-53114500 AAGGAGAGCAGAAAAGGGGATGG + Intergenic
990193801 5:53290443-53290465 ATGGGGAGCTGGAACAGGGATGG - Intergenic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990463781 5:56053398-56053420 AAAGGGAGCTGGAAGGGGGATGG - Intergenic
990499023 5:56376539-56376561 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
990597935 5:57329939-57329961 ATGCAGAGCTGGGAATGGGAAGG - Intergenic
990795144 5:59531616-59531638 GTGGACAGCTAGAAAGGGCAAGG - Intronic
991082333 5:62614901-62614923 ATGGGGAGCTGGAAAGGGTATGG + Intronic
991134695 5:63167711-63167733 ATGGATACCTGGAGAGGGTAGGG - Intergenic
991207450 5:64065892-64065914 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
991425725 5:66489736-66489758 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
991540300 5:67720449-67720471 GAGGAGAGCAGGAGAGGGGAGGG - Intergenic
991604975 5:68392182-68392204 ATGAAGAGAGAGAAAGGGGAGGG + Intergenic
991644996 5:68792664-68792686 TTGGGGATCTGGAAAGGGGATGG + Intergenic
991942029 5:71862556-71862578 GTTGAGAGCTGGAGAGGGCAGGG + Intergenic
992160091 5:73992667-73992689 ATAAGGAGCTGGAAAGAGGATGG + Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992344993 5:75867450-75867472 AAGGAGAGAAGGAAAGGAGAAGG + Intergenic
992474515 5:77088562-77088584 ATGGGGAGCTGGAAAGGGGGTGG + Intergenic
992637122 5:78735748-78735770 ATGGGGAGCTAAAAGGGGGATGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
993036247 5:82760789-82760811 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
993184510 5:84600432-84600454 ATGAAGAGCTGGAAATGGGATGG + Intergenic
993274868 5:85844055-85844077 AAGGGGATCTGCAAAGGGGATGG + Intergenic
993773542 5:91962501-91962523 GTGGGGAGCTGGAAAGGAGATGG - Intergenic
993906736 5:93631798-93631820 AGGGAGAGGGGGAGAGGGGAGGG + Intronic
994407213 5:99359845-99359867 AAGGAGAGCTGGAAAGGGGTTGG + Intergenic
994533208 5:100992887-100992909 ATGGGGAGCTGGAAAGGGAATGG + Intergenic
994762820 5:103878220-103878242 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
994775266 5:104031308-104031330 AAGGGAAGCTGGAAAGGGGATGG - Intergenic
994819290 5:104628132-104628154 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
994830424 5:104774897-104774919 AAGAGGAGCTGGAAAGAGGATGG + Intergenic
994955728 5:106529219-106529241 ATGGAAAGGTGGGAAGGGTAGGG + Intergenic
994998380 5:107094670-107094692 ATGGGGAGCTGGAAAAGGGATGG + Intergenic
994999029 5:107103482-107103504 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
995083448 5:108080947-108080969 AAGGAAACCTGGAAAGGGAAAGG + Intronic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
995638156 5:114219437-114219459 AAGGGGAGCTGAAAAGGGTACGG + Intergenic
995727819 5:115201115-115201137 ATGGAGAACTTAAAAGTGGAAGG - Intergenic
995740870 5:115354558-115354580 TAGGGGAGCTGAAAAGGGGATGG + Intergenic
995747552 5:115419335-115419357 AGGGAGAGGTGGACAGGGAAGGG + Intergenic
995996318 5:118304811-118304833 AAGGAGAGATGGAAGGAGGAAGG + Intergenic
996052183 5:118947384-118947406 AAGGAGAGCTGGAAGAGGGATGG + Intronic
996101517 5:119450063-119450085 AAGGGGAGCTGAAAAGGGGATGG + Intergenic
996242064 5:121215915-121215937 ATGGGGAGCTGGGAAGAGAATGG - Intergenic
996243326 5:121228827-121228849 AGGAAGAGATGGAATGGGGAAGG + Intergenic
996399622 5:123047156-123047178 AGGGGGAGATGGAAAGGGGTCGG + Intergenic
996557884 5:124797655-124797677 AAGGGGAGCTGGAAAGCGGATGG - Intergenic
996576729 5:124983967-124983989 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
996650759 5:125873380-125873402 AAGGAGAGCTGAAAAGGGGATGG + Intergenic
996710117 5:126535501-126535523 ATGGGGACCTGGCGAGGGGATGG + Intergenic
996725957 5:126673592-126673614 AAGGAGATCTGGAAAGGAGTCGG + Intergenic
996796125 5:127350451-127350473 ATGGAGGGCAGGAAGGGGCAGGG - Intronic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
997318146 5:132955047-132955069 ATGGGGAGCTGGAAAAGGGATGG + Intronic
998535234 5:142924212-142924234 AAGGAGAGTTGGAAAGAGGAGGG - Intronic
998612459 5:143703812-143703834 ATAGGGAGCTGGAAAGCGGATGG + Intergenic
998762625 5:145449337-145449359 ATGGGGAGCTGGATAGGAGATGG + Intergenic
998791162 5:145767323-145767345 ATGGGGAGCTGGAAAGGGGATGG - Intronic
998856385 5:146398894-146398916 ATGCAGAGTTGAAAAGGGGACGG - Intergenic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
998984396 5:147739696-147739718 TTGGAGCACTGGAAAGGGAAGGG - Intronic
999109278 5:149103951-149103973 ATGAAGAGATGGATAGGGCAAGG + Intergenic
999517307 5:152314452-152314474 AGGGAGAGAAGGAAAGGGGGAGG - Intergenic
999668495 5:153937322-153937344 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
999706860 5:154281523-154281545 ATGGAGACCTGGAAAGACAAGGG + Intronic
999712223 5:154328851-154328873 ATGAAGAGCTGCATAGGGCAGGG + Intronic
999811457 5:155131343-155131365 ATGGGGAGGTGGACAAGGGATGG + Intergenic
999851230 5:155541708-155541730 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
