ID: 1178100033

View in Genome Browser
Species Human (GRCh38)
Location 21:29258154-29258176
Sequence AACGTCCTTATGAAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178100030_1178100033 25 Left 1178100030 21:29258106-29258128 CCACTTTTCTTGGGGTAAATTTA 0: 1
1: 0
2: 0
3: 36
4: 404
Right 1178100033 21:29258154-29258176 AACGTCCTTATGAAGTATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 80
1178100031_1178100033 -7 Left 1178100031 21:29258138-29258160 CCTCTTTAATCCTCACAACGTCC 0: 1
1: 1
2: 12
3: 74
4: 388
Right 1178100033 21:29258154-29258176 AACGTCCTTATGAAGTATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178100033 Original CRISPR AACGTCCTTATGAAGTATGA AGG Intronic
900311247 1:2034251-2034273 ATTGTCCTTTTGAAGAATGAGGG + Intergenic
911937894 1:104004241-104004263 AAAGTTTTTAAGAAGTATGATGG + Intergenic
911979067 1:104543271-104543293 AACATCGTGATGAAGTATCATGG - Intergenic
913088853 1:115462529-115462551 AACGTGGTGATTAAGTATGAGGG - Intergenic
921305403 1:213791728-213791750 AACATCCCTATGAGGTTTGATGG + Intergenic
921842738 1:219845809-219845831 AACAACCTTATGAAATAAGATGG + Intronic
924196052 1:241608073-241608095 AACTTTCTTATTAAGTATAATGG + Intronic
1063357158 10:5412363-5412385 AAAGTCCTAATGAACAATGAAGG + Intergenic
1063852504 10:10209003-10209025 ACCTTCCCTGTGAAGTATGAGGG + Intergenic
1065855124 10:29823840-29823862 AAAGTCTTTATAAAGTATAACGG - Intergenic
1074820205 10:117172854-117172876 AATGGCCTTATCAAGGATGAGGG - Intergenic
1085775941 11:79366503-79366525 GATGTCCTGAGGAAGTATGATGG + Intronic
1088838264 11:113597941-113597963 AATTTCCTTATAAAGTATCAAGG - Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1090486334 11:127115820-127115842 AAAGTCCATATGAGGTATCAAGG - Intergenic
1101923925 12:108955705-108955727 AGCGTCATTGTGATGTATGATGG - Intronic
1108494744 13:51014010-51014032 GATGACCTTTTGAAGTATGAGGG - Intergenic
1109035933 13:57260261-57260283 AATGTCCATGTGAACTATGAAGG - Intergenic
1112138880 13:96615699-96615721 AAGGTTCTGATGAAGCATGAAGG + Intronic
1114847142 14:26336578-26336600 AACATTCTTAAGAAGTATGGAGG + Intergenic
1125213763 15:37245520-37245542 AATGTCATTATGAAGTTTGCAGG + Intergenic
1127940811 15:63693858-63693880 CTCTTCCTTATGAGGTATGATGG - Intronic
1129008240 15:72392860-72392882 ATAGTCCTCATGAAGTATTAAGG - Intergenic
1139784351 16:69379745-69379767 AACATCCTTATGAAAAATTACGG + Intronic
1140697697 16:77551236-77551258 AAAGACCTTTTAAAGTATGAGGG - Intergenic
1140837693 16:78810458-78810480 AACATCCCTAGGAAGTATTATGG + Intronic
1141207238 16:81942174-81942196 GACGTCCTCTTGAAGGATGAGGG + Intronic
1141534227 16:84668100-84668122 AACCACCTTATCAGGTATGATGG - Intergenic
1149756724 17:59192426-59192448 AACGACCCTATGAAGTAAAACGG - Intronic
1154022210 18:10674132-10674154 AAAGTCCTTATCAAGGAAGAAGG + Intronic
1155703757 18:28782024-28782046 AACATGCTTATGAGGGATGAAGG + Intergenic
1157606124 18:48926937-48926959 AGGGTCCTTGTGAATTATGATGG - Intronic
1157664215 18:49472161-49472183 AAAGTCCTTCTAAAGTAGGAAGG - Intergenic
1157754995 18:50209924-50209946 AAAGTCCTTACGAAGTGAGATGG - Intergenic
1159942066 18:74415875-74415897 CAGATCCTTATGAAGTTTGAGGG + Intergenic
1163058359 19:14739770-14739792 AAGGTCTTTATAAAGTATGAAGG + Intronic
1166119908 19:40680029-40680051 AACTTCCTTCAGAAGTAGGAAGG + Intronic
