ID: 1178100038

View in Genome Browser
Species Human (GRCh38)
Location 21:29258210-29258232
Sequence GACTAAAGAACTTTAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178100035_1178100038 28 Left 1178100035 21:29258159-29258181 CCTTATGAAGTATGAAGGAGGAA 0: 1
1: 0
2: 1
3: 19
4: 203
Right 1178100038 21:29258210-29258232 GACTAAAGAACTTTAGAATGTGG 0: 1
1: 0
2: 0
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178100038 Original CRISPR GACTAAAGAACTTTAGAATG TGG Intronic
901715800 1:11152895-11152917 GACCAAAGGATTTAAGAATGTGG - Intronic
906861287 1:49362778-49362800 CAGTAATGATCTTTAGAATGTGG + Intronic
907349627 1:53816612-53816634 AACTAAAGAGCTTTTGCATGGGG + Intronic
907425442 1:54376286-54376308 GACTAAAGAACTTGAGGAAAGGG - Intronic
907568960 1:55465534-55465556 GACTAGAGAACTGGAGACTGGGG + Intergenic
907790347 1:57657667-57657689 AACTTCAGAACTTTAGAATATGG + Intronic
911060009 1:93739618-93739640 TTCTTAATAACTTTAGAATGAGG + Intronic
911799493 1:102117729-102117751 AACTAAAGTACTTTAGTATAGGG - Intergenic
916696624 1:167244140-167244162 GACTCAGGAACTTTGGAATTGGG + Intronic
918141420 1:181723376-181723398 GTCTAAAGACCTTTTGAATGTGG + Intronic
919488927 1:198180329-198180351 GAATAAATTACTTTAGAATAAGG - Intronic
920970458 1:210739120-210739142 GATTGTAGAACTTTAGACTGAGG - Intronic
921156799 1:212445415-212445437 GAATGAAGAACTTAAGAAAGGGG + Intronic
921832872 1:219747786-219747808 AGATGAAGAACTTTAGAATGGGG - Intronic
923815916 1:237378477-237378499 GACTAAATAAATATAAAATGGGG + Intronic
1064766900 10:18684493-18684515 GTCTCAAGTACTTTTGAATGAGG - Intergenic
1068207507 10:53874830-53874852 TAATAAAGAGCTTTAAAATGCGG + Intronic
1070738939 10:78889186-78889208 AACTAAAGAATATTATAATGAGG - Intergenic
1074564951 10:114569196-114569218 GACTAAAGGACTTCACAATGAGG + Intronic
1074735910 10:116432456-116432478 GACTCAAGAACTGAAGAAAGTGG + Intronic
1076040140 10:127240295-127240317 TTATAAAGAACTTTAGAGTGAGG - Intronic
1076055067 10:127366205-127366227 CATTAAAGATCTTTAAAATGAGG + Intronic
1076915793 10:133422743-133422765 GACCAAAGGACTTAAGAATTTGG - Exonic
1076935926 10:133567581-133567603 GACCAAAGGACTTAAGAATTTGG - Intronic
1079917000 11:26381163-26381185 GACTAAACTGATTTAGAATGGGG + Intronic
1081280756 11:41207149-41207171 GCCTAAAGGACTTAAGACTGTGG + Intronic
1083129491 11:60611181-60611203 AAATAAAGAACTATAGAATTTGG - Intergenic
1083854232 11:65384511-65384533 GATTAAAGCACTTTAAAAAGTGG + Intergenic
1087284405 11:96249158-96249180 GAAGAAAGAACTTAAGAAGGAGG - Intronic
1088014204 11:105038824-105038846 GACTCATGAACTTTAGACAGAGG + Intergenic
1088568266 11:111196196-111196218 GAAAAAAGAGCTTTTGAATGAGG - Intergenic
1088917275 11:114237227-114237249 CACGAAAAAACTTTATAATGTGG - Intronic
1090938480 11:131366399-131366421 GACTAAAGAACCTCTGACTGGGG - Intergenic
1092461324 12:8689182-8689204 AACCATAGATCTTTAGAATGTGG - Intronic
1092532200 12:9353867-9353889 GCTGAAAGAACTTTAAAATGGGG + Intergenic
1093098337 12:14997536-14997558 GAGTATAGAGGTTTAGAATGAGG - Intergenic
1094325386 12:29232332-29232354 GACTAAAGAAGTTTGTAATTTGG - Intronic