999924549 5:156360765-156360787 AAGGGGAGCTGGAGAGGGGATGG - Intronic
1000149852 5:158489016-158489038 GTGGAGAGCAGGAAATGGCATGG + Intergenic
1000233456 5:159336258-159336280 AAGGGGAGGTGGAAAGGGGAGGG - Intergenic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000413620 5:160960203-160960225 AAGGAGACCTGGGAAGGGGATGG + Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000742511 5:164987230-164987252 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1000852882 5:166362125-166362147 GTGGGGAGCTGGAAAGGGGATGG + Intergenic
1000867956 5:166538429-166538451 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1000949424 5:167462566-167462588 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1001408736 5:171495379-171495401 AGGGAGAGCGGGAAGGAGGAAGG + Intergenic
1001679486 5:173545666-173545688 ATGGCGGGCAGGAAAGGTGATGG - Intergenic
1001969578 5:175943828-175943850 AAGGAGAGCTAGAAAGGGGATGG + Intronic
1002247857 5:177899925-177899947 AAGGAGAGCTAGAAAGGGGATGG - Intergenic
1002717289 5:181235468-181235490 GTTGAGTGCTGGAAAAGGGAAGG - Exonic
1002742620 5:181444741-181444763 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002742635 5:181444790-181444812 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002765574 6:235872-235894 AGGGAGAGGAGGGAAGGGGAGGG + Intergenic
1002999749 6:2319826-2319848 GAGGGGAGCTGGAAAGAGGATGG + Intergenic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003282521 6:4706258-4706280 ATGGAAAGGAGGAAATGGGAGGG + Intronic
1003488110 6:6597039-6597061 TTGGAGAGGTAGAAATGGGAAGG + Intronic
1003551306 6:7104494-7104516 GGGGAGAGGTGGAAAGAGGAGGG + Intergenic
1003593136 6:7452714-7452736 ATGGGGAGCTGGAGGGGGAATGG - Intergenic
1003604824 6:7549768-7549790 AGGGAGAGATGGAAAGAGGAAGG + Intronic
1003687860 6:8322641-8322663 ATAGGGAGCTGGAGAGGGGATGG + Intergenic
1003783091 6:9451442-9451464 AAGGGGAGCTAGAAAAGGGATGG - Intergenic
1003801866 6:9679043-9679065 GTGGAGGGAAGGAAAGGGGAGGG - Intronic
1003939943 6:11014552-11014574 ATGGGGAGAAGGAAAAGGGAGGG - Intronic
1003940425 6:11019666-11019688 ATGGGGAGAAGGAAAAGGGAGGG + Intronic
1003967379 6:11266020-11266042 ATGGAGACTTGGAAGGGAGAGGG + Intronic
1004138390 6:12990805-12990827 ATCAGGAGCTGGAGAGGGGATGG + Intronic
1004167536 6:13270228-13270250 ATGAAGAGATGGACAGGGCAAGG + Intronic
1004294112 6:14394735-14394757 CTGGAGAGCTGAACACGGGAAGG + Intergenic
1004469548 6:15917008-15917030 ATCGGGAGCTGGAAGGGGGATGG + Intergenic
1004647204 6:17573913-17573935 ATGGGGAGCTAGAAAGGGAATGG + Intergenic
1004675572 6:17838760-17838782 ATGGAGACTTGGAAGGGTGAGGG + Intronic
1004906123 6:20238802-20238824 AAGGGGAGCTGGAAAGAGGGTGG + Intergenic
1004907540 6:20250597-20250619 AAGGAAAGCTGGAAAGGGGATGG + Intergenic
1004977513 6:20984636-20984658 AAGGGGAGCTGAAAAGGGGACGG + Intronic
1004985459 6:21077599-21077621 ATGGCCAGCAGGAAAGGGGCAGG + Intronic
1005200883 6:23342791-23342813 TTGGGGGGCTGGAAAGGGGATGG - Intergenic
1005993608 6:30918734-30918756 CAGTAGAACTGGAAAGGGGAAGG - Intronic
1006002483 6:30976285-30976307 ATGGAGTGCTGGGGAGGGCATGG - Intergenic
1006252698 6:32802534-32802556 ATGAAGAAGTGGAAATGGGAGGG - Intergenic
1006409578 6:33864786-33864808 GAGGGGAGCTGGAGAGGGGATGG - Intergenic
1006967604 6:38004451-38004473 ATGGAGAGGGGGAGAGGGGAAGG - Intronic
1007116727 6:39348312-39348334 ATGGAGAGATGGATGGGGCAGGG + Intronic
1007296174 6:40823093-40823115 CTGGAGAGCTGAAAAGGCAAAGG + Intergenic
1007302303 6:40876528-40876550 AAGGAGGGATGGAAGGGGGAAGG - Intergenic
1007303273 6:40884733-40884755 TTGGGGAGCTGGAGAGGGGATGG + Intergenic
1007350383 6:41269182-41269204 ATGGGGAGGTGGAACTGGGATGG - Intronic
1007720088 6:43879601-43879623 AGGGAGAGGTGGAAGGGGGTCGG + Intergenic
1007722464 6:43893228-43893250 ATGGAGAGCAGCAAAAGGCAAGG + Intergenic
1007832718 6:44651122-44651144 ATAGAGAGCTGGGAGGGAGAGGG - Intergenic
1008215488 6:48782917-48782939 AAGGGGAGCTGAAAAGGGGAGGG + Intergenic
1009001666 6:57724310-57724332 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1009349907 6:62661376-62661398 ATGGAGAGCTGGAAGTGGGATGG + Intergenic
1009404090 6:63291414-63291436 TTGGGGAGCAGGAAATGGGATGG + Intronic
1009698485 6:67142583-67142605 ATGGGGAACTAGAAAGGGGATGG - Intergenic
1010294719 6:74182711-74182733 GAGGGGAGCTGGAGAGGGGATGG - Intergenic
1010412018 6:75571235-75571257 ATGGAAAGCTGAAAAGAGCAGGG + Intergenic
1010455283 6:76047604-76047626 AAGGTGAACTGGAGAGGGGAGGG - Intronic
1010494222 6:76513818-76513840 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1010572699 6:77496974-77496996 ATGGAAAGATGGAAAAGGCAGGG - Intergenic
1010584488 6:77641784-77641806 AAGGAGTGCTGGAAAGGGGGTGG + Intergenic
1010613919 6:77990493-77990515 CAGGAGAGCCGGAAAGGGGAGGG - Intergenic
1010621790 6:78085709-78085731 ATGGGGAGCTGGAAATGAGATGG + Intergenic
1010736602 6:79450682-79450704 AAAGGGAGCTGAAAAGGGGATGG - Intergenic
