ID: 1178094085

View in Genome Browser
Species Human (GRCh38)
Location 21:29195549-29195571
Sequence TTAAGGGATCAATAAGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178094085_1178094089 0 Left 1178094085 21:29195549-29195571 CCTGAGTCTTATTGATCCCTTAA 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1178094089 21:29195572-29195594 CAGGTGCCAGACGCCGTGCTAGG 0: 1
1: 0
2: 7
3: 109
4: 1933

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178094085 Original CRISPR TTAAGGGATCAATAAGACTC AGG (reversed) Intronic
904019440 1:27451214-27451236 TAAAGGGGACAATAATACTCTGG + Intronic
913702999 1:121391579-121391601 TTAAGGAAACAAAAAGACTTCGG + Exonic
913939915 1:125092356-125092378 TTAAGGAAACAAAAAGACTTCGG - Intergenic
914043561 1:144072078-144072100 TTAAGGAAACAAAAAGACTTCGG + Intergenic
914134526 1:144888413-144888435 TTAAGGAAACAAAAAGACTTCGG - Exonic
916502004 1:165395370-165395392 TTAAAGGATGAGTAGGACTCAGG + Intergenic
1063269797 10:4495329-4495351 TCAATGGATAAATAAGACACAGG + Intergenic
1063839874 10:10058681-10058703 TTAAGGGAGGAATAAGGTTCTGG + Intergenic
1066125777 10:32341139-32341161 TTAAGGGAGCAATAATACCATGG - Intronic
1074875031 10:117607061-117607083 TTCAGGGATGAATAAGAATGAGG - Intergenic
1075896826 10:126003410-126003432 TTAAAGGCTTAATTAGACTCAGG + Intronic
1083836855 11:65275289-65275311 TTTAGGGAGCAATAGGTCTCTGG + Intronic
1088176548 11:107058923-107058945 TTCTGGGATCAATAAAATTCTGG + Intergenic
1088576769 11:111279748-111279770 TTAAGGTATCAATATAACTTTGG + Intronic
1089237300 11:117041373-117041395 TTCAGGGATCCACAAGACACTGG + Intronic
1089403067 11:118175983-118176005 TTAAGGGAGCATTAAGTCCCAGG + Intronic
1089836739 11:121376944-121376966 ATAAGGTTTAAATAAGACTCAGG + Intergenic
1089884275 11:121804303-121804325 TTAAGGAATCAGGAAGTCTCAGG + Intergenic
1093106955 12:15098341-15098363 TTAAGCAATTAATAAGAATCTGG + Intergenic
1102383504 12:112487017-112487039 TTAAGGGATCCTCAAGAGTCAGG - Intronic
1105346801 13:19580610-19580632 TTAAGAGATTGCTAAGACTCTGG + Intergenic
1107813606 13:44223883-44223905 TTAAGGGATTAAGAAGACACTGG + Intergenic
1108122575 13:47205622-47205644 TTAAGTGATTAATAATACTGTGG - Intergenic
1112204868 13:97314935-97314957 TTCAGGGATTTATAAGAATCAGG + Intronic
1117753389 14:58947070-58947092 TTTAGGGAACCATAGGACTCAGG - Intergenic
1120053590 14:79897083-79897105 TTAATGTATCAATAAAACACGGG + Intergenic
1123396182 15:19939088-19939110 TTAAGGAAACAAAAAGACTTCGG + Intergenic
1124663746 15:31573380-31573402 TCAAGAGATGAATAAGAGTCTGG + Intronic
1125404478 15:39338272-39338294 TGAAGGAATCAATAACATTCTGG + Intergenic
1126893463 15:53232554-53232576 TTAAGGGATAAATGAAAGTCAGG + Intergenic
1129006717 15:72379943-72379965 TTAAGGGATCAGAAAGAAGCAGG + Intergenic
1135160758 16:20094008-20094030 TTAAAATATGAATAAGACTCAGG - Intergenic
1135510087 16:23075048-23075070 TTAAGGGATAAAAGAGACGCGGG + Intronic
1136698654 16:32111241-32111263 TTAAGGAAACAAAAAGACTTCGG + Intergenic
1136768955 16:32816589-32816611 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1136799155 16:33054535-33054557 TTAAGGAAACAAAAAGACTTCGG + Intergenic
1139031158 16:62882538-62882560 CTATGGGATCAATTATACTCAGG + Intergenic
1203071370 16_KI270728v1_random:1078697-1078719 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1142926185 17:3239681-3239703 TTAAGATATTAATAAGAATCAGG - Intergenic
