ID: 1178095644

View in Genome Browser
Species Human (GRCh38)
Location 21:29212306-29212328
Sequence GGTTAAATGGAGACTATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178095644_1178095650 9 Left 1178095644 21:29212306-29212328 CCTTCCATAGTCTCCATTTAACC 0: 1
1: 0
2: 4
3: 13
4: 144
Right 1178095650 21:29212338-29212360 CTCAGCACCTGGCCTCAGACAGG 0: 1
1: 0
2: 5
3: 26
4: 373
1178095644_1178095655 24 Left 1178095644 21:29212306-29212328 CCTTCCATAGTCTCCATTTAACC 0: 1
1: 0
2: 4
3: 13
4: 144
Right 1178095655 21:29212353-29212375 CAGACAGGGTATGAAGGTGTAGG 0: 1
1: 0
2: 1
3: 25
4: 339
1178095644_1178095648 -2 Left 1178095644 21:29212306-29212328 CCTTCCATAGTCTCCATTTAACC 0: 1
1: 0
2: 4
3: 13
4: 144
Right 1178095648 21:29212327-29212349 CCCATAGAGCACTCAGCACCTGG 0: 1
1: 0
2: 0
3: 22
4: 138
1178095644_1178095653 18 Left 1178095644 21:29212306-29212328 CCTTCCATAGTCTCCATTTAACC 0: 1
1: 0
2: 4
3: 13
4: 144
Right 1178095653 21:29212347-29212369 TGGCCTCAGACAGGGTATGAAGG 0: 1
1: 0
2: 1
3: 16
4: 175
1178095644_1178095651 10 Left 1178095644 21:29212306-29212328 CCTTCCATAGTCTCCATTTAACC 0: 1
1: 0
2: 4
3: 13
4: 144
Right 1178095651 21:29212339-29212361 TCAGCACCTGGCCTCAGACAGGG 0: 1
1: 0
2: 5
3: 33
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178095644 Original CRISPR GGTTAAATGGAGACTATGGA AGG (reversed) Intronic
903076862 1:20776837-20776859 TGTTAATTGGAGACTTTGGCTGG - Intronic
903968463 1:27103818-27103840 TGTTAAATAGAGACAATGGAAGG - Intronic
904257959 1:29268619-29268641 GGTTAAATGCAGACAATTGCAGG + Intronic
906968909 1:50489803-50489825 GGTAAAGTGAAGACTGTGGAAGG + Intronic
907787224 1:57624388-57624410 GGTGAAATGGAAACGATGAAAGG + Intronic
909988322 1:82190224-82190246 GATTAAATGGAGAATTTTGAGGG - Intergenic
911678862 1:100691453-100691475 GGTGAAATGGAGACTCTGTGAGG + Intergenic
914297545 1:146343440-146343462 GGATAAATGGAGAGGAAGGAAGG + Intergenic
914639084 1:149585151-149585173 GGATAAATGGAGAGGAAGGAAGG - Intergenic
915643334 1:157247363-157247385 GGTAAAATGGAAGCCATGGAAGG - Intergenic
916078836 1:161219368-161219390 GGATAAATGCTGACTATGGCTGG + Intronic
916312520 1:163412658-163412680 TGATAAAGGGAGACTATGGGAGG + Intergenic
916849487 1:168688945-168688967 GGTTAGATTGAGTTTATGGAGGG + Intergenic
920663339 1:207938780-207938802 GAAAAAATGGAGACTATGCAGGG - Intergenic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
922170127 1:223147124-223147146 GTTTATATGGAGACAATGGGGGG + Intergenic
923851235 1:237797453-237797475 GTTGAAATTGAGACCATGGAAGG + Intronic
924420673 1:243906322-243906344 TGTCAAATGGACACTATGGCAGG + Intergenic
1065646693 10:27842126-27842148 GGTCAAATGAAGACTAATGAAGG - Intronic
1066748315 10:38625604-38625626 GTTTAAATGGGGATTAAGGATGG + Intergenic
1066968367 10:42292171-42292193 GTTTAAATGGGGATTAAGGATGG - Intergenic
1068401584 10:56534495-56534517 AGTTAAATTCAGACTATGTACGG + Intergenic
1071785970 10:88900106-88900128 GGATTACTGGAGACAATGGAGGG + Intronic
1072671244 10:97431203-97431225 GGTAAAAAGGAGTCTAGGGAAGG + Intronic
1075506388 10:123026362-123026384 GGTTAAATGGTGATGATAGAGGG - Intronic