1010804079 6:80214165-80214187 TTGTAGAGCTGGAATGGGGAAGG + Intronic
1011261696 6:85476696-85476718 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1011293282 6:85799795-85799817 ACGGAGACTTGGAAAGGGGAGGG - Intergenic
1011353328 6:86446890-86446912 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1011408787 6:87044190-87044212 AAAGGGAGCTGGAAAGGGGATGG - Intergenic
1011491830 6:87900754-87900776 ATGTGAAGCTGGAAAGGGGATGG + Intergenic
1011493518 6:87916513-87916535 AAGGGGAGCTGAAAGGGGGATGG - Intergenic
1011745354 6:90402958-90402980 AGGGAGAGAGGAAAAGGGGAAGG - Intergenic
1011864675 6:91809923-91809945 ATGGAGGGAGGAAAAGGGGAAGG + Intergenic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1012263242 6:97111808-97111830 AAGGGGAGCTGGAAAGGGGATGG + Intronic
1012448592 6:99331434-99331456 AGGAAGAGATGGAAAGGGCAGGG + Intronic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1012769039 6:103405280-103405302 AAGGAGAGCTGGAAAGGGGATGG + Intergenic
1012945458 6:105461162-105461184 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1013013092 6:106137119-106137141 ATGGAGAGTTGCAGCGGGGAGGG - Intergenic
1013216550 6:108032636-108032658 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1013476109 6:110508791-110508813 ATGGGGAGCTAGAAGGGAGATGG - Intergenic
1013492345 6:110660601-110660623 AAGGGGAGCTGAAAAGGGGATGG + Intronic
1013747656 6:113364914-113364936 ATGGAGTGCTGGAAATGTCAGGG + Intergenic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1014010803 6:116473593-116473615 TTGGAGAGCTAGAAAGTAGATGG + Intergenic
1014045327 6:116877515-116877537 ATCCGGAGCTGGGAAGGGGACGG + Intronic
1014107403 6:117582662-117582684 GAGGGGAGCTGGAAAGGGGATGG - Intronic
1014157635 6:118129551-118129573 ATCTAGATCTAGAAAGGGGATGG + Intronic
1014252209 6:119126848-119126870 AAGGGGAGCTGGAAAAGGGATGG + Intronic
1014625462 6:123719448-123719470 AAGGAGAGCTGACAAGGAGATGG - Intergenic
1014635628 6:123843317-123843339 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1014740511 6:125143451-125143473 GAGGGGAGCTGGAGAGGGGATGG + Intronic
1014812412 6:125901851-125901873 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1014825803 6:126047448-126047470 ATGGGGAGCTGTAAAGGGGATGG - Intergenic
1014912473 6:127111396-127111418 GGGGAGAGCTGGAAAGCAGAAGG + Intergenic
1014992816 6:128103239-128103261 ATGGGGACCCGGAAAGGGGGTGG - Intronic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015194475 6:130510326-130510348 AAGGGGAGCTAAAAAGGGGATGG + Intergenic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1015349006 6:132195033-132195055 ACGGGGAGCTGGAAGGGGGATGG + Intergenic
1015577675 6:134690217-134690239 GTGGAGAGGTGTTAAGGGGATGG - Intergenic
1015705247 6:136080857-136080879 ATGGAGAGCTGCATGGAGGAAGG + Intronic
1015716532 6:136198375-136198397 ATGAAGAGGTGGCAAGGGAAAGG - Intergenic
1015790392 6:136959299-136959321 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1015790411 6:136959369-136959391 AATGGGAGCTGAAAAGGGGATGG - Intergenic
1016117380 6:140303690-140303712 ATGGGTAGCTGGAGAGGGGATGG + Intergenic
1016155914 6:140808564-140808586 ATGGGAAGCTGGAAGGGGGATGG + Intergenic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1016902144 6:149113494-149113516 ATGGGAAGCTGGAGAGGGGATGG - Intergenic
1017584856 6:155909394-155909416 AAGGGTAGCTGGAAAGAGGATGG - Intergenic
1017633611 6:156422844-156422866 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1017782359 6:157725794-157725816 ATGGGGAGTTGGAAAGGGGATGG - Intronic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1017821319 6:158050903-158050925 ATGGAAAGGTGGGAAAGGGATGG - Intronic
1017875576 6:158521551-158521573 AGGGAGAGAAGGGAAGGGGAGGG + Intergenic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018201437 6:161399168-161399190 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1018278016 6:162153680-162153702 AGGGGGAGCTGGAAAGGGGATGG + Intronic
1018702149 6:166435826-166435848 GTGGAGGGCTGGAAAGGTGGAGG + Intronic
1018781957 6:167076227-167076249 AAGGAAAGAAGGAAAGGGGAGGG - Intergenic
1018803094 6:167238380-167238402 AGGCAGAACTGGAAAGGGGGTGG - Intergenic
1018816797 6:167338939-167338961 AGGGAGAGCAGGAAGGAGGAAGG - Intronic
1018831086 6:167444115-167444137 AAGGGGAGCTGGAAGTGGGATGG + Intergenic
1018850595 6:167587729-167587751 AGGGAGAGGTGGAGGGGGGAGGG + Intergenic
1019042314 6:169117467-169117489 AAGGGGAGCTGAAAGGGGGATGG - Intergenic
1019043497 6:169125164-169125186 AAAGAAAGCTGGAAGGGGGATGG - Intergenic
1019247755 6:170720480-170720502 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019247770 6:170720529-170720551 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019549264 7:1594074-1594096 AGGGAGAGATGGAAAGAGGGAGG - Intergenic
1019754767 7:2760928-2760950 AGGGGGAGCTGGAGTGGGGAAGG - Intronic
1020029747 7:4924564-4924586 ATGGACAGCTGGCATGGTGATGG + Intronic
