ID: 1178115790

View in Genome Browser
Species Human (GRCh38)
Location 21:29415073-29415095
Sequence TGGAATACTTCCCATGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178115786_1178115790 10 Left 1178115786 21:29415040-29415062 CCTGGTGTTTGGGTGAATAGAAC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1178115790 21:29415073-29415095 TGGAATACTTCCCATGTGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178115790 Original CRISPR TGGAATACTTCCCATGTGGT GGG Intronic
901460884 1:9390962-9390984 GGGGACAATTCCCATGTGGTAGG + Intergenic
901767903 1:11515534-11515556 GGGCAGACTTCCCATGTGGGAGG - Intronic
903117382 1:21189392-21189414 TTGAATACTTCCTATGTGCCAGG - Intergenic
904055205 1:27665459-27665481 CGGAATGCTTCCTATGTGCTTGG + Intergenic
904919336 1:33994588-33994610 TGGAATATCTACCATGTGCTGGG - Intronic
905397975 1:37679650-37679672 TAAAATACTACCCAAGTGGTAGG - Intergenic
906910482 1:49943761-49943783 TGGGAGACTTCTCATTTGGTTGG - Intronic
907071842 1:51542602-51542624 TGGAATAATTACCATGTGCCAGG + Intergenic
909106393 1:71414763-71414785 TAGCATACTTGTCATGTGGTAGG + Intronic
910115108 1:83723547-83723569 TGGAATTCCTCCCCTGGGGTAGG + Intergenic
912154574 1:106901831-106901853 TAGAAAACTTCTCATGTAGTTGG + Intergenic
914464975 1:147919524-147919546 TGGAATGCTTACCATGTGCCAGG - Intergenic
916008382 1:160682087-160682109 TAGAATACCTGCCATGTGGCAGG - Intronic
917429846 1:174954713-174954735 TGAAATACTTCCGATCTGGTGGG + Intronic
917761057 1:178158412-178158434 TGGAGTACTTGCTATGTGCTAGG - Intronic
918803031 1:188997805-188997827 TTGAATACTTGCAATGTGATCGG + Intergenic
921347749 1:214204228-214204250 TTGAATACTTCCTATGTGCAAGG - Intergenic
922386073 1:225084546-225084568 TGAAATGCTTTTCATGTGGTAGG - Intronic
922717761 1:227886118-227886140 AGGCTTACTTCCCAAGTGGTTGG - Intergenic
924574097 1:245263528-245263550 TGGAATACTTAGTATGTGCTAGG + Intronic
1064826831 10:19413069-19413091 TGGAATACCTCCTATGTGTAAGG + Intronic
1065202642 10:23329482-23329504 TGGAATACTTCACATAAGATTGG - Intronic
1065557028 10:26926500-26926522 TGCATTACTTCCCATGAGATTGG + Intergenic
1065723102 10:28644702-28644724 GGGAAGACTTCCCAGGTAGTGGG + Intergenic
1066451160 10:35531673-35531695 TGGAATACATGCCATGAGGAAGG + Intronic
1067517067 10:46958944-46958966 TGGAATATTTTGCATGTGTTAGG - Intronic
1067580996 10:47445668-47445690 TGGAAGACTTCCCAAGTCTTAGG + Intergenic
1067645183 10:48092882-48092904 TGGAATATTTTGCATGTGTTAGG + Intergenic
1068129229 10:52876659-52876681 TTGAATGCATCCCATGTGCTAGG + Intergenic
1068197361 10:53734359-53734381 AGGAAGAGCTCCCATGTGGTTGG - Intergenic
1068273940 10:54767741-54767763 TAGAATACATACCATGTGTTGGG - Intronic
