ID: 1178099570

View in Genome Browser
Species Human (GRCh38)
Location 21:29253114-29253136
Sequence CCACATGGAGAATCTCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3580
Summary {0: 1, 1: 4, 2: 125, 3: 1357, 4: 2093}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178099570_1178099578 7 Left 1178099570 21:29253114-29253136 CCTGGCAGAGATTCTCCATGTGG 0: 1
1: 4
2: 125
3: 1357
4: 2093
Right 1178099578 21:29253144-29253166 CTGTGTAGCAAACTTTTGCCTGG 0: 1
1: 7
2: 44
3: 477
4: 1522
1178099570_1178099580 16 Left 1178099570 21:29253114-29253136 CCTGGCAGAGATTCTCCATGTGG 0: 1
1: 4
2: 125
3: 1357
4: 2093
Right 1178099580 21:29253153-29253175 AAACTTTTGCCTGGGCATCCAGG 0: 220
1: 617
2: 1125
3: 1463
4: 1683
1178099570_1178099579 8 Left 1178099570 21:29253114-29253136 CCTGGCAGAGATTCTCCATGTGG 0: 1
1: 4
2: 125
3: 1357
4: 2093
Right 1178099579 21:29253145-29253167 TGTGTAGCAAACTTTTGCCTGGG 0: 1
1: 4
2: 33
3: 345
4: 764

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178099570 Original CRISPR CCACATGGAGAATCTCTGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr