ID: 1178114265

View in Genome Browser
Species Human (GRCh38)
Location 21:29401168-29401190
Sequence TCTATTCCACACTTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178114265_1178114268 9 Left 1178114265 21:29401168-29401190 CCTTGCTCCAAGTGTGGAATAGA 0: 1
1: 0
2: 1
3: 14
4: 125
Right 1178114268 21:29401200-29401222 TGTCATACTTTAGACCTTGAGGG 0: 1
1: 0
2: 1
3: 4
4: 114
1178114265_1178114267 8 Left 1178114265 21:29401168-29401190 CCTTGCTCCAAGTGTGGAATAGA 0: 1
1: 0
2: 1
3: 14
4: 125
Right 1178114267 21:29401199-29401221 GTGTCATACTTTAGACCTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178114265 Original CRISPR TCTATTCCACACTTGGAGCA AGG (reversed) Intronic
904594677 1:31635826-31635848 TCCATTCTACACTGGGAGCTGGG - Intronic
904830341 1:33302357-33302379 TCTACTCCAGGCTTAGAGCATGG - Intergenic
908951211 1:69565738-69565760 TCTAATCCACACTTACAGGAAGG - Intergenic
912240563 1:107903561-107903583 TCTTTGCCACACTTTGAGAATGG - Intronic
916676206 1:167066115-167066137 TTTATTCCACAATTGGAGAGCGG + Intronic
917040589 1:170801833-170801855 GGTATTCCACACTTTGAGGATGG - Intergenic
917813830 1:178687414-178687436 TATACTCCACCCTTGGAGCAGGG - Intergenic
920639495 1:207738034-207738056 TCTAAACCACAGTTGTAGCAGGG - Intronic
922022182 1:221716425-221716447 TCTATTCCAGACTAGGATTAAGG - Intronic
1063242671 10:4187523-4187545 TCTTTTCCACACTGGGCTCAAGG - Intergenic
1067530277 10:47066092-47066114 ACTGTCCCACACTTCGAGCAGGG - Intergenic
1067746350 10:48939216-48939238 TCTTTTCTACTCTTGGAGGAAGG - Intronic
1067759961 10:49037426-49037448 TCTGGCCCACAATTGGAGCAGGG + Intronic
1074855821 10:117472772-117472794 TTTATTCCATACTTGGATCTTGG - Intergenic
1076820241 10:132935060-132935082 TCTATTCCAGCCTTGTAGGAAGG - Intronic
1078320348 11:10328899-10328921 TCCATTTCACAGTTGGAACATGG - Intronic
1080104981 11:28502355-28502377 TCAATTCTACCCTTGTAGCATGG + Intergenic
1081300807 11:41449055-41449077 TCTATTCTTCACTTCTAGCAAGG + Intronic
1081668467 11:44930163-44930185 TTTCTTCCACTCTTGGAGCTGGG - Exonic
1083111948 11:60419347-60419369 TCTATGCTACATTTGGAACATGG + Intergenic
1085815201 11:79730118-79730140 TCCAGTCCCCTCTTGGAGCAGGG + Intergenic
1088002324 11:104897110-104897132 TTTATTCTCCACTTGGAGAAAGG + Intergenic
1088849779 11:113695325-113695347 GCTCTTCCACACTTGAGGCAGGG + Intronic
1090159812 11:124481121-124481143 TCTATTCTACCCCTGGACCAGGG - Intergenic
1091290075 11:134434657-134434679 TCTCTTCCATCCTTGGTGCATGG + Intergenic
1092150889 12:6247634-6247656 TCTGTACCACACTGGGAGCTGGG + Intergenic
1092246486 12:6867127-6867149 TCTATCCCACAGTTGGAGAGGGG + Exonic
1094089401 12:26631141-26631163 TTTATTCCAGATTTGGAGAATGG - Intronic
1098725660 12:73963155-73963177 TCTTTTCCACACTTTAAACATGG + Intergenic
1099232088 12:80038742-80038764 TCTCCTCCACACATCGAGCATGG - Intergenic
1101519129 12:105465508-105465530 TCAATAACACACCTGGAGCATGG + Intergenic
1102198039 12:111038129-111038151 TCTTTTCTAAACTTTGAGCAGGG - Intronic
1103209310 12:119154858-119154880 TCCTTTCCACACTTGGTTCAAGG - Intronic
1104745464 12:131207664-131207686 GATATTCCACACCTGGAGAACGG - Intergenic
1104788876 12:131469445-131469467 GATATTCCACACCTGGAGAACGG + Intergenic
1117456580 14:55903745-55903767 TCTATTCCACACTTGGAATAAGG - Intergenic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1119698163 14:76730635-76730657 TCCATGCCACACTTGGGGCAAGG - Intergenic
1125820262 15:42623902-42623924 TCTGGTCCACACTTGGGCCAGGG + Intronic
1127391182 15:58506235-58506257 TCTATGACACCCTTGGGGCAAGG + Intronic
