ID: 1178096708

View in Genome Browser
Species Human (GRCh38)
Location 21:29223070-29223092
Sequence GCATTGGAGGGCCCCTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 2, 2: 4, 3: 14, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178096700_1178096708 12 Left 1178096700 21:29223035-29223057 CCAAATATGATTACATCAAGAAG 0: 1
1: 12
2: 18
3: 39
4: 323
Right 1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG 0: 1
1: 2
2: 4
3: 14
4: 57
1178096698_1178096708 29 Left 1178096698 21:29223018-29223040 CCATCTGGAGAAACCTGCCAAAT No data
Right 1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG 0: 1
1: 2
2: 4
3: 14
4: 57
1178096699_1178096708 16 Left 1178096699 21:29223031-29223053 CCTGCCAAATATGATTACATCAA 0: 1
1: 13
2: 11
3: 28
4: 233
Right 1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG 0: 1
1: 2
2: 4
3: 14
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178096708 Original CRISPR GCATTGGAGGGCCCCTTCAA GGG Intronic