1068646883 10:59477994-59478016 TGGGAAACTTGCAATGTGGTGGG + Intergenic
1069579949 10:69559152-69559174 TTGAATACTTAGCAAGTGGTAGG - Intergenic
1069681952 10:70291734-70291756 TGGGATACCTCCCCTGTGGTGGG + Intergenic
1070183220 10:74034635-74034657 ATGAGTACTTCCCATGTGGGAGG - Intronic
1071266453 10:83968870-83968892 TTTATTACTTCCCATGTGTTGGG - Intergenic
1071945621 10:90641063-90641085 TATAATATTTACCATGTGGTAGG - Intergenic
1074508576 10:114093224-114093246 CGGTATACTTTCCATGTGATGGG + Intergenic
1075137402 10:119796330-119796352 TTAAATACTTCCCATATGGCAGG + Intronic
1075268733 10:121030023-121030045 TGGTATATTTCCCAAATGGTTGG + Intergenic
1075515316 10:123103742-123103764 TGGAATACCTACCATGGGCTAGG - Intergenic
1079041359 11:17063291-17063313 TGGAATACATATCATGTGCTAGG + Intergenic
1079657366 11:23000019-23000041 TGAAGTACTTCCCTGGTGGTCGG - Intergenic
1080018130 11:27529202-27529224 TGGAGTACATACTATGTGGTAGG - Intergenic
1081064085 11:38518361-38518383 ATGAATTCTTGCCATGTGGTGGG + Intergenic
1085497935 11:76988999-76989021 TGGAGTCCTTCCTATGTGTTAGG - Intronic
1087531677 11:99389746-99389768 TGGAATTTTCCCCAAGTGGTAGG + Intronic
1088481280 11:110298083-110298105 CGTAATACTTCCCATGAAGTAGG + Intergenic
1090144720 11:124309498-124309520 TTGAATACTTGCTATGTGGGAGG - Intergenic
1090864038 11:130679878-130679900 TCCAATAATTCCCATGTGTTGGG - Intronic
1093425875 12:19028388-19028410 TGGAATACCTCCTATGTACTAGG + Intergenic
1095719434 12:45385023-45385045 TGGATTATTCCCCAGGTGGTGGG + Intronic
1096562421 12:52446224-52446246 TGCAATATTTCCCTGGTGGTGGG + Intergenic
1098405340 12:70120044-70120066 TTGAACACTTACCATGTGGCAGG - Intergenic
1099609541 12:84850283-84850305 TGGAATAGTGCCCATGAGATTGG - Intergenic
1101796832 12:107982720-107982742 TTGAATATTTCCCATATGATTGG + Intergenic
1102267785 12:111502841-111502863 TTGAATACATACCATGTGCTAGG + Intronic
1103276359 12:119714994-119715016 TGCCATAATTCCCATGTGTTGGG + Intronic
1104431077 12:128716906-128716928 TAGAAAAATGCCCATGTGGTTGG + Intergenic
1105829789 13:24153832-24153854 TGGAATTCATCCCTTGGGGTTGG + Intronic
1107573368 13:41687790-41687812 TTAAATACCTCCTATGTGGTAGG + Intronic
1110115149 13:71804885-71804907 TGAAATACTTCTCATACGGTAGG - Intronic
1110156349 13:72321516-72321538 TGGAACACTGCACATGTGGTAGG + Intergenic
1110162212 13:72392199-72392221 TGGAATACTTACCGAGTCGTTGG - Intergenic
1111052608 13:82905060-82905082 TGTAATAATTCCCATGTGTTTGG + Intergenic
1112155310 13:96810365-96810387 TGGAACACTTCCAATGTGCCTGG - Intronic
1112446048 13:99465283-99465305 TGGAGTCTTTCCCATGTGCTGGG + Intergenic
1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG + Intergenic
1115732235 14:36283727-36283749 TTGAGTACTTCCTCTGTGGTAGG + Intergenic