1020139393 7:5604289-5604311 AAGGAGAGCAGGGAAGGGGAGGG + Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020389881 7:7646671-7646693 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1021041910 7:15872800-15872822 ATGGGGAGCTGGACAGAGGATGG - Intergenic
1021073587 7:16273543-16273565 ATGCGGTGCTGGAAAGGGGATGG - Intronic
1021097672 7:16551719-16551741 ATGAAGAGCTGCATAGGGCAAGG - Intronic
1021179944 7:17494658-17494680 ATGAGGAGCTGGAAGGGGAATGG - Intergenic
1021416529 7:20392681-20392703 ATGGAGACTTGGAAGGGTGAGGG - Intronic
1021560501 7:21964749-21964771 ATGGAGAGCTGGAAGGGGGATGG - Intergenic
1021626595 7:22599539-22599561 GTGGAGATCTGGAAAGTGGGTGG + Intronic
1021645945 7:22789592-22789614 GAGGAGAGTTGGAAAGGGGACGG + Intergenic
1021687516 7:23201742-23201764 GGGGAGGGCAGGAAAGGGGATGG - Intergenic
1021808380 7:24378945-24378967 AAGGGGAGCTGAAAAAGGGATGG - Intergenic
1021820707 7:24494928-24494950 ATGGGGAGCTGGAAGGGGTATGG + Intergenic
1021926709 7:25540807-25540829 ATGGGGAGATGGGGAGGGGATGG + Intergenic
1022490964 7:30817307-30817329 AAGGAGAGCAGGAAAGTGAAAGG + Intronic
1022589187 7:31644795-31644817 ATAGAGAGTTGAAAAGGTGAAGG + Intronic
1022591814 7:31671010-31671032 AAAGGGAGCTGGAAAGGGGATGG - Intergenic
1022654384 7:32305649-32305671 AGGGACAGCTGGAAAGAGGGTGG - Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023089136 7:36601364-36601386 AGGGAGAGGGGGGAAGGGGAGGG + Intronic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1024304968 7:47921900-47921922 AGGGAGAGGGGGAAAGGGAAGGG - Intronic
1024511904 7:50211468-50211490 CTGGAGGGCAGGAAAGGGAATGG - Intergenic
1024964970 7:55016392-55016414 ATGTACAGCTGGCAAAGGGATGG + Intergenic
1024968729 7:55049615-55049637 TCAGAGAGCTGGAGAGGGGAGGG - Intronic
1025141565 7:56471233-56471255 AAGGGGTGCTGAAAAGGGGAGGG - Intergenic
1025207146 7:57000450-57000472 ATGAAGAATGGGAAAGGGGAGGG - Intergenic
1025664790 7:63576440-63576462 ATGAAGAATGGGAAAGGGGAGGG + Intergenic
1026155017 7:67818938-67818960 ATGGAGGGGAGGGAAGGGGAAGG - Intergenic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026281015 7:68921806-68921828 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1026308833 7:69166264-69166286 ATGGGGAGGGGGGAAGGGGAGGG + Intergenic
1026481956 7:70787071-70787093 ATTGGGAGCTGGAAAAGGAAAGG - Intronic
1026522533 7:71130001-71130023 ATGGACACCTGGGAAGGAGAAGG + Intergenic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026644816 7:72158427-72158449 TTGGAGAGGTGGAGTGGGGAAGG - Intronic
1026674851 7:72419891-72419913 AGAGGGAGCTGGAAAGGGGATGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026918704 7:74139418-74139440 GAGGGGAGCTGGAGAGGGGATGG - Intergenic
1027319609 7:77003590-77003612 ATGGAGGGCTGGGAATGGGGAGG + Intergenic
1027521647 7:79216271-79216293 ATGAGGAGCTACAAAGGGGATGG - Intronic
1027569555 7:79847237-79847259 ATGCAGAGCTGGAAGAGGGATGG - Intergenic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1027708518 7:81567163-81567185 ATGGGGAGCGGGAAAGGGGATGG - Intergenic
1028192661 7:87870770-87870792 AAGGGGAGCTGAAAAGGGGTTGG - Intronic
1028531394 7:91842372-91842394 AAGGGGAGCTGGAAAGGGGATGG - Intronic
1028636013 7:92989957-92989979 ATGGAGAGGTTGAGATGGGAGGG - Intergenic
1028761112 7:94497349-94497371 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
1028872287 7:95782799-95782821 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1029016118 7:97316772-97316794 ACGGGGAGCTGGAAAGGGGATGG - Intergenic
1029017277 7:97327507-97327529 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1029105076 7:98168160-98168182 GTGGAGGGCTGGGGAGGGGAGGG + Intronic
1029350721 7:100011181-100011203 AGGGAAAGAAGGAAAGGGGAGGG - Intergenic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029582451 7:101446305-101446327 ATGGAGACATGGAAAGGGATGGG - Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1030386553 7:108874216-108874238 ATGGGGAGCTGTAAAGGGGATGG - Intergenic
1030387166 7:108878209-108878231 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1030688447 7:112509346-112509368 AAGGGAGGCTGGAAAGGGGATGG + Intergenic
1031105036 7:117530310-117530332 AAGCAGAGCTGGGAATGGGAGGG - Intronic
1031242968 7:119270003-119270025 AGGGAGGGATGGAAAGGGAAAGG - Intergenic
1031258071 7:119482076-119482098 AAGCAGAGCTGGAGAGGGGATGG - Intergenic
1031514311 7:122683144-122683166 GATGAGAGTTGGAAAGGGGATGG + Intronic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1031712651 7:125068270-125068292 GTGGGGAGCTGGAAAGGGGATGG + Intergenic
1031766245 7:125781303-125781325 AAGGGGAGCTGGAGAGGGGATGG + Intergenic
1031782398 7:125985237-125985259 ATGGGGAGCTGTAAAGGAGATGG - Intergenic
1031871976 7:127097384-127097406 ATTGAGAACTGGAAAAGAGAGGG + Intronic
1032437476 7:131911963-131911985 AGGAAGAGATGGAATGGGGAAGG + Intergenic