1094446464 12:30536038-30536060 TACTAAAGCCCTTAAGAATGGGG + Intergenic
1095157375 12:38874149-38874171 GACTAAATAACTTTAAATTATGG + Intronic
1098646972 12:72914650-72914672 GGCTAAATAACTTTAAAATATGG - Intergenic
1099340213 12:81422295-81422317 GAATGAAGAACTTAAGAGTGAGG + Intronic
1100122049 12:91380171-91380193 AAATAAAGTACTTTAGAAAGAGG - Intergenic
1100680520 12:96915050-96915072 GACTAAGAAGCTTTAGAATCTGG - Intronic
1103633991 12:122287223-122287245 GCCTAACGTCCTTTAGAATGTGG + Intronic
1104824279 12:131697378-131697400 AAGTAAAGAACTTTAGGCTGAGG - Intergenic
1104824281 12:131697414-131697436 AAGTAAAGAACTTTAGGCTGAGG - Intergenic
1104824283 12:131697450-131697472 AAGTAAAGAACTTTAGGCTGAGG - Intergenic
1106322313 13:28652863-28652885 GAGTAAAGAATTTAAGAGTGGGG + Intergenic
1108679246 13:52765220-52765242 AAAAAAAAAACTTTAGAATGGGG + Intergenic
1109368481 13:61390271-61390293 AATTCAAGAACTTAAGAATGAGG - Intergenic
1110928650 13:81187463-81187485 GATTAAAGAATTTAAAAATGAGG - Intergenic
1117575109 14:57089960-57089982 GATTAAATAACATTAGAAAGTGG - Intergenic
1117933912 14:60879843-60879865 TCCTAAAGAACTTTACATTGAGG + Intronic
1118431714 14:65725833-65725855 AAATAAATAAATTTAGAATGAGG + Intronic
1120311623 14:82835363-82835385 GACTAAAGAATCTGAGAAAGTGG + Intergenic
1121822144 14:96979578-96979600 GACTTAAGCACTTTACAATTAGG - Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1125121919 15:36170266-36170288 GAAAATAGAATTTTAGAATGGGG - Intergenic
1126939905 15:53755932-53755954 GAATAATGAATTTCAGAATGGGG - Intronic
1130847942 15:87765015-87765037 GACTAAAGGAATTCAGAGTGAGG - Intergenic
1131494170 15:92890538-92890560 GACTAAAGGAATTTAGATTTGGG + Intronic
1137256035 16:46776309-46776331 GGCCCAAGAACTTTAGAATGTGG - Intronic
1137943502 16:52712297-52712319 CACTAAAGTGATTTAGAATGTGG + Intergenic
1138584576 16:57961535-57961557 CACTAAAGCAATTTAGGATGAGG - Intronic
1138906916 16:61347712-61347734 TCCTAAAGAACTCTACAATGTGG + Intergenic
1144458591 17:15439181-15439203 GACCAAAGAAATATAGAATTAGG - Intronic
1145086196 17:19943277-19943299 CTCTAAAGAGCTTTAGGATGAGG + Intronic
1146133631 17:30298737-30298759 GCCCAAAGAACTTTAGATTCAGG + Intergenic
1149097223 17:52857468-52857490 TACTAATGAATTTTAGTATGGGG + Intergenic
1149422390 17:56523211-56523233 GATTTAAGAACTTTCAAATGCGG + Intergenic
1153815641 18:8787726-8787748 GAATAAAAAACATCAGAATGAGG - Intronic
1156865171 18:41880867-41880889 GACCAGAGAAATTTAAAATGTGG - Intergenic
1158308249 18:56129967-56129989 TACTATATTACTTTAGAATGTGG - Intergenic
1159247468 18:65827967-65827989 GCCTAAAGATTTTTAGCATGAGG - Intronic
1159833358 18:73305539-73305561 GAGAAGAGAAATTTAGAATGGGG - Intergenic
1166705572 19:44906198-44906220 GATTGGAGAACTTTAAAATGAGG + Intronic
1167114671 19:47482051-47482073 GACTCTAGAACATTAGAATCTGG + Intronic
926855773 2:17254381-17254403 GACTATAGAACATTAGATTTAGG + Intergenic
926923446 2:17962287-17962309 GATAAAAGAAATTTAAAATGTGG + Intronic
929328888 2:40654487-40654509 GAGTAGAGAACTTTGGCATGTGG - Intergenic
932198526 2:69805153-69805175 GAATAAACATCTTTAGAATTTGG + Intronic
937927755 2:127180743-127180765 AACTAAATTATTTTAGAATGAGG + Intergenic