1116832822 14:49739126-49739148 TGGAATACTTCCTGGGTGTTTGG + Intronic
1117108887 14:52428028-52428050 TGGAATACAACCAATGTGGCTGG - Intergenic
1118273303 14:64363313-64363335 TGCAATATTTCCCATGGGGGAGG + Intergenic
1120485771 14:85112024-85112046 TCCAATAATTCCCATGTGGGTGG - Intergenic
1120738639 14:88083206-88083228 TGGGAAACTTCCCAAGGGGTGGG + Intergenic
1126200210 15:45976977-45976999 TGGAATATTTCTCATTTTGTGGG - Intergenic
1126902826 15:53331475-53331497 TGGCATATTTCCCCTGTGATAGG + Intergenic
1127315930 15:57793650-57793672 TCGCATACTTCCCCAGTGGTTGG + Intergenic
1128068571 15:64779354-64779376 CAGAAAGCTTCCCATGTGGTAGG - Intergenic
1129904187 15:79174582-79174604 TGGAATGTTTCTCATGTGCTAGG + Intergenic
1130736565 15:86556567-86556589 TGGCTTCCTTCCCATGGGGTGGG - Intronic
1132391607 15:101442909-101442931 TGGAATACCTTCCATGTGGCTGG - Intronic
1135956960 16:26963812-26963834 TTGAATACTTCCTATGTGCTTGG - Intergenic
1136026787 16:27473808-27473830 GGGAACACTCTCCATGTGGTGGG + Intronic
1137414010 16:48255636-48255658 TGTAATAATTCCCATGTGTCAGG + Intronic
1137616533 16:49851413-49851435 TGGAATTCTTCCCCTGATGTAGG - Intronic
1138248114 16:55481868-55481890 TTGAGTACTTACCATGTGCTAGG - Intronic
1138466042 16:57191245-57191267 TGCTATATTTCCCATGTGGAGGG - Intronic
1138627915 16:58267025-58267047 GGGAATACTCCTCATGAGGTGGG - Intronic
1145083314 17:19913886-19913908 AGGAGTACTTACCATGTGCTAGG + Intronic
1146267760 17:31464278-31464300 TGGCATTCTTCCCATCTCGTGGG + Intronic
1149061884 17:52432420-52432442 TTGAGTACTTGCTATGTGGTAGG + Intergenic
1149686678 17:58539619-58539641 TGAGAAACTTGCCATGTGGTTGG - Intronic
1151150303 17:72079427-72079449 TGAAATATTTCCTGTGTGGTTGG - Intergenic
1153378510 18:4409337-4409359 TGGAAAACTTCCTATGTGGAAGG + Intronic
1153786092 18:8536916-8536938 AGAAATACTTCCCCTGGGGTAGG + Intergenic
1155419397 18:25638348-25638370 TGGAATACTGCCCATCTCCTTGG - Intergenic
1158691247 18:59663070-59663092 CTGAATATTTCCCATGTGCTAGG + Intronic
1162440861 19:10691292-10691314 TGGAATCCATCCCTCGTGGTGGG - Exonic
1165649726 19:37475517-37475539 TTGAATACTTCACATGTGCCAGG + Intronic
1166841833 19:45702136-45702158 TGGAATGCTTGCTATGTGCTGGG - Intronic
1167841401 19:52124463-52124485 TGGAACACTCCCCACGTGCTGGG + Intronic
1167845528 19:52161013-52161035 TGGAACACTCCCCATGTGCTGGG + Intronic
1167874960 19:52404518-52404540 TGGAACACTTCCCATGTGATAGG - Intronic
1167878261 19:52432546-52432568 TAGAACACTTCCCATGTGATAGG - Intronic
925899565 2:8498940-8498962 TGGAATATTTCCTATGTGGCAGG - Intergenic
928610311 2:32986050-32986072 TTGAATACTTACCATGTACTAGG - Intronic
929820826 2:45272089-45272111 AGTAATACTTCCCATGTTGTTGG + Intergenic