1032612475 7:133430144-133430166 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1032910247 7:136420242-136420264 ATAGAGAGATGGAAAGGTCAAGG - Intergenic
1032917590 7:136509858-136509880 AAAGGGAGCTGAAAAGGGGATGG + Intergenic
1033067864 7:138173189-138173211 ATGGAGAGATGCATAGGGAAAGG - Intergenic
1033519465 7:142146298-142146320 ATGCAATCCTGGAAAGGGGAGGG - Intronic
1033679933 7:143584010-143584032 AGGGAGAGGAGGAAAGGGAAGGG + Intergenic
1033691901 7:143745433-143745455 AGGGAGAGGAGGAAAGGGAAGGG - Intergenic
1033730881 7:144178459-144178481 AGGGAGAGGAGGAAAGGGAAAGG - Intergenic
1033767093 7:144505844-144505866 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1033857176 7:145577876-145577898 ATGGGGAGCTGGAAAGGAGTTGG + Intergenic
1033875829 7:145817630-145817652 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1033881302 7:145887155-145887177 ATGGTGAGCTAGAAAGGGGATGG + Intergenic
1033976046 7:147101647-147101669 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1034263785 7:149772212-149772234 GGGGAGGGCTGGAAAGGGGGAGG - Intronic
1034263810 7:149772263-149772285 AAGGAGAGCTGCAGAAGGGAGGG - Intronic
1034298573 7:149995396-149995418 AGGGAGAGGAGGACAGGGGAAGG + Intergenic
1034807441 7:154101382-154101404 AGGGAGAGGAGGACAGGGGAAGG - Intronic
1034889009 7:154822771-154822793 ATGAAGAGCAGGAAATAGGATGG - Intronic
1034998093 7:155591064-155591086 AAGGGAGGCTGGAAAGGGGATGG + Intergenic
1035288644 7:157822822-157822844 ATGGATAGATGGATAGTGGATGG - Intronic
1035370346 7:158375868-158375890 ATGGGGAGCTGGAGAGGGGATGG - Intronic
1035389630 7:158496465-158496487 AAGGGGAGCAGGGAAGGGGAGGG - Intronic
1035389707 7:158496656-158496678 AAGGGGAGCAGGGAAGGGGAGGG - Intronic
1035389755 7:158496764-158496786 AAGGGGAGCAGGGAAGGGGAGGG - Intronic
1035500348 8:87334-87356 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500366 8:87407-87429 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500381 8:87456-87478 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035824397 8:2629083-2629105 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1035887713 8:3309626-3309648 AGGGAGAGCTGGAAACTTGAGGG + Intronic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1037258541 8:16981911-16981933 AAGGGGAGCTGAAGAGGGGATGG - Intergenic
1037423489 8:18728855-18728877 AAGGGAAGCTGGGAAGGGGAAGG + Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037540924 8:19870276-19870298 CTGGAGAGCAGGAGATGGGAAGG + Intergenic
1037758400 8:21726209-21726231 AGGAAGATCTGGAAATGGGAAGG - Intronic
1037784165 8:21892797-21892819 CTGGAGTGCTGGACAAGGGACGG - Intergenic
1037907813 8:22725689-22725711 ATGGAGAGCGGGAAGGGGAGTGG - Intronic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038266211 8:26041522-26041544 ACGGAGACCCGGAAAGGGCAAGG + Intronic
1038271707 8:26081004-26081026 GTGGAAAGCAGGAAAGGGCATGG - Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039103977 8:33970609-33970631 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1039162595 8:34639384-34639406 AAGGGGAACTGAAAAGGGGATGG - Intergenic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1039306334 8:36267336-36267358 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1039409665 8:37342283-37342305 AGGGAGAGCTGGAAAGAAGTGGG + Intergenic
1039424847 8:37477354-37477376 AAGGATGGCTGGAGAGGGGAAGG - Intergenic
1039599613 8:38824081-38824103 ATGGAGAGATGGCTGGGGGAGGG - Intronic
1039645513 8:39278080-39278102 AAGGGGAGCTGAAAAGGGGATGG + Intronic
1039679082 8:39709196-39709218 AAGGGGAGCCGAAAAGGGGATGG + Intronic
1040496116 8:47966957-47966979 ATGGAGAGCTGGAGACAGAAAGG + Intronic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040835036 8:51722587-51722609 ATAGGGAGCTGGAAAGGGGATGG + Intronic
1040908297 8:52491557-52491579 AGGAGGAGCTGTAAAGGGGATGG + Intergenic
1041201979 8:55458624-55458646 ATGGGGAGCTGGAAAGGGAATGG + Intronic
1041216667 8:55607844-55607866 GTGGGGAGCTGGAAAGCGGATGG - Intergenic
1041451084 8:58007456-58007478 ATGGAGGGGTGGAAAAGTGATGG - Intronic
1041545195 8:59034675-59034697 ATGGTGAGCTGGTGAGGTGAAGG - Intronic
1041566249 8:59281895-59281917 AGGGAGAGAGGGAAAGGGGGAGG - Intergenic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042004407 8:64165571-64165593 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1042238696 8:66640780-66640802 GTGGGGAGCTGGAAAGGGGATGG - Intronic
1042328690 8:67555484-67555506 ATGGAGAGATGCATAGGGCAAGG - Intronic
1042333659 8:67608466-67608488 ATGGGGAGCTGGAAAGTGAACGG - Intronic
1042445906 8:68884881-68884903 AAGGAGAGCTGAAAAGGTGATGG + Intergenic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043220454 8:77655814-77655836 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044274660 8:90285681-90285703 ATGGGGAGCTGAAAAGGGGATGG + Intergenic
1044731584 8:95232714-95232736 ATGGGGAGCTGGAATGGCGCTGG + Intergenic
1045065734 8:98442249-98442271 TTGGAGAATTGGAGAGGGGAAGG - Intronic
