ID: 1178108351 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:29346938-29346960 |
Sequence | AGTGAGAGGGAGAAGGAGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 6343 | |||
Summary | {0: 1, 1: 2, 2: 50, 3: 715, 4: 5575} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1178108344_1178108351 | 12 | Left | 1178108344 | 21:29346903-29346925 | CCTGGCGTGTTAAAGGAACAGAA | 0: 1 1: 0 2: 2 3: 39 4: 246 |
||
Right | 1178108351 | 21:29346938-29346960 | AGTGAGAGGGAGAAGGAGGAAGG | 0: 1 1: 2 2: 50 3: 715 4: 5575 |
||||
1178108341_1178108351 | 30 | Left | 1178108341 | 21:29346885-29346907 | CCACTTGGCACAAATAAGCCTGG | 0: 1 1: 0 2: 0 3: 9 4: 107 |
||
Right | 1178108351 | 21:29346938-29346960 | AGTGAGAGGGAGAAGGAGGAAGG | 0: 1 1: 2 2: 50 3: 715 4: 5575 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1178108351 | Original CRISPR | AGTGAGAGGGAGAAGGAGGA AGG | Intronic | ||
Too many off-targets to display for this crispr |