932447521 2:71790147-71790169 TTGAATTCTTCTCAGGTGGTGGG + Intergenic
932900136 2:75688253-75688275 CAGAGTACTTGCCATGTGGTAGG - Intronic
934909889 2:98241988-98242010 AGGTATACATCCCATGAGGTGGG - Intronic
938298119 2:130191177-130191199 TAGAAAACCTCCCATGAGGTGGG - Intergenic
938458649 2:131483484-131483506 TAGAAAACCTCCCATGAGGTGGG + Intronic
939086661 2:137727556-137727578 TTGAATTCTTCCTATGTGCTAGG + Intergenic
941683222 2:168421324-168421346 TGGAATAATCGCCATTTGGTGGG + Intergenic
942423378 2:175832681-175832703 TTGAATACTTACTATGTGTTAGG - Intergenic
944227334 2:197360738-197360760 TGGAGTACTTTCTATGTGCTGGG - Intergenic
944351288 2:198730224-198730246 TGAAAAATTGCCCATGTGGTTGG - Intergenic
945676716 2:212863736-212863758 AGGCAGACTTCCCATGTGCTTGG + Intergenic
946961511 2:224990482-224990504 TTGAATTCTTACCATGTGTTTGG - Intronic
1169919872 20:10723704-10723726 TGGAGTACTTACTATGCGGTAGG + Intergenic
1170260840 20:14406151-14406173 TGGAGTACTTCCCATAAGATAGG - Intronic
1172007450 20:31827084-31827106 TGGAATACTTACCAAGTGCCAGG + Intronic
1172963622 20:38817041-38817063 TTGAATACCTACCATGTGCTGGG + Intronic
1173541734 20:43857878-43857900 TGGAATATTTGACATGTGCTAGG - Intergenic
1176925838 21:14747598-14747620 TTGAACACTTACCATGTGCTAGG - Intergenic
1178115790 21:29415073-29415095 TGGAATACTTCCCATGTGGTGGG + Intronic
1178349052 21:31858471-31858493 TGGAATTCTTCACAGGTGGCAGG - Intergenic
1178496210 21:33088579-33088601 TGGAATACTTCCCAGGGGGCGGG + Intergenic
1179776229 21:43664944-43664966 TGTAATAATCCCCACGTGGTGGG - Intronic
1184916130 22:47570209-47570231 TTGCATGCTTCCCTTGTGGTGGG + Intergenic
949442139 3:4093222-4093244 TTGAATACTTGCTATGTGCTAGG - Intronic
950858402 3:16126574-16126596 TGGCTGACTGCCCATGTGGTGGG + Intergenic
951878062 3:27450227-27450249 TCGAGTACTTACCATGTGCTAGG - Intronic
953601857 3:44374108-44374130 TAGAATAGTTCCAATGTTGTAGG - Intronic
955821404 3:62899770-62899792 TGGAATATTTCCCATGTTCATGG + Intergenic
956015137 3:64874439-64874461 TGGAGTGCTTCCTATGTGCTGGG + Intergenic
956062304 3:65359996-65360018 CAAAATACTTCCCCTGTGGTTGG + Intronic
956715185 3:72073145-72073167 TTGAATACTTGTTATGTGGTAGG + Intergenic
956905833 3:73764066-73764088 TGGATTATTTCCCATTTGGAAGG + Intergenic
960311988 3:116128117-116128139 TGGAATAGTTTCCATGTCTTAGG + Intronic
961988457 3:131161886-131161908 TGGAATACTTTTTATGTGCTAGG + Intronic
963300318 3:143590302-143590324 TGGAGTGCTTTCCATGTTGTAGG - Intronic
964769719 3:160211648-160211670 TGGAAAACTTCACATGTAGCTGG - Intergenic
966314174 3:178626378-178626400 TTGAATACTTACCATGTGTCAGG - Intronic
966492458 3:180543211-180543233 TGGAAGCCTTGCCATTTGGTAGG - Intergenic