1045392036 8:101725393-101725415 AAGGGAAGCTGGAAAGGGGATGG - Intronic
1045442519 8:102228313-102228335 AAGAGGAGCTGGAAAGGGGATGG - Intronic
1045487163 8:102640564-102640586 AGGGAGAGAAGGAAAGAGGAAGG + Intergenic
1045762641 8:105628714-105628736 AAGGGGAGCTGAAAAGGGGACGG - Intronic
1046396827 8:113651146-113651168 AAGGGGAGCTGGAAAGGGTATGG - Intergenic
1046438723 8:114230653-114230675 AAGGGGAGCTGAAAAGGGAACGG - Intergenic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1046812316 8:118546275-118546297 ATGAAGAGGTGGAATTGGGAGGG + Intronic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1047248659 8:123165693-123165715 AGAGAGAACTGGAAAGGAGAGGG - Intergenic
1047252207 8:123189268-123189290 ATGGATAGCTGGACAGGGGAGGG - Intronic
1047348037 8:124047599-124047621 ATGGAGATCTGGAAGGGAAATGG - Intronic
1047359989 8:124160448-124160470 ATGGGGAGATGGGATGGGGATGG - Intergenic
1047616230 8:126564651-126564673 ATGGAGAGCTGGTTTGGGGTGGG - Intergenic
1047983187 8:130204563-130204585 CAGGAGACCTGGAAATGGGAGGG - Intronic
1048074990 8:131060505-131060527 ATGGAGAGCTAGACAGAGGATGG - Intergenic
1048088644 8:131213630-131213652 ACGGAGAGTTGGATGGGGGAAGG + Intergenic
1048360619 8:133694246-133694268 AGGGAGAGCTGGAGAGTGGAGGG + Intergenic
1048439603 8:134450305-134450327 AAGGGGAGCTAAAAAGGGGATGG - Intergenic
1048488230 8:134868215-134868237 ATGGAGAGCTTGAGAGGGGAAGG + Intergenic
1048616084 8:136076887-136076909 GAGGGGAGGTGGAAAGGGGATGG + Intergenic
1048641695 8:136370245-136370267 GAGGGGAGCTGAAAAGGGGATGG + Intergenic
1048648699 8:136450945-136450967 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
1048680101 8:136831855-136831877 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1048800409 8:138189268-138189290 AAGGGGAGCTGGAAAGGGCATGG - Intronic
1048855714 8:138685196-138685218 ATGGAGAGCCGGTAAGTGGAAGG - Exonic
1048900364 8:139031737-139031759 ATGGGGAGCTGGAAAGGGGAAGG + Intergenic
1049272879 8:141705415-141705437 ATGGAGAGATGGAGAGATGATGG + Intergenic
1049283786 8:141763649-141763671 ATGGAGAGATGGGCAGTGGAAGG - Intergenic
1049360981 8:142212548-142212570 ATGGAGTGCAGGGCAGGGGATGG - Intronic
1049676127 8:143890035-143890057 GTGAAGAGGTGGAAATGGGAGGG + Intergenic
1049753522 8:144297127-144297149 AGGGCGAGCTGGAGAGGGGTCGG + Intronic
1049888061 9:41543-41565 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1049906622 9:223432-223454 ATTGAGAGCTGGAAAAAGAAAGG + Intronic
1050132652 9:2428723-2428745 ATGGAGAGGAGAGAAGGGGAAGG + Intergenic
1050237542 9:3597660-3597682 GAGGAGACCTGGAGAGGGGATGG - Intergenic
1050266865 9:3900126-3900148 GTGGGGAGGTGGAAATGGGAAGG + Intronic
1050330427 9:4540242-4540264 GAGGGGAGCTGAAAAGGGGATGG - Intronic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1051183798 9:14438546-14438568 GGGGAAAGCTGGAAAGGGGGTGG + Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051983800 9:23057633-23057655 ATGAGGAGCAGGAAAGAGGATGG - Intergenic
1052113468 9:24619092-24619114 ACGGGGAGCTGCAAAGGGGATGG + Intergenic
1052169680 9:25377657-25377679 ATGGGGAGCTGTAAAGGGAATGG + Intergenic
1052289305 9:26823931-26823953 GTGGGGAGCTGGAACAGGGATGG + Intergenic
1052363335 9:27583471-27583493 ATGAAGAGATTGAAAGGGAAAGG + Intergenic
1052459747 9:28747319-28747341 ATGAGGAGCTGGAAGGGGAATGG - Intergenic
1052465887 9:28829242-28829264 AAGGGGGCCTGGAAAGGGGATGG - Intergenic
1052793653 9:32902287-32902309 GTGGGGAGCTAGAAGGGGGATGG - Intergenic
1052816982 9:33109337-33109359 ATGGAGAGATGCATAGGGCAAGG - Intronic
1052843123 9:33310551-33310573 ATGGAGAGAATGAAAGGGAAGGG - Intronic
1052909534 9:33868081-33868103 AAGGGAGGCTGGAAAGGGGATGG + Intronic
1053054753 9:34987925-34987947 AAGGAGGGCTGGGGAGGGGAGGG - Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053162923 9:35825962-35825984 AAGGGGATCTGGGAAGGGGATGG + Exonic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053357071 9:37455321-37455343 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1054353444 9:64040613-64040635 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1054821947 9:69531534-69531556 CTGGAGTGCTGGAGAGGGGAAGG - Intronic
1055033892 9:71797439-71797461 ATGAAGAGATGGAAAGAGGAAGG - Intronic
1055121382 9:72664694-72664716 GTGGGGAGCTGGAAAGGGGATGG - Intronic
1055156129 9:73065414-73065436 AAGGAAGGCTGGAAAGGGAATGG - Intronic
1055376122 9:75649417-75649439 AAGGGGAGGTGAAAAGGGGAGGG + Intergenic
1055449277 9:76416268-76416290 ATGGGCAGCTGGAAAGGGGATGG - Intergenic
1055467186 9:76577366-76577388 ATGGAAAGATGGAAAGCTGACGG + Intergenic
1055486281 9:76759605-76759627 ATGGGGAGCTGGAAAGGGAATGG - Intronic
1055708467 9:79033671-79033693 GTGGGGAGCTAGAGAGGGGATGG + Intergenic
1055869337 9:80855336-80855358 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1055890429 9:81117911-81117933 ATGGAGATCTGGAAAGGTTGAGG - Intergenic
1055898905 9:81212036-81212058 ATGGAGATCTGGGAAGAGGTAGG + Intergenic