1076682974 10:132184612-132184634 GGTTAGAGGGTGACTATGAAGGG - Exonic
1078271939 11:9804003-9804025 GGTGAAATGGAGGCTATCGTGGG + Intronic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1081786171 11:45749438-45749460 GAGGAAATGGAGACTATGCAGGG - Intergenic
1084192798 11:67506415-67506437 GGGGAAGAGGAGACTATGGATGG - Intergenic
1084873847 11:72116278-72116300 GGATAAGTGGAGACTATGAGTGG - Intronic
1085652850 11:78284157-78284179 GGTTAGATGTAGAGTATGAAAGG - Intronic
1087092927 11:94293616-94293638 GGTTAAATGGAGTTTAAGAAAGG + Intergenic
1088312398 11:108473921-108473943 GGTGGCATGGAGACTGTGGAGGG - Exonic
1088346592 11:108833914-108833936 GGTTAACTGTAGAATATGAATGG - Intronic
1089554066 11:119305325-119305347 GGCTGAATGGAGGCTAAGGAAGG - Exonic
1093757429 12:22868096-22868118 GGTTAAAGAGAGAATACGGAGGG - Intergenic
1097350356 12:58542298-58542320 GGTTAAAAGAAGATTAGGGAAGG + Intergenic
1100038238 12:90279783-90279805 GGCTACATGGAGGCTATGCATGG - Intergenic
1100071387 12:90723891-90723913 GGCAAAATGGAATCTATGGATGG - Intergenic
1101228920 12:102719904-102719926 TGTTAAATGAAGATTATTGATGG + Intergenic
1103164247 12:118756673-118756695 AGTTAATTGGAGAAGATGGATGG - Intergenic
1103981198 12:124738088-124738110 GGCTAAATGGAGGCAATGAAGGG + Intergenic
1105476888 13:20735758-20735780 GAGTAAATAGAGACTATGGAGGG + Intronic
1107058676 13:36131947-36131969 GGTTAAGTGGAGATGATGGGTGG - Intergenic
1111076117 13:83237904-83237926 GGTATAATGGAGAATAGGGAAGG + Intergenic
1113081861 13:106528745-106528767 GCTGAAATGGAAAGTATGGAAGG + Intronic
1114786330 14:25603964-25603986 GGTTAGATAGAAACTCTGGAAGG + Intergenic
1116014712 14:39392495-39392517 TGGTACATGGAGAATATGGATGG + Intergenic
1116214390 14:41992543-41992565 AGTTAAATTGAGAGTATTGAGGG + Intergenic
1116276288 14:42837415-42837437 CATTAAGTGGAGACTATGAAAGG - Intergenic
1117703129 14:58435473-58435495 GGTTAAAAGGAGGATATTGAAGG - Intronic
1118139612 14:63065943-63065965 GGTTAACTGGAGACTACTGCAGG - Intronic
1118321417 14:64755366-64755388 GGCTCAATGGAGACGTTGGAAGG + Intronic
1121242491 14:92440555-92440577 GGTTGATGGGAGCCTATGGAAGG + Intronic
1122048764 14:99041278-99041300 GGTCAGATGGAGGCTTTGGAAGG - Intergenic
1126063377 15:44805518-44805540 GGGTTATTGGAGGCTATGGAAGG - Intergenic
1128885581 15:71283885-71283907 TGGTAAATGGAGACTCTGGTGGG + Intronic
1132315191 15:100884927-100884949 GGTTAAATAGAGGCTGTGAATGG - Intronic
1133161963 16:3917852-3917874 GGGTAAAGGGAAACCATGGAAGG - Intergenic
1134293964 16:12928370-12928392 TGTAAAATGCAGACAATGGATGG - Intronic
1136734448 16:32451697-32451719 GTTTAAATGGGGATTAAGGATGG - Intergenic
1137926937 16:52548531-52548553 CGTTAAATGGAGACTAGGGAGGG - Intergenic
1138953895 16:61947968-61947990 GATTTAATGGAGACTGTGAATGG - Intronic
1140833039 16:78769155-78769177 GGTTAAATGGAAATTATGTAAGG + Intronic
1203018632 16_KI270728v1_random:377905-377927 GTTTAAATGGGGATTAAGGATGG + Intergenic
1203036967 16_KI270728v1_random:651063-651085 GTTTAAATGGGGATTAAGGATGG + Intergenic
1148681414 17:49476101-49476123 GGTTAAGAGTAGACTGTGGAGGG - Intronic
1149278229 17:55069774-55069796 AATTAAATGAAGACTCTGGATGG - Intronic
