ID: 1178108351

View in Genome Browser
Species Human (GRCh38)
Location 21:29346938-29346960
Sequence AGTGAGAGGGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6343
Summary {0: 1, 1: 2, 2: 50, 3: 715, 4: 5575}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178108344_1178108351 12 Left 1178108344 21:29346903-29346925 CCTGGCGTGTTAAAGGAACAGAA 0: 1
1: 0
2: 2
3: 39
4: 246
Right 1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG 0: 1
1: 2
2: 50
3: 715
4: 5575
1178108341_1178108351 30 Left 1178108341 21:29346885-29346907 CCACTTGGCACAAATAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG 0: 1
1: 2
2: 50
3: 715
4: 5575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178108351 Original CRISPR AGTGAGAGGGAGAAGGAGGA AGG Intronic
Too many off-targets to display for this crispr