1144378849 17:14672898-14672920 TTCAGAGAACAAAAAGACTCTGG - Intergenic
1145692810 17:26761488-26761510 TTAAGGAAACAAAAAGACTTCGG + Intergenic
1149805714 17:59616006-59616028 TGAAGGGTTAAATAAGACCCTGG - Intergenic
1150208001 17:63423637-63423659 TGAAGGGATCATTAAGACACAGG + Exonic
1156877978 18:42039319-42039341 TTAAGGCATCAAAAAGATTTGGG - Intronic
1158014507 18:52767670-52767692 TCAAGGGAAAAATAAGACTTGGG - Intronic
1164735145 19:30535864-30535886 CCAAGGAATCAATAAGGCTCTGG + Intronic
1165674480 19:37709805-37709827 TTCAGGGATCAATAACATTCGGG - Exonic
1202682807 1_KI270712v1_random:24414-24436 TTAAGGAAACAAAAAGACTTTGG + Intergenic
929994660 2:46817706-46817728 TTGAGGGATCAAGAAGGCTAAGG - Intronic
932521227 2:72415127-72415149 CTGAGGGATCCTTAAGACTCAGG + Intronic
934189359 2:89772367-89772389 TTAAGGAAACAAAAAGACTTTGG - Intergenic
934248992 2:90330761-90330783 TTAAGGAAACAAAAAGACTTCGG - Intergenic
934260585 2:91472711-91472733 TTAAGGAAACAAAAAGACTTCGG + Intergenic
936357608 2:111765201-111765223 TTAAGGGATCTGTCACACTCAGG - Intergenic
938518717 2:132043121-132043143 TTAAGGAAACAAAAAGACTTGGG - Intergenic
940937033 2:159507566-159507588 ATAAGGGATTAATATGACTTCGG + Intronic
941643634 2:168016319-168016341 TTCAGGGACCAATAAGCCTATGG + Intronic
942023738 2:171893128-171893150 TTAAGGCATGAATAGGACTAAGG + Intronic
947114550 2:226755024-226755046 TTATGGGATCAATAAATGTCAGG - Intronic
948740518 2:240043083-240043105 TTAAGGGATCAAGCTGACTTGGG - Intergenic
1170552008 20:17486299-17486321 TTAGGGGATCCTTAAAACTCTGG + Intergenic
1171379956 20:24727293-24727315 TTCTGGGAGCAATAAGACTTTGG + Intergenic
1172596161 20:36152681-36152703 TGAAAGGACCAATAAAACTCAGG - Intronic
1173084524 20:39903042-39903064 TTAAGGCTTCAATATTACTCAGG - Intergenic
1175579559 20:60088102-60088124 TTAAGGGAGGAATAAAGCTCGGG + Intergenic
1176743002 21:10623042-10623064 TTAAGGAAACAAAAAGACTTCGG + Intergenic
1177803774 21:25854198-25854220 TTAAGGGAACACTAATACTAAGG + Intergenic
1178094085 21:29195549-29195571 TTAAGGGATCAATAAGACTCAGG - Intronic
1182752587 22:32653703-32653725 TAACGGGATCAGGAAGACTCGGG + Intronic
951956668 3:28263218-28263240 TTAAAGGAAAAATAAGACTCTGG - Intronic
953754182 3:45632467-45632489 TTCAGAGATGAATAAGACCCTGG + Intronic
954276279 3:49543753-49543775 TTTAGGGGTCCATAATACTCTGG - Intergenic
955656904 3:61253791-61253813 TTCAGGGATTATTAAGACCCTGG + Intergenic
956451643 3:69380712-69380734 TTAAGTGACCAATAAGAGGCTGG - Intronic
956939491 3:74140495-74140517 TTCAGGGATCCAAAAGTCTCAGG - Intergenic
962825893 3:139100858-139100880 TTAAGGGTCCAAGAAGAGTCTGG - Intronic
963263686 3:143217943-143217965 ATAAGGTATTAATTAGACTCTGG - Intergenic
963680792 3:148373287-148373309 AAAAGGGATCAATAAGTCACTGG + Intergenic
967915026 3:194572315-194572337 TTAGGGGACAAATGAGACTCGGG + Intergenic
968193294 3:196686516-196686538 TAAAGGGAGCAATAGGACCCTGG - Intronic
974702492 4:65470019-65470041 TTAATGGTTCAACTAGACTCTGG - Intronic
974725296 4:65791256-65791278 TTAAGGGAGGCATATGACTCTGG + Intergenic
975468702 4:74738428-74738450 TTAAGGGTTTAAAAAAACTCAGG + Intergenic
976468059 4:85394284-85394306 TTAGGGCATCAATAAAACTGTGG - Intergenic
980517758 4:133887088-133887110 TTATGGAATTAATAAGACACAGG + Intergenic
981808400 4:148744578-148744600 TTTAGGAATCAATAAAACACTGG - Intergenic