1127558745 15:60114822-60114844 TCTAGTCCACACGTGGGGGAGGG + Intergenic
1128817955 15:70628279-70628301 TCATTTCCACTCTTGGAACAGGG - Intergenic
1129677979 15:77642663-77642685 TCCATACCACACAGGGAGCAAGG + Intronic
1133220921 16:4318859-4318881 TGAATTCCCCACTTGGACCAGGG + Intronic
1135974519 16:27099125-27099147 TCTATGCCAGACTTTGAGCCAGG + Intergenic
1137397730 16:48128260-48128282 TCTTCTCCACACTTGGAGAGGGG + Intronic
1139894412 16:70276899-70276921 TCTTTTCCACACTGGGAACTGGG - Intronic
1142877533 17:2861039-2861061 TCCTTTCCACACTTGGAACATGG + Intronic
1143774505 17:9189167-9189189 TCTCTTCCACCCATGGAGCTAGG + Intronic
1144097251 17:11911266-11911288 TCTTTTCAACAAATGGAGCAGGG - Intronic
1150427459 17:65087837-65087859 TTTATGCTACACTTGGGGCAGGG + Intergenic
1151054917 17:71019822-71019844 TCCACCCCACACTTGGAGAAAGG - Intergenic
1151083126 17:71351473-71351495 TCTATTCTTCACTCGGGGCATGG + Intergenic
1151740322 17:75977626-75977648 TCTCTTCCACACTAGAACCAAGG + Intronic
1153637791 18:7128172-7128194 TCTCTTCCACAGTAGGAGCTGGG + Intergenic
1154429394 18:14296928-14296950 TATATCCCACATCTGGAGCACGG - Intergenic
1155853932 18:30808594-30808616 TCTCCTCCACGCTTGGAGCAGGG + Intergenic
1157003799 18:43558816-43558838 TCTAGTCCACTCTTGGATCTTGG + Intergenic
1157869256 18:51214823-51214845 TCACTTCCACCCTTGGAGTAAGG + Intronic
1165296577 19:34931460-34931482 TTTATTCTACAGTTGGAGAAAGG + Intronic
926540174 2:14167078-14167100 TCTATGCAGCAATTGGAGCAAGG + Intergenic
929259686 2:39851767-39851789 TCTATTCCACTGTGGGTGCAGGG - Intergenic
929615820 2:43306422-43306444 TCTCTTCCACACTTAGTCCATGG + Intronic
929919215 2:46160723-46160745 TCTTTTCTGCACTTGGAGAAGGG - Intronic
932345092 2:70990203-70990225 TCTACTCCAAACTCGCAGCAAGG + Intronic
933198145 2:79416191-79416213 TCTTTTTCACATTAGGAGCAGGG + Intronic
944657539 2:201891129-201891151 TCTCTTCCACTCCCGGAGCAGGG + Intronic
1169726668 20:8741243-8741265 TCTATCCAACACTTTGAACATGG - Intronic
1170812885 20:19688252-19688274 TGTGTGCCACACTTGGAGCACGG + Intronic
1172577285 20:36018984-36019006 TTTGTTCCATGCTTGGAGCATGG - Intronic
1173121818 20:40299586-40299608 TTTTTTCCACACTTGGAGAGAGG + Intergenic
1177350783 21:19938626-19938648 TCTATACCACACTTTAAGCTGGG + Intergenic
1178025050 21:28456727-28456749 GCTGTACCACACTTGGGGCAGGG - Intergenic
1178114265 21:29401168-29401190 TCTATTCCACACTTGGAGCAAGG - Intronic
1182079663 22:27520020-27520042 TCTAGTCTACACTGGGACCAGGG + Intergenic
1183651108 22:39153498-39153520 TCCATTCCTCACTGGGAGCCCGG + Intergenic
949500146 3:4672164-4672186 TCCATTCCACACTGGGAGGTGGG + Intronic
950391937 3:12703614-12703636 TGTTTTCTACCCTTGGAGCAGGG + Intergenic
950666802 3:14501443-14501465 TCTAATCCATGCTTGGAGCTTGG - Intronic
952032369 3:29159363-29159385 TCAATTCCACACTAGTTGCAAGG + Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954542151 3:51400669-51400691 TCACTTCAACACTTGGAGAATGG - Intronic
955062046 3:55501349-55501371 TGAATACCACATTTGGAGCAAGG - Intergenic
956702248 3:71968605-71968627 TCTATCCCATGCTTGCAGCAGGG - Intergenic
957715551 3:83926063-83926085 TTGATTCCAGACTTGTAGCAGGG - Intergenic
959573517 3:107910209-107910231 TCTATTGCTGAGTTGGAGCAGGG - Intergenic
961756306 3:129129049-129129071 TCTTTGCCACACTTGGGGCTGGG + Intronic
963475552 3:145798947-145798969 TCTTTGCCAGACTTGCAGCAGGG - Intergenic
971414732 4:26413915-26413937 TCTATTGAACAATTGGAGGACGG + Intronic
972550140 4:40125077-40125099 TCCAGTCCACACTGGGACCAAGG + Intronic
972900789 4:43680606-43680628 TCTTTTTCACAGTTGGAGCACGG + Intergenic