1156984034 18:43327866-43327888 TATTAAATGGAGATTATGTATGG - Intergenic
1157429191 18:47609485-47609507 GATTAAAATGAGACTATGAAAGG - Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
925675135 2:6354300-6354322 TATTAAATGGAAACTATCGAAGG - Intergenic
925682804 2:6440691-6440713 GGTTAGCTGCAGACTATGCATGG - Intergenic
932152682 2:69387291-69387313 GGTTCAATGGAGCCTACGGGCGG - Intergenic
933308535 2:80632119-80632141 GTACAAATGGAGATTATGGATGG - Intronic
934311284 2:91867752-91867774 GTTTAAATGGGGATTAAGGATGG + Intergenic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
934787133 2:97019509-97019531 TTTTAAAAGGAGACTGTGGATGG - Intergenic
935154853 2:100475100-100475122 GGAAAAATGGAGAAGATGGAAGG - Intronic
937939936 2:127277291-127277313 GGTTATGTGAAGACTTTGGAGGG + Intronic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
941830351 2:169951626-169951648 GGTTACAGGGAAACTGTGGAAGG + Intronic
944858972 2:203796626-203796648 GGTTAAATGGGGACTATTCAGGG + Intergenic
946608466 2:221432450-221432472 GGTTGGAAGAAGACTATGGAGGG - Intronic
948482648 2:238259877-238259899 GGTTAAATGCTGACTCTGGCTGG - Intronic
1169394923 20:5220599-5220621 GGAAAAGTGGAGACTGTGGAAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1172185680 20:33029711-33029733 GGTTGAAGGGAGACTAGGGAGGG + Intergenic
1176727835 21:10456874-10456896 GGTTAAATGAAAACAATGAATGG + Intergenic
1177960018 21:27652279-27652301 TGTTAAATGGAGACTAGGAAGGG + Intergenic
1178095644 21:29212306-29212328 GGTTAAATGGAGACTATGGAAGG - Intronic
1180286560 22:10750174-10750196 GGTTAAATGAACACAATGAATGG - Intergenic
1180538044 22:16413663-16413685 GTTTAAATGGGGATTAAGGATGG + Intergenic
1180661818 22:17474356-17474378 GGTGAAATGGGGAATATGGTAGG + Intronic
1185076659 22:48686865-48686887 GGATAGATGGAGATGATGGATGG + Intronic
949395116 3:3606679-3606701 GGTGAAATGGGGAGTGTGGAAGG - Intergenic
949779722 3:7672480-7672502 GCTTTAATGGAGTCTATGGATGG - Intronic
955202808 3:56866364-56866386 GGTAAAAGGGAGACTAAAGATGG + Intronic
958489834 3:94758335-94758357 GGCCAAATGGAGATGATGGAGGG - Intergenic
958884387 3:99709348-99709370 GGTTAGACAGGGACTATGGAAGG - Intronic
959970999 3:112409813-112409835 GGTCAAAAGGAGAGTAAGGAGGG + Intergenic
960461068 3:117936589-117936611 GGCTAAGAGCAGACTATGGAAGG + Intergenic
963503407 3:146156890-146156912 GGTGAAATGGAGATTTGGGATGG - Intronic
969239411 4:5888935-5888957 GGATAAACGGAGGCTATGGAAGG - Intronic
970244611 4:14046855-14046877 GTTACAATGGAGACTGTGGAAGG + Intergenic
974227384 4:59064517-59064539 AGTGGAATAGAGACTATGGAGGG + Intergenic
975384600 4:73741438-73741460 GATTATTTGGAGACTATGGAAGG - Intronic
977944441 4:102895692-102895714 GTTTAAATGGGGACTAAGGATGG + Intronic
978345487 4:107763720-107763742 GGTTAACTAGAGACTGTGCATGG + Intergenic
983511957 4:168618544-168618566 GGTTAAATAGAGACTAAGATGGG - Intronic
984099609 4:175469370-175469392 TGTTCAATGGATACTGTGGAAGG - Intergenic
986387322 5:7247514-7247536 GGTAAAATGGAAGGTATGGAGGG + Intergenic
987883130 5:23775634-23775656 GGTTAGGTGGACAATATGGAAGG - Intergenic
989456533 5:41650412-41650434 GGTTATATGGATACCATGAAAGG - Intergenic
