ID: 1178116864

View in Genome Browser
Species Human (GRCh38)
Location 21:29426843-29426865
Sequence CTCTTTGTCTGGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 358}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178116864_1178116878 12 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116878 21:29426878-29426900 TCCGGGGATGGGAAATGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 225
1178116864_1178116873 0 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116873 21:29426866-29426888 GTTTTTGTCGATTCCGGGGATGG 0: 1
1: 0
2: 1
3: 44
4: 652
1178116864_1178116874 1 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116874 21:29426867-29426889 TTTTTGTCGATTCCGGGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 93
1178116864_1178116870 -6 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116870 21:29426860-29426882 AAAGAGGTTTTTGTCGATTCCGG 0: 1
1: 0
2: 0
3: 11
4: 159
1178116864_1178116871 -5 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116871 21:29426861-29426883 AAGAGGTTTTTGTCGATTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 97
1178116864_1178116881 24 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116881 21:29426890-29426912 AAATGGTGGGGTATAGGTGACGG 0: 1
1: 0
2: 2
3: 25
4: 258
1178116864_1178116872 -4 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116872 21:29426862-29426884 AGAGGTTTTTGTCGATTCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 57
1178116864_1178116882 30 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116882 21:29426896-29426918 TGGGGTATAGGTGACGGTAACGG 0: 1
1: 0
2: 0
3: 6
4: 101
1178116864_1178116880 18 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116880 21:29426884-29426906 GATGGGAAATGGTGGGGTATAGG 0: 1
1: 0
2: 4
3: 45
4: 287
1178116864_1178116877 11 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116877 21:29426877-29426899 TTCCGGGGATGGGAAATGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 151
1178116864_1178116876 10 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116876 21:29426876-29426898 ATTCCGGGGATGGGAAATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 211
1178116864_1178116875 7 Left 1178116864 21:29426843-29426865 CCTTCTCCCCTCCAGACAAAGAG 0: 1
1: 1
2: 4
3: 46
4: 358
Right 1178116875 21:29426873-29426895 TCGATTCCGGGGATGGGAAATGG 0: 1
1: 0
2: 0
3: 2
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178116864 Original CRISPR CTCTTTGTCTGGAGGGGAGA AGG (reversed) Intronic
900346447 1:2212720-2212742 CTCGTTGCCTGGAGGACAGAGGG + Intronic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
902669646 1:17964229-17964251 CTCACTGTCAGGAGTGGAGAAGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903879456 1:26499251-26499273 CTCTTTGTCTGGAAGAGAACTGG + Intergenic
905311241 1:37050524-37050546 CTCATTGCCTTGAGGGCAGAGGG - Intergenic
905520064 1:38590752-38590774 CTCTTTTTGTGGGGGCGAGAAGG - Intergenic
905769866 1:40630600-40630622 CTCCTTGTGGGGAAGGGAGAAGG + Intronic
905933460 1:41806149-41806171 GTGTTTGTCTGGAGAGCAGAGGG - Intronic
906109536 1:43313523-43313545 CTCTTTGTCAGGAGGGGCCTGGG - Intronic