940686255 2:156855002-156855024 CTCTAAAGAACTTTGGAAGGGGG + Intergenic
942540901 2:177014568-177014590 AACTACAGAAGTTTAGAAGGTGG - Intergenic
943216778 2:185046860-185046882 GCTTAAAGAACTTAAGAAGGGGG - Intergenic
944445729 2:199786287-199786309 GACTTCAGAACTTTAAAAAGGGG + Intronic
944944596 2:204668952-204668974 GACCAAAGAGCTAAAGAATGTGG + Intronic
946630525 2:221662766-221662788 GACAAAATAATTTTAAAATGTGG - Intergenic
1178100038 21:29258210-29258232 GACTAAAGAACTTTAGAATGTGG + Intronic
1178164063 21:29951614-29951636 GAGTAAAGAATGTTAAAATGTGG + Intergenic
1179298481 21:40084665-40084687 CACTAAAGAAATTCAGAATCAGG + Intronic
1179337336 21:40469865-40469887 GACTAAAAAATTTAACAATGAGG + Intronic
1180515912 22:16144461-16144483 CACTAAATATCTTTAGAATTTGG + Intergenic
949134875 3:552473-552495 AACCAATGAACTTTAAAATGTGG - Intergenic
950053459 3:10008743-10008765 GACTTCAGAACCTGAGAATGGGG - Intronic
951072499 3:18348681-18348703 TACAAAAGAACTATAGACTGTGG - Exonic
955180229 3:56661138-56661160 AACAAAAGATCTTTAGAATAAGG - Intronic
959193708 3:103149429-103149451 GACTATTTAACTTTAGAATGTGG - Intergenic
959872007 3:111339541-111339563 GAGTAAAAAACTTGAGTATGAGG + Intronic
959996687 3:112688086-112688108 AACTAAATAACTCTAGAATATGG - Intergenic
961223057 3:125215012-125215034 GAGTTAAAAACTTTAGAATGGGG + Intergenic
962031873 3:131609406-131609428 GACTAAAGTAGTTAGGAATGAGG + Intronic
967314411 3:188137733-188137755 AAATTAAGAACTTAAGAATGGGG - Intergenic
971550122 4:27943674-27943696 GACCAAAGAACTTTAAATTCTGG - Intergenic
971823707 4:31593512-31593534 GACTAACTAAGTTTAAAATGTGG - Intergenic
973957703 4:56079191-56079213 CCCAAAACAACTTTAGAATGAGG + Intergenic
977191604 4:94007984-94008006 GAACAAAGAACTTTATAAAGCGG - Intergenic
979375505 4:119941901-119941923 CACTCAAGAACTTTAGAAGGTGG + Intergenic
981390615 4:144186329-144186351 GGCTAATGAACTTGAGAATATGG + Intergenic
982986152 4:162209546-162209568 GACTAATACACTTTACAATGAGG + Intergenic
983968878 4:173846779-173846801 GACTGAGGAAATTTACAATGTGG - Intergenic
983994507 4:174165146-174165168 GGTTAAAGAACATTAGAAAGTGG + Intergenic
986453214 5:7887498-7887520 GAGTAAAGTACTTTAGAGAGAGG + Intronic
988395215 5:30688514-30688536 AACTAAAGACCTTTATAATTTGG + Intergenic
991244992 5:64501197-64501219 GACCAAAGAACTTTAGCATTGGG - Intergenic
991708547 5:69383910-69383932 GATTAGTGAACTTGAGAATGAGG - Intronic
993167644 5:84377841-84377863 CACTAAAGCACTTTTGAATGTGG - Intronic
993343266 5:86751468-86751490 GAATGAAGCACTTTAGAAAGAGG + Intergenic
993397613 5:87410307-87410329 TACAAAAGAACTGTAAAATGAGG - Intronic
994553932 5:101272649-101272671 GTTTAAAGAACTATAGACTGAGG + Intergenic
995441214 5:112194355-112194377 GATTAAACAACTTGACAATGAGG - Intronic
1004222388 6:13758036-13758058 AATTAAAGATCTTGAGAATGAGG + Intergenic
1004802556 6:19166458-19166480 GATAGCAGAACTTTAGAATGAGG - Intergenic
1006621937 6:35371417-35371439 GAGAAAAGAACTTTAGTATTTGG - Intronic
1008622696 6:53287303-53287325 TACTAAATAACTTGAAAATGTGG + Intronic
1008792297 6:55251192-55251214 AACCAAATAACTTTAAAATGTGG - Intronic
1011150509 6:84267625-84267647 AACTGAAGAACTTGAGAATGAGG - Intergenic