1056085729 9:83147814-83147836 AGGGGGAGCTGGAAAGGGGATGG + Intergenic
1056223009 9:84468348-84468370 ATGGGGAGGTGGGAAGGGGAGGG + Intergenic
1056607074 9:88094731-88094753 ATAGAGAGCTGGGAAGTGGCAGG + Intergenic
1056851355 9:90087176-90087198 AGGGAGAGATGGAAGGAGGAAGG + Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057261965 9:93589832-93589854 GTGGAGAGAGGGAAAGGGGGTGG - Intronic
1057268986 9:93636582-93636604 ATGGATAGCGGGACAAGGGACGG - Intronic
1057542797 9:95990938-95990960 AAGGGAGGCTGGAAAGGGGATGG + Intronic
1058054050 9:100431990-100432012 ATGGAGTGTGGGGAAGGGGAAGG + Intronic
1058093856 9:100836984-100837006 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058317458 9:103586525-103586547 GAGGGGAGCTGGAGAGGGGATGG - Intergenic
1058321432 9:103636360-103636382 ATGGGGAGCTGGAAAAGGGATGG - Intergenic
1058394849 9:104539373-104539395 AAGGAGGGAGGGAAAGGGGAGGG + Intergenic
1058828033 9:108792601-108792623 GAAGGGAGCTGGAAAGGGGATGG - Intergenic
1058974367 9:110112304-110112326 TTGGAGAGCTGGACAGGCCAGGG + Intronic
1059062225 9:111045355-111045377 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1059573808 9:115468545-115468567 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
1059766260 9:117386606-117386628 AGGTGGAGCTGGAAAGGGGCAGG + Intronic
1059985067 9:119813556-119813578 ATTGAGACCTGGAAAGGGGATGG - Intergenic
1060225509 9:121787685-121787707 GTGGAGAGGTGGAAGGGGGGTGG - Intergenic
1060325934 9:122615517-122615539 CTGAATAGCTGGAAAGGGGCCGG - Exonic
1060816724 9:126639029-126639051 GAGGAGAGGAGGAAAGGGGAGGG + Intronic
1061901531 9:133674798-133674820 ATGGGGAGTTGGAAATGGCAAGG + Intronic
1061942749 9:133891986-133892008 AGGGAGAGAGGAAAAGGGGATGG + Intronic
1062319412 9:135983091-135983113 TTGGAGTGCAGGAGAGGGGAGGG - Intergenic
1203515999 Un_GL000213v1:2097-2119 AAAGGGAGCTGGAAAGGGGATGG - Intergenic
1203695907 Un_GL000214v1:96717-96739 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1203741777 Un_GL000218v1:9723-9745 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203701966 Un_KI270742v1:4313-4335 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203553949 Un_KI270743v1:190368-190390 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1203608526 Un_KI270748v1:75960-75982 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1203618104 Un_KI270749v1:88311-88333 ATTGGTAGCTTGAAAGGGGATGG - Intergenic
1203640366 Un_KI270751v1:7346-7368 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1185582956 X:1225226-1225248 ATGGAGGGTTGGGACGGGGAGGG - Intergenic
1185589967 X:1269664-1269686 ACGCAGAGCTGAAAGGGGGAGGG + Intronic
1185604667 X:1361176-1361198 ATGGAGAGAGAGAGAGGGGAAGG - Intronic
1185640816 X:1588485-1588507 AGGGAGTGGAGGAAAGGGGAGGG - Intergenic
1185640998 X:1588868-1588890 AGGGAGTGGAGGAAAGGGGAGGG - Intergenic
1185641049 X:1588979-1589001 AGGGAGCGGAGGAAAGGGGAGGG - Intergenic
1185738502 X:2511776-2511798 ATGGGGAGCTGGAAAGGGAATGG + Intergenic
1185769787 X:2757073-2757095 TTGGGGAGTTGGAAAGGGGATGG + Intronic
1185796716 X:2971851-2971873 ATGGGGAGTTGGAAAGGGGACGG + Intergenic
1185797052 X:2974030-2974052 ATAGGGGGTTGGAAAGGGGATGG + Intergenic
1185804445 X:3044559-3044581 AAGAGGAGCTGGAAAGGGGATGG + Intronic
1185943489 X:4347809-4347831 TTGGAGACTGGGAAAGGGGATGG + Intergenic
1185950106 X:4423043-4423065 AAGGGGAGCTGGAAGTGGGATGG + Intergenic
1185961786 X:4552611-4552633 ATGAGGAGCTGGAAAGCGGATGG + Intergenic
1185975395 X:4714218-4714240 AAGGGGAACTGGAAAGGGGAGGG - Intergenic
1186031746 X:5376126-5376148 ATGGGGAGCTGCAAAGGGGTTGG - Intergenic
1186032067 X:5378956-5378978 ATGGGAAGCTGGAAAGGGGTTGG - Intergenic
1186036474 X:5428882-5428904 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1186056473 X:5654707-5654729 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1186127103 X:6426040-6426062 AAAGGGAGCTGAAAAGGGGATGG + Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187245996 X:17553296-17553318 GTGGAGAGCTGGCAATGAGATGG + Intronic
1187324476 X:18273938-18273960 ATGGGGAATTGAAAAGGGGATGG - Intronic
1187384300 X:18833338-18833360 AAGGGAGGCTGGAAAGGGGATGG - Intergenic
1187413273 X:19069757-19069779 ATGGGTGGCTGGAAAGGGGATGG - Intronic
1187548688 X:20279611-20279633 ATGGGGAACTTGAAATGGGAAGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188182410 X:27072595-27072617 AAGGGGAGTTGAAAAGGGGATGG - Intergenic
1188188364 X:27144558-27144580 AAAGGGAGCTGCAAAGGGGATGG - Intergenic
1188390359 X:29611817-29611839 ATGGGGAGCTCGAAAGGGTATGG + Intronic
1188437561 X:30179662-30179684 ATGGGGAGCTTGAAAGGGGATGG - Intergenic
1188526567 X:31094106-31094128 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1188554778 X:31399229-31399251 AAGGGGAGCTGAAAAGGGGATGG + Intronic
1188587276 X:31793026-31793048 AAGGGGAGCTGAAAAGGGGATGG + Intronic
1188807101 X:34605066-34605088 ATGGGGAGCTGGAAGTGGGATGG - Intergenic