906318361 1:44802215-44802237 CCCTTTGTGTGGATGGGGGAAGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907046938 1:51305233-51305255 GGCTTTACCTGGAGGGGAGAGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908460460 1:64343999-64344021 GCCTTTGGCTGGAGGGCAGATGG - Intergenic
908849893 1:68365071-68365093 CTCCTTCTCTGGATGTGAGATGG + Intergenic
909783804 1:79584530-79584552 CTCTTAGTCTGTAAGAGAGAGGG - Intergenic
911028020 1:93455589-93455611 TGCTTTTTCTGGAGGTGAGAGGG + Intronic
911155163 1:94629379-94629401 CCCTCTGTCAGGTGGGGAGAGGG + Intergenic
912429673 1:109622435-109622457 CTCCTGGTCGAGAGGGGAGATGG + Intronic
914889953 1:151612992-151613014 TACTTGGTCTGGAGGGCAGAAGG - Intronic
915374073 1:155376909-155376931 CTTTTTTTTTGGGGGGGAGATGG + Intronic
916123749 1:161551064-161551086 CTCTGTGTGTGGCGGGGGGAGGG - Intergenic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
917338674 1:173951319-173951341 CTCTTTTTTTGGGGGGGGGATGG - Intronic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918193371 1:182198134-182198156 CTCCTTGTCCTGAGGGCAGAGGG + Intergenic
918721634 1:187859604-187859626 CTCTTTGTCTTTAGAAGAGAAGG + Intergenic
919849896 1:201665555-201665577 GTCTCTCTCTGGAGGGGTGAGGG + Intronic
920216962 1:204367727-204367749 ATCCTTGTCAGGAGGAGAGATGG - Intronic
921165009 1:212500553-212500575 CTCCTCCTGTGGAGGGGAGAGGG + Intergenic
921431130 1:215067427-215067449 CTCATTGTCAAGAGGGAAGAGGG + Intronic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
923646093 1:235821829-235821851 CTCTTTGCCTGCAGGGGAGGTGG - Intronic
924044195 1:240011156-240011178 CTCACAGTCTGGAGGGGAGGAGG - Intergenic
924277599 1:242404109-242404131 CTCACTGTCTAGAGAGGAGAGGG + Intronic
924832608 1:247614153-247614175 GTGTTTGGCTGGAGTGGAGAAGG - Intergenic
1062884926 10:1009203-1009225 CTCTTTGGCCTGAGGGAAGATGG + Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064801985 10:19086778-19086800 CTCTTAGTCTGTAAGAGAGAGGG - Intronic
1064811658 10:19206873-19206895 GTCTTTGGCTGTAGGGCAGAAGG - Intronic
1065028064 10:21557755-21557777 CTCTGTGGCTGGAGTGGGGAGGG + Intronic
1065605173 10:27411271-27411293 CTCTATTTCTGGGGGGGAAATGG - Intronic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067826012 10:49573487-49573509 CTCTTTTTCTGCGTGGGAGATGG - Intergenic
1069449792 10:68507385-68507407 CTCTTTATCTGGAAGGATGAAGG + Intronic
1071595345 10:86918338-86918360 ACCTTTTTCTGGAGGGAAGAGGG + Intronic
1072666093 10:97393632-97393654 GGCTTTTTGTGGAGGGGAGAAGG - Intronic
1073124909 10:101143105-101143127 CTCTTAGTCTAGAGGGGGGCTGG + Intergenic
1074346657 10:112692864-112692886 CTCACTGTCTGGTGGGGAGATGG - Intronic
1074456219 10:113597683-113597705 TTCTTTGTATGGAGAGGAGGAGG - Intronic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1075306839 10:121375541-121375563 CTTTTGGTCTGGAGAGGAGATGG - Intergenic
1076218075 10:128711596-128711618 CTCATTCTCAGGAGGGGAGAGGG - Intergenic
1076896989 10:133317810-133317832 CTCTGTGTCTGGGGGGGGGGGGG - Intronic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1077245021 11:1532566-1532588 CACCATGTCTGGAGGGGAAAAGG + Intergenic
1077582378 11:3424667-3424689 CTCTCTGCCTGCAGGAGAGAAGG + Intergenic