983747939 4:171224780-171224802 TAAAGGGATGAATAAGATTCTGG + Intergenic
992297605 5:75340917-75340939 TAAATTGATGAATAAGACTCAGG + Intronic
996144947 5:119962909-119962931 TGTAGGGACCAATAAGACCCAGG - Intergenic
999101968 5:149032976-149032998 TTAAGAGATCTATAAAACTTTGG - Intronic
1002966855 6:1975247-1975269 TTAAGGGATAAATAAGCATATGG + Intronic
1003237579 6:4310214-4310236 TTAAGGGATCAATGAGATACAGG + Intergenic
1005804225 6:29459162-29459184 TTTATGGATGAATAAAACTCTGG + Intronic
1007307943 6:40921701-40921723 TTTAGAGAGTAATAAGACTCAGG - Intergenic
1013449855 6:110269491-110269513 CTATGGGATCAAAAAGTCTCGGG - Intronic
1017739903 6:157397735-157397757 TACAGGGAACAATAAGAATCCGG - Intronic
1018654569 6:166022145-166022167 TAAATGGATAAATAAGACTGTGG + Intergenic
1018794262 6:167173833-167173855 TCAAGGCATCCATATGACTCTGG - Exonic
1018822057 6:167381234-167381256 TCAAGGCATCCATATGACTCTGG + Exonic
1020691087 7:11355395-11355417 TTAGGGGAACAACAAGAGTCCGG - Intergenic
1020756501 7:12210583-12210605 TTGAGGGATCAATGAGATGCCGG - Intergenic
1024320607 7:48063753-48063775 TTAAGAGAACAATAAGACAAAGG + Intergenic
1024617078 7:51125045-51125067 TTAAGTGATCTATCAGCCTCAGG + Intronic
1025307333 7:57873732-57873754 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1025838379 7:65118715-65118737 TTAAGGAAACAAAAAGACTTCGG + Intergenic
1025878898 7:65514375-65514397 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1025884693 7:65577262-65577284 TTAAGGAAACAAAAAGACTTTGG - Intergenic
1031551992 7:123125873-123125895 ATATGGGAACAATAAGACTATGG - Intronic
1032824139 7:135552693-135552715 ATAATGGATCAATTAGACTGGGG + Intergenic
1033474807 7:141681724-141681746 TTAAGGGGTCAAGAAGTCACAGG - Intronic
1038399945 8:27276680-27276702 TTCAGGGATCACTAAAACACTGG - Intergenic
1038666919 8:29545659-29545681 GTAAGTGATTAATAAGACTTAGG - Intergenic
1038675537 8:29619469-29619491 TTGAGGGATCAAAGAGACTATGG - Intergenic
1046273979 8:111932710-111932732 TAAATGTATCAATAGGACTCAGG + Intergenic
1053220026 9:36304820-36304842 TTAAGGAATCAGAAAGACTGAGG - Intergenic
1053697986 9:40656074-40656096 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1053943994 9:43286283-43286305 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1054309277 9:63455482-63455504 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1054408073 9:64779604-64779626 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1054441219 9:65263430-65263452 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1054489057 9:65758059-65758081 TTAAGGAAACAAAAAGACTTCGG + Intergenic
1056254335 9:84783404-84783426 TTCAGGGATGAATCTGACTCAGG - Intronic
1060510908 9:124231425-124231447 GGAAGGGAGCAAGAAGACTCAGG + Intergenic
1202780350 9_KI270717v1_random:29264-29286 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1203587129 Un_KI270747v1:14861-14883 TTAAGGAAACAAAAAGACTTCGG - Intergenic
1187225109 X:17368338-17368360 TAATGGGTTCAATAAGAGTCTGG - Intergenic
1188781049 X:34285633-34285655 GTAAGGGTTCAATAAGTCTTTGG + Intergenic
1193916788 X:87374895-87374917 TTATGTTATCAGTAAGACTCTGG + Intergenic
1199372321 X:147064723-147064745 TTTAGGGATCATGAAGCCTCTGG - Intergenic
1200699930 Y:6393418-6393440 TTCAGGGAGCAAAAAGACTTTGG - Intergenic
1201034181 Y:9771280-9771302 TTCAGGGAGCAAAAAGACTTTGG + Intergenic
1201322150 Y:12711223-12711245 TTAAGGGATCCCCAAGCCTCAGG - Intronic