1012368856 6:98478314-98478336 AACTAAATAACTTTAGATTTTGG - Intergenic
1012574115 6:100769921-100769943 TAGTAAAGAAATTAAGAATGAGG + Intronic
1014669959 6:124290229-124290251 GACTAAAGATTTATAGGATGTGG + Intronic
1017040675 6:150306218-150306240 GATTAAAGAACATAAGAATGTGG - Intergenic
1018725399 6:166608927-166608949 GAATAAACAACTTAAGATTGGGG + Intronic
1019038815 6:169085655-169085677 TACTAAAGGACTTGAGAATTTGG - Intergenic
1019130254 6:169868055-169868077 GATTAAAGAACTTCAGGATGAGG - Intergenic
1019829494 7:3312734-3312756 AATTCATGAACTTTAGAATGAGG + Intronic
1020583039 7:10029964-10029986 GAGTAAAGAGATTTAGTATGAGG + Intergenic
1021942958 7:25697386-25697408 TACTCAAGAATTTTAAAATGTGG - Intergenic
1023489703 7:40725900-40725922 GAGTAAAGAACTTTATAGAGAGG + Intronic
1023585003 7:41720116-41720138 GACCAGGAAACTTTAGAATGGGG - Intergenic
1023788329 7:43730221-43730243 GACTAATTAACTTTAGACTGGGG + Intergenic
1024002234 7:45198020-45198042 GACTACAGATCTTTAGATAGAGG - Intergenic
1024114001 7:46174994-46175016 GACTAAAGAAATTGAAAATAAGG + Intergenic
1036989474 8:13576363-13576385 AACCAAAGAACTCTAGAATCTGG - Intergenic
1038964950 8:32561904-32561926 GACTAAATAATCTTATAATGTGG - Intronic
1039557193 8:38484966-38484988 GCTTAGAGAACTTTAAAATGGGG + Intergenic
1040124410 8:43720692-43720714 TGCTATAGATCTTTAGAATGAGG - Intergenic
1043000701 8:74756327-74756349 CTCTAGATAACTTTAGAATGGGG - Intronic
1044629701 8:94266425-94266447 GACTAAAGAGCTATGGAATGTGG + Intergenic
1045101127 8:98845323-98845345 AACTTAAGAATTTAAGAATGAGG - Intronic
1045189404 8:99868161-99868183 TAGTAAAGACCTTTATAATGAGG + Intronic
1047283417 8:123465410-123465432 GACTACAAAGCTTTAGTATGAGG - Intronic
1050196495 9:3089632-3089654 GACTTAATATCTTTAAAATGAGG - Intergenic
1050773230 9:9230193-9230215 GCCTAGATAACTTCAGAATGGGG + Intronic
1050993627 9:12184715-12184737 GACTGAGGAAATTTAGAATTAGG - Intergenic
1051155765 9:14143766-14143788 GTCTAAAGAACATTAGAAGATGG + Intronic
1051325984 9:15969149-15969171 GACTAAATAACCTTGAAATGGGG - Intronic
1052631757 9:31050209-31050231 GACTTAAGAGTCTTAGAATGAGG - Intergenic
1055007249 9:71522232-71522254 TACAAAAGAACTTTAAAATAAGG + Intergenic
1055218677 9:73900017-73900039 CACTAAAGAACTGTACAAAGTGG + Intergenic
1055416461 9:76089333-76089355 AACAAAACAACTTTGGAATGAGG - Intronic
1055516783 9:77041927-77041949 GACTACAGAACATGAGAAGGTGG - Intergenic
1056108035 9:83366841-83366863 GACTACATAACTGTGGAATGTGG - Intronic
1056697739 9:88874239-88874261 GACTTGAGAACTTTGGAATTAGG + Intergenic
1057243137 9:93430516-93430538 CACTAAAGAAATTTAGACTTGGG + Intergenic
1062320799 9:135989774-135989796 GATTAAAGAACTTTAGGAGATGG - Intergenic
1188994187 X:36862133-36862155 TATTAAAGAACTTGAGAAGGTGG + Intergenic
1189448509 X:41104408-41104430 GACAAAATAATTTTAAAATGTGG + Intronic
1196553591 X:117060336-117060358 GTCAAAAGACCTTTAGAAGGAGG + Intergenic
1198985366 X:142446008-142446030 CACTGAAGAACTAAAGAATGAGG - Intergenic
1199784400 X:151091375-151091397 GAGCAAAGCACTATAGAATGAGG + Intergenic
1201897095 Y:19003338-19003360 GACTTAAGATGTTTAAAATGAGG + Intergenic