989527125 5:42466451-42466473 GGTTAAGTGGTGACTAGGTAAGG - Intronic
989951551 5:50304505-50304527 GATGAAATGGAGACTAACGAAGG + Intergenic
993328664 5:86570097-86570119 GATTTAATGGAGACTATGTATGG - Intergenic
995789630 5:115871482-115871504 TGTGAAATTGAGATTATGGAGGG - Intronic
998209139 5:140180822-140180844 GGTTTAAGGGAGAATATTGATGG + Intronic
999048336 5:148493801-148493823 GGGTTAATGGAGACAAAGGAAGG + Intronic
1001307190 5:170584007-170584029 GGGTAAATGGAGGCACTGGATGG + Intronic
1001742285 5:174063692-174063714 GGATAAATGGAGGGGATGGAGGG - Intronic
1001864052 5:175087519-175087541 GGTTTAATGGTGAGTAAGGAAGG - Intergenic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1005862461 6:29912036-29912058 TGTGAAATTGAGAGTATGGAAGG - Intergenic
1011743923 6:90390763-90390785 GTTTAAATGGAGAAAATGGGTGG - Intergenic
1013744408 6:113327859-113327881 AGGTAAATGGAGACTTTGGATGG + Intergenic
1017507870 6:155085020-155085042 CTGTAAATGGAGACTCTGGAGGG + Intronic
1024947956 7:54830707-54830729 GGATAAAATGAGACTATGAATGG + Intergenic
1026538680 7:71261608-71261630 CGTGAAATGGAGACCCTGGAAGG + Intronic
1028667724 7:93366109-93366131 GGGTAACTGGAGACTAGGCAAGG - Intergenic
1032740063 7:134729893-134729915 GGTCAAATCTAGACTCTGGATGG + Intergenic
1034602262 7:152271127-152271149 GGTTAAATGAAAACAATGAATGG - Intronic
1036273452 8:7329568-7329590 GCTTACATTGTGACTATGGAAGG - Intergenic
1036289597 8:7475745-7475767 GGTTAAAAGGAGACAATTCATGG + Intergenic
1036347897 8:7980784-7980806 GCTTACATTGTGACTATGGAAGG + Intergenic
1037107600 8:15128515-15128537 GACTAAATGGAGAGTCTGGAGGG - Intronic
1037212376 8:16406494-16406516 GGTTATGTGGACACTCTGGATGG + Intronic
1039623338 8:39022532-39022554 GGTTAAATGTGGACTATGAATGG + Intronic
1044974057 8:97645816-97645838 GAGCAAATTGAGACTATGGAGGG + Intronic
1048028440 8:130608370-130608392 GGTCTGATGGAGAATATGGACGG + Intergenic
1048343741 8:133560684-133560706 GGCTAAGTGGGGACTCTGGAAGG - Intronic
1049318638 8:141983638-141983660 GGGTCAATGTGGACTATGGATGG - Intergenic
1049318649 8:141983698-141983720 GGGTCAATGTGGACTATGGATGG - Intergenic
1056473109 9:86925059-86925081 GGGGAAGTGGAGACAATGGAAGG + Intergenic
1059799022 9:117730874-117730896 GGTCAAGTAGAGTCTATGGAGGG - Intergenic
1061883590 9:133579805-133579827 GGAGACATGGAGACTCTGGATGG + Intronic
1062416746 9:136455029-136455051 GGTGAGATGGAGAGTCTGGAGGG + Intronic
1185944803 X:4363070-4363092 GGTGAAATGGAAATGATGGATGG + Intergenic
1186675160 X:11808687-11808709 GGATAATTTGAGAATATGGAAGG - Intergenic
1186818634 X:13263537-13263559 GGTTGATTGGACAGTATGGATGG + Intergenic
1188948118 X:36333716-36333738 CTTGAAATGGAGATTATGGAGGG - Intronic
1190559474 X:51672827-51672849 GGTAAAATGGAGAAGACGGAGGG + Intergenic
1190564817 X:51720494-51720516 GGTAAAATGGAGAAGACGGAGGG - Intergenic
1192370879 X:70512011-70512033 GGTTGGAAGCAGACTATGGAGGG - Intergenic
1194814993 X:98430356-98430378 GGTTAAAATTAGACTATGGTAGG - Intergenic
1196693893 X:118590614-118590636 GAGGAAATGGAGACTCTGGAGGG - Intronic
1199547462 X:149020795-149020817 AGTAAAATGAAGACTATGAAGGG - Intergenic
1201245953 Y:12003925-12003947 AATTAAATGGTGACAATGGATGG - Intergenic