977678450 4:99773393-99773415 TCTATACCACACTGGGATCTTGG + Intergenic
980169015 4:129264342-129264364 TATATTCCAGACATAGAGCAGGG - Intergenic
988385573 5:30560286-30560308 TCTATTCAACAATTGGTGCTGGG - Intergenic
990723274 5:58723373-58723395 TATATTCTACTCTTGGAGCAGGG - Intronic
990984943 5:61632615-61632637 TCAAGGCCACACTTGGAGAATGG + Intergenic
991554278 5:67877725-67877747 TCTATGACATAATTGGAGCATGG - Intergenic
1000749864 5:165081217-165081239 ATTATTCCACAGGTGGAGCAAGG + Intergenic
1002995506 6:2279541-2279563 TCTATTCCACAAATGGTGCTGGG - Intergenic
1003030747 6:2598444-2598466 TTAATTCTACACTTAGAGCAAGG + Intergenic
1005836323 6:29712112-29712134 CCAATTACACACTTGGAGAATGG - Intergenic
1006364551 6:33607781-33607803 TCCATTCCCCATCTGGAGCATGG + Intergenic
1006577493 6:35057074-35057096 GCAATCCCACACTTGGTGCAGGG - Intronic
1010734517 6:79428765-79428787 TTTATTCCACTCTTGGAGCCTGG + Intergenic
1012306893 6:97669531-97669553 TCTATTCCACATGTGAGGCAAGG + Intergenic
1013425686 6:110010570-110010592 TCTATTCCACTCTTTGAAAATGG - Intergenic
1014602131 6:123426432-123426454 ACTATTCCACACATGCAGCAGGG - Intronic
1015308993 6:131744145-131744167 TTTATCCCACACTTGGTGTAAGG + Intronic
1015439070 6:133226453-133226475 TCTATTCTCCACTTGGATCACGG - Intergenic
1015891693 6:137976361-137976383 TCTATTCCATTCTTGTAGCGGGG + Intergenic
1016191037 6:141264599-141264621 TCGATTCCACACTAGGAAGATGG + Intergenic
1016365928 6:143318390-143318412 TCTATTCCACAAATGGTGCTGGG + Intronic
1017983971 6:159426346-159426368 TCTATTTGGCACCTGGAGCAGGG + Intergenic
1020478048 7:8622142-8622164 TTTATTCTACACTTAAAGCAAGG + Intronic
1023075875 7:36482599-36482621 TCTAGTCCACTCTTGGATCTTGG + Intergenic
1025164373 7:56698415-56698437 TCTCTTCCATACTTGGTGCTGGG + Intergenic
1025755815 7:64339515-64339537 TCTCTTCCACACTTGGGGCTGGG - Intronic
1042975758 8:74467363-74467385 TCTGTTCCACACTTGAACCAGGG - Intronic
1046325804 8:112643644-112643666 TCTATTGCACACTGGGATAATGG + Intronic
1046674747 8:117094978-117095000 TCTGCTCCAATCTTGGAGCAAGG - Intronic
1047199351 8:122751727-122751749 TCCATACTTCACTTGGAGCAAGG + Intergenic
1047814691 8:128450211-128450233 TTTTTTCCTCAATTGGAGCAAGG + Intergenic
1047893561 8:129340218-129340240 TCTATTTGACACTGGGAGTAAGG + Intergenic
1049833981 8:144721231-144721253 TCTGTACCACACTTGGAGGCAGG + Exonic
1051229606 9:14942082-14942104 TCTCTTCCCCACTTGCAGCTTGG - Intergenic
1054813724 9:69455218-69455240 TCTGTTTCTCACATGGAGCACGG - Intronic
1057367536 9:94437074-94437096 TCCATCCCACACTTGGAGCCTGG - Intronic
1057655792 9:96950979-96951001 TCCATCCCACACTTGGAGCCTGG + Intronic
1060064665 9:120494364-120494386 TTGATTCCAGACCTGGAGCAGGG + Intronic
1061812618 9:133171211-133171233 TCCATTTCCCACTTAGAGCATGG + Intergenic
1185694229 X:2183236-2183258 TCTATTGCACAGATGTAGCATGG + Intergenic
1187473496 X:19589629-19589651 TTTATGCCACACACGGAGCAAGG - Intronic
1187744490 X:22393752-22393774 TCTATTCAACACATGGTGCTGGG + Intergenic
1188137581 X:26508578-26508600 TCAACACCACAATTGGAGCAGGG + Intergenic
1192716529 X:73648035-73648057 TCTCTTCCACACCTGGAGGCTGG - Intronic
1193040861 X:77002086-77002108 TCTATTCCTTACTTAGGGCAGGG + Intergenic
1195097138 X:101513985-101514007 TCTATTCCACAATGGAAGTAAGG - Intronic
1195917726 X:109952319-109952341 TCTTTTCCAGGCCTGGAGCAGGG + Intergenic
1196562955 X:117172980-117173002 TCTCTTGCACACTGGGAGTATGG + Intergenic
1197500761 X:127239358-127239380 TCTATTCCACACCTGCTTCAAGG - Intergenic
1198266273 X:135011879-135011901 CCTTTTCCACAATTTGAGCAGGG - Intergenic