967625643 3:191680708-191680730 TGGACTACCTCACATGTGTTTGG + Intergenic
967747367 3:193072214-193072236 TGAAATGCTTCCCATGTCCTGGG - Intergenic
968755650 4:2414580-2414602 TGGGGTAGTTCCCATGTGGCTGG - Intronic
969427552 4:7134517-7134539 TGGAAGGCTTTGCATGTGGTAGG + Intergenic
971001266 4:22325340-22325362 TGGAAAACTTACCATGTGCCAGG - Intergenic
972115281 4:35624615-35624637 TGGAATACTTACTATGTGACAGG - Intergenic
972210212 4:36827301-36827323 TGGAATAGTTTCAGTGTGGTTGG - Intergenic
973712546 4:53643853-53643875 CTGAATTCTTCCCATGTGCTAGG - Intronic
974272616 4:59671254-59671276 TGGAATTCCTTCCATGTGGAAGG + Intergenic
974860160 4:67510679-67510701 TGGAGTACTTGCCATGGGGCAGG - Intronic
975489481 4:74973090-74973112 TTAAATACCTCCCATGTGATGGG - Intronic
975706188 4:77113998-77114020 TAGAATACTTGCCATATGTTGGG + Intergenic
977098377 4:92774853-92774875 TGGAAGAGATCACATGTGGTGGG - Intronic
979717999 4:123864755-123864777 CGGAATACTTCCTATGTAGCAGG - Intergenic
981058823 4:140397261-140397283 TTGATTTCTGCCCATGTGGTAGG + Intronic
981892022 4:149749571-149749593 TGGAATACCTTCCAGGGGGTAGG + Intergenic
983057216 4:163112402-163112424 TGGAATACTGAACATGTGTTAGG + Intronic
984288998 4:177768808-177768830 AAGAATACCTACCATGTGGTAGG - Intronic
984595181 4:181658664-181658686 TGGAATGCTTACCATGTGCCAGG + Intergenic
986760839 5:10878304-10878326 TTCAATACTTCTCATGTGATGGG + Intergenic
988366367 5:30305552-30305574 TGGAATGCTACACATGGGGTAGG + Intergenic
988983305 5:36593309-36593331 TGGAACACTGCCCATGGGGTTGG - Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
992478770 5:77129502-77129524 TGGATTACTTCCCCTCTGGTGGG + Intergenic
995247062 5:109946409-109946431 TGGAACACTTCCTATGTGCCAGG + Intergenic
996677433 5:126192749-126192771 TGTAATACTTTGCATGTAGTGGG - Intergenic
996775916 5:127132404-127132426 TGTCATACTTCCCTTGTGTTGGG + Intergenic
998477091 5:142431297-142431319 TTGAATACCTCCCACGTGCTGGG + Intergenic
998530796 5:142882690-142882712 TTGAGCACTTTCCATGTGGTAGG + Intronic
1000059243 5:157638402-157638424 TGGAATACTCCCTAGGAGGTTGG + Exonic
1000552075 5:162679338-162679360 TGGAAAACTCCACAAGTGGTTGG + Intergenic
1001312184 5:170619039-170619061 TGGAACACTTACCATGTGCTAGG - Intronic
1004242901 6:13943659-13943681 TTGAATACTTCCCATGTTCTAGG - Intronic
1008707080 6:54175370-54175392 TGAAATACATCCCATGTTCTTGG - Intronic
1012822762 6:104108100-104108122 TGAAATCCTTGCCATGTGCTAGG + Intergenic
1013056140 6:106584679-106584701 TAGAATACTTCCTATGTGTGAGG - Intronic
1014346767 6:120280171-120280193 GGAAATATTTCACATGTGGTAGG + Intergenic
1014532609 6:122577013-122577035 TGGAACACTTACCATGTGTCAGG + Intronic
1015428965 6:133107369-133107391 TTGAATACTTTCCATGTGGCAGG - Intergenic