927391132 2:22596703-22596725 AAAGTCCTTAGGATGTAGGAGGG + Intergenic
930460747 2:51671679-51671701 AAGGTGCAGATGAAGTATGAAGG - Intergenic
931881086 2:66571637-66571659 AAGGTCCCTATGAAGAATTAGGG - Exonic
932449650 2:71801497-71801519 AACGTCATTATGTATTAGGAAGG + Intergenic
940806893 2:158197631-158197653 AAGGACCTCATGAAGTATTAGGG - Intronic
940834396 2:158505101-158505123 AACATCCTCATGAAGTAAGCAGG - Intronic
1168848836 20:962770-962792 AAAGTCATGATGAAGGATGAGGG - Intronic
1172145604 20:32755709-32755731 AACACCCTTGTGAAGTAGGAAGG - Intergenic
1172356353 20:34282964-34282986 AACACCCTTAAGAAGTAGGATGG + Intronic
1172464726 20:35147615-35147637 AACAACCTTATTAAGTATGAAGG + Intergenic
1175785870 20:61711551-61711573 AGCGTCCTTATGAGGGAGGAAGG - Intronic
1176888904 21:14290376-14290398 AAGGACCTTATGAAATATGATGG + Intergenic
1178100033 21:29258154-29258176 AACGTCCTTATGAAGTATGAAGG + Intronic
1178573668 21:33764879-33764901 AAGTTCATTATGAAGAATGATGG + Intronic
1184372668 22:44092545-44092567 ATTGTCCTTATGAAGGATGGAGG + Intronic
955726408 3:61937597-61937619 AGAGAACTTATGAAGTATGATGG - Intronic
955841293 3:63115852-63115874 AACTTCCTCAGGAAGTATCAGGG + Intergenic
965963802 3:174461071-174461093 AAGGTCCTTATGCAGCTTGAGGG + Intronic
967155693 3:186690012-186690034 AAAGCCCTTGTGAAGTATAAAGG + Intergenic
970318132 4:14848704-14848726 AAAGTTCTTTGGAAGTATGAAGG + Intergenic
983314415 4:166111469-166111491 AACATACTTATGAAGAAAGAAGG - Intergenic
984894180 4:184521798-184521820 AATGTCCTTTTGAAGATTGAGGG - Intergenic
985098630 4:186435577-186435599 TGCGGCCTTAGGAAGTATGATGG - Intronic
985098795 4:186436543-186436565 CACGGCGTTAGGAAGTATGATGG - Intronic
988360770 5:30233631-30233653 ACCTTCCTTCTGAAATATGAGGG - Intergenic
990076359 5:51850533-51850555 AATGTCCTTGAGAAGTAAGAGGG + Intergenic
995941126 5:117585896-117585918 ATAGTCCTTATGTTGTATGAAGG + Intergenic
997150504 5:131488793-131488815 AGAGTCCTTATGAAGTAGGGAGG - Intronic
1002791012 6:437526-437548 AACGTCCTAGAGAAGGATGATGG - Intergenic
1003817560 6:9859300-9859322 AGCTTGCTTATGAAGTATGGTGG + Intronic
1003984639 6:11423646-11423668 AACCTCCTTGTGAAGAAAGAGGG + Intergenic
1014086725 6:117354550-117354572 GACTTCCTTATGAAGTAGCAGGG + Intronic
1015298076 6:131621709-131621731 AATGTCCTTTTGAAATATAAGGG + Intronic
1020559973 7:9718552-9718574 AAGTTCCTAATGAATTATGAAGG - Intergenic
1021301252 7:18975770-18975792 ACAATTCTTATGAAGTATGATGG + Intronic
1021883703 7:25117807-25117829 AACGTCATGCTGAAGTATGTGGG + Intergenic
1037268933 8:17103663-17103685 ATAGTCCTTATAAAGTATAATGG - Intronic
1047716058 8:127596345-127596367 AAGATCCTTGTGAAGGATGACGG - Intergenic
1052035084 9:23671316-23671338 AACAGGCTTTTGAAGTATGATGG + Intergenic
1052314797 9:27105242-27105264 AATGTCCTTAAGAAGTCAGATGG + Intergenic
1058619512 9:106868123-106868145 CACATACTTATGGAGTATGATGG + Intronic
1059737450 9:117116397-117116419 AACATACTTTTGAAGCATGATGG + Intronic
1060708014 9:125824579-125824601 AACTTCCTTATAAACTAGGAAGG - Intronic
1187642309 X:21307496-21307518 AACTTCCTCATGAAATGTGATGG + Intergenic
1191938156 X:66448023-66448045 AACTACCTTATGAAGTCTAAGGG - Intergenic
1198991682 X:142521600-142521622 TACGTTCTCATGAAGTCTGATGG - Intergenic
1201889104 Y:18922058-18922080 AACCTCCTTAGAATGTATGAGGG - Intergenic