ID: 1178094089

View in Genome Browser
Species Human (GRCh38)
Location 21:29195572-29195594
Sequence CAGGTGCCAGACGCCGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2050
Summary {0: 1, 1: 0, 2: 7, 3: 109, 4: 1933}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178094085_1178094089 0 Left 1178094085 21:29195549-29195571 CCTGAGTCTTATTGATCCCTTAA 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1178094089 21:29195572-29195594 CAGGTGCCAGACGCCGTGCTAGG 0: 1
1: 0
2: 7
3: 109
4: 1933

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178094089 Original CRISPR CAGGTGCCAGACGCCGTGCT AGG Intronic
Too many off-targets to display for this crispr