1015442285 6:133263039-133263061 TGGCATGCTTCCCGGGTGGTTGG + Intronic
1017258332 6:152359865-152359887 TGGAACAATTCCCATGTTCTGGG - Intronic
1018716545 6:166537119-166537141 TGGAATACATCCCATGGCGGAGG - Intronic
1018913475 6:168117763-168117785 CAGAAGACTTCCCATGTGCTGGG - Intergenic
1021317329 7:19164721-19164743 TGAAAAACTTCTCAGGTGGTCGG + Intergenic
1021821558 7:24503296-24503318 GCGAATACTTCCCATGTGTCAGG + Intergenic
1023513320 7:40976299-40976321 TGGGATACCTCCCATGTATTTGG - Intergenic
1026269944 7:68827813-68827835 TTGAATATTTACCATGTGGTAGG + Intergenic
1027445131 7:78265130-78265152 TGGACTAATTCACATCTGGTAGG - Intronic
1030271971 7:107678251-107678273 TTGAATACTTACCATGTGCCAGG + Intronic
1031134303 7:117869419-117869441 TGGAACACTTACCATGTGCCTGG + Intronic
1031141355 7:117947017-117947039 GGGATTACCTCCCATCTGGTAGG - Intergenic
1032864337 7:135910925-135910947 TGGAATACTAGCCACATGGTAGG - Intergenic
1034339820 7:150345306-150345328 AGGAACACTTGCCATGTGGCTGG - Intergenic
1037089629 8:14897877-14897899 TTGAATACTTCCTATGTAGAAGG + Intronic
1037686067 8:21140707-21140729 AGGAAAACTTCCCAAGGGGTGGG - Intergenic
1038080719 8:24133261-24133283 AGAAATATTTCCCATGTAGTAGG - Intergenic
1038690735 8:29760813-29760835 TGGAGTGCTTACTATGTGGTAGG - Intergenic
1041820660 8:62029043-62029065 TGGAGTACTTACCATGTGGCAGG + Intergenic
1045913173 8:107434403-107434425 TGAAATACTTCGCTTGGGGTTGG + Intronic
1046228239 8:111315638-111315660 TGAAACCCTTCCCAAGTGGTTGG - Intergenic
1046551740 8:115726903-115726925 TGGAATTCTGCCCATGTGAGAGG - Intronic
1048751830 8:137685857-137685879 TGGAATACCTCCAATGTGCCAGG - Intergenic
1049261192 8:141640179-141640201 TGGAAAACTTCTCATGAGGACGG + Intergenic
1049613130 8:143565030-143565052 TGGAATATTTGCCCTGGGGTGGG + Intergenic
1054993908 9:71362455-71362477 TTGACTATTTCCCATGTGGCTGG + Intronic
1055731279 9:79281586-79281608 TTTAATACTTGACATGTGGTAGG - Intergenic
1057281756 9:93717836-93717858 TGGAATGCTTCCCAAGTAGTGGG - Intergenic
1057429674 9:94981901-94981923 AGGAAGACTTGCCTTGTGGTTGG + Intronic
1058060066 9:100485762-100485784 TGGCATACTTCTCATGTACTTGG + Intronic
1058850893 9:109011850-109011872 TGTAATGCTTACTATGTGGTAGG - Intronic
1186835741 X:13436064-13436086 TGGTACACTTTCCCTGTGGTGGG - Intergenic
1190019355 X:46859108-46859130 TGGAGCACTTACCATGTGGCAGG - Intronic
1190285641 X:48959368-48959390 TTGAACACTTCCTATGTGCTGGG - Intergenic
1197251385 X:124219336-124219358 AGGCAAACTTCCCATGTAGTTGG + Intronic
1197761707 X:130032646-130032668 TGGCATACTTTGCATGTGGGAGG - Intronic
1199481982 X:148307776-148307798 TTGAATACTTCCTATGAGCTGGG + Intergenic
1199987211 X:152961361-152961383 TGGCATGCATCCCATGTGTTAGG - Intronic