1189450303 X:41122804-41122826 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1189761504 X:44326222-44326244 ATTAAAGGCTGGAAAGGGGAAGG + Intronic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1190167507 X:48085272-48085294 AAAGGGAGCTGGAAAGAGGAAGG + Intergenic
1190220439 X:48509199-48509221 AGGGAGAGTCGGAAAGGTGATGG - Intronic
1190334241 X:49252858-49252880 GTGGACATCTGGAAAGGGGTAGG + Intronic
1190417948 X:50199738-50199760 AGGGAGAGCGGGAGTGGGGAGGG - Intronic
1190569375 X:51766173-51766195 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1190805384 X:53831015-53831037 ATTAAAAGCTGGAAAGGGGAGGG - Intergenic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1191057248 X:56254640-56254662 AGGGGGAGCTGAAAAGGGGATGG + Intronic
1191117458 X:56866586-56866608 ATGGTGAGAGGCAAAGGGGAAGG - Intergenic
1191767117 X:64710013-64710035 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1191884459 X:65874389-65874411 TGGGAGAGCTGTAAAGGGGAGGG + Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192170526 X:68851798-68851820 ATGGAGAGCTGGGGAAGGGAAGG - Intergenic
1192174870 X:68879292-68879314 ATGGGGGGCTGGGAATGGGAAGG + Intergenic
1192210992 X:69127627-69127649 ATGGAAAGCTAGAGAGGGGAGGG - Intergenic
1192285095 X:69727097-69727119 ATGGGGAGCTGAAAAAGGGGTGG + Intronic
1192332286 X:70185663-70185685 GTTGGGAACTGGAAAGGGGAGGG - Intronic
1193111115 X:77731798-77731820 GAGGGGAGCTGGAGAGGGGATGG - Intronic
1193144600 X:78064059-78064081 AAGGGGAGCTGAAAGGGGGATGG + Intergenic
1193549852 X:82878664-82878686 GTGGAGAGATGGAATGGGGTGGG + Intergenic
1193709374 X:84860770-84860792 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1193963513 X:87954278-87954300 ATGGAAAACTGAAAAGGGCACGG + Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194163376 X:90483436-90483458 ATAGGTAGCTGGAAAGGGGATGG + Intergenic
1194690650 X:96980275-96980297 AAGGAAAGCTGGGAAAGGGATGG + Intronic
1194752151 X:97697178-97697200 ATGGGGAGCTAGACAAGGGATGG - Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1194802702 X:98291899-98291921 ATGCGGAGCTGGAAAGGGAGAGG + Intergenic
1194878950 X:99225961-99225983 AAGGGGAGCTGAAAAGGGGATGG - Intergenic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1194979173 X:100423028-100423050 GTGGGGAGCTAGAAAGGGAATGG + Intergenic
1195012597 X:100747886-100747908 AGGGAGAGGAGGAAATGGGAAGG - Intergenic
1195413517 X:104595241-104595263 ATGTTGAGGTGGGAAGGGGAAGG + Intronic
1195501557 X:105606902-105606924 AGGGAGAGCTGAATAGGGAAAGG + Intronic
1195605163 X:106798167-106798189 ATGTGGGGCTGGAAATGGGAGGG - Intergenic
1195647558 X:107249751-107249773 CTGGGGAGCTGAAAAGGGGATGG + Intergenic
1195722454 X:107879343-107879365 AAGGGGAGCTGAAAAGGGGACGG + Intronic
1195858765 X:109358480-109358502 AAGGGGAGCTGGAAGAGGGATGG - Intergenic
1196395906 X:115261479-115261501 ATGGGGAGTTAAAAAGGGGATGG + Intergenic
1196861564 X:120033664-120033686 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1197013390 X:121594204-121594226 ATGCAGAGCTGGAAGGGAGATGG + Intergenic
1197311846 X:124915053-124915075 ATGAAGAGATGGAAAGGGGCAGG - Intronic
1197340695 X:125263314-125263336 ATGGGGAGCTGTAAAGGGGATGG + Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1197727796 X:129787960-129787982 AGGGAGAGCTGGAAAAAGGGTGG - Exonic
1197739238 X:129876586-129876608 ATGAGGAGCTGGACAGGGGATGG - Intergenic
1198147034 X:133867950-133867972 ACGGGGAGCTGGAAAGGGGATGG - Intronic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1198454583 X:136803873-136803895 GAGGAGAGCTGGAAAGGGAATGG + Intergenic
1198489218 X:137122174-137122196 ATGGAGATTTGGAAAGGTGAGGG + Intergenic
1198697653 X:139359736-139359758 ATGAAGAGCTGGAAGGGGGACGG + Intergenic
1198883409 X:141306528-141306550 ATGGGGAGCCAGAAAGGAGATGG - Intergenic
1199219896 X:145305923-145305945 AAGGGGAGGTGGAAAAGGGATGG + Intergenic
1199380654 X:147168475-147168497 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1199671703 X:150153117-150153139 ATGGAGCGCTTGAAATGTGATGG - Intergenic
1199964417 X:152807671-152807693 ATGAGGAGCTGGAAAGCAGAAGG + Intergenic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200509645 Y:4061161-4061183 ATAGGTAGCTGGAAAGGGGATGG + Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1200985270 Y:9296841-9296863 ATGGGGAGCTAGAAAGGAGATGG + Intergenic
1201155309 Y:11127177-11127199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1201300732 Y:12502559-12502581 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201458237 Y:14194360-14194382 GAAGAGAGGTGGAAAGGGGATGG - Intergenic
1201547716 Y:15184253-15184275 ATGGGTAGCTGGAAAGGGGATGG - Intergenic
1201634301 Y:16105092-16105114 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1201751498 Y:17436650-17436672 ATGGGGAGATGGAAAGGGGATGG + Intergenic
1202048823 Y:20760225-20760247 GTGAAAAGCTGGAAAGGGGTTGG + Intronic