1078856295 11:15208587-15208609 GTCTTTGTTAGAAGGGGAGAGGG - Intronic
1079062878 11:17264825-17264847 CTCTTTTTTTGGTGGGGGGAAGG - Intronic
1079095589 11:17508038-17508060 CTCTCTCTGTGAAGGGGAGAGGG - Intronic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080354740 11:31430057-31430079 ATCTTTCTCTGTAGAGGAGATGG - Intronic
1080891557 11:36412949-36412971 CTCTTTTTTTGGTGGGGGGAAGG + Intronic
1083810704 11:65104868-65104890 GCCTTTGTGTGGAGGGGAAAGGG + Intronic
1084288253 11:68145737-68145759 CTTCTCGTCTGGAGGAGAGATGG + Intergenic
1084616150 11:70237282-70237304 TTCCTTGACTGGAGGGAAGAAGG + Intergenic
1085289469 11:75387433-75387455 TTCTCTGTCTGGTGTGGAGAAGG - Intergenic
1085497093 11:76979644-76979666 CTTTTTTTCTGGGGGGGACAGGG - Intronic
1085721215 11:78913932-78913954 CTGTTAGCCTGGAGAGGAGAAGG + Intronic
1085726917 11:78962270-78962292 CTCATTGGCCGGAGGGGAGGGGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1088977689 11:114830351-114830373 CACTTTGTCTGGAGGGGAGGAGG + Intergenic
1089125242 11:116172176-116172198 ATGTTTGGGTGGAGGGGAGAGGG - Intergenic
1094034619 12:26054608-26054630 CTCTTTGTCCTGTGGGGAGAGGG + Intronic
1094213820 12:27920042-27920064 CTTTTAGTGTGGAGGAGAGAAGG - Intergenic
1096417111 12:51424100-51424122 TTCTTTTTCTTGAGGAGAGAGGG + Intronic
1097750045 12:63342098-63342120 CCCTTTGTCAGATGGGGAGATGG - Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098512979 12:71341014-71341036 CTCTTGGTGGGGTGGGGAGAGGG - Intronic
1099614355 12:84915425-84915447 CTCTTTGACTAGAGGAGAGAAGG + Intergenic
1100743081 12:97616632-97616654 CTGTTTGTGTGGGTGGGAGAGGG - Intergenic
1101263746 12:103063263-103063285 CTCTTTCTCTACAGGGGATAAGG - Intergenic
1101858819 12:108465938-108465960 TTTTTTGTCAGCAGGGGAGAAGG - Intergenic
1102263788 12:111463685-111463707 CTTTTTGCCAGGTGGGGAGAGGG + Intronic
1103629022 12:122244344-122244366 CTTTTTGTGTGGAGGGTAGGTGG - Intronic
1103764058 12:123269605-123269627 CTCTTTGTCTGGCGTGGGGGTGG - Intronic
1104599261 12:130141559-130141581 TTCTTTTTTTGGTGGGGAGAGGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1106230133 13:27815234-27815256 CTCTATGGCTAGAGTGGAGAGGG + Intergenic
1106372092 13:29144821-29144843 CTCTTTGTCTTGAGTGCAGGTGG - Intronic
1106743146 13:32669289-32669311 CTTTTTTTTTGGAGGGGAGGGGG + Intronic
1107348561 13:39489551-39489573 CTTTTTTTTTGGAGGGGAGCGGG + Intronic
1107662994 13:42658613-42658635 CTCATGGGCTGGAGGGGACAAGG - Intergenic
1107928579 13:45287678-45287700 TTCTTGGTTTGGAGGTGAGATGG - Intergenic
1108170800 13:47739969-47739991 CCCTTTGTCAGGTGGGTAGATGG - Intergenic
1112419847 13:99238412-99238434 CGCCTTGTCTGGAGGGAAAAAGG - Exonic
1112825223 13:103384121-103384143 CTTTTTATCTGTAGTGGAGATGG + Intergenic
1112998598 13:105604539-105604561 CTTGGTGTCTGGAGAGGAGAGGG + Intergenic
1113404724 13:110027767-110027789 CTCTTTGTGGAGAGGAGAGAGGG + Intergenic
1113457465 13:110458708-110458730 CTCTTAGCGTGGCGGGGAGAGGG - Intronic
1114141829 14:19920921-19920943 CCTTTTTACTGGAGGGGAGATGG + Exonic
1114821087 14:26019888-26019910 ATCTTAGTCTGGAGGTGAGGAGG - Intergenic
1116171680 14:41410286-41410308 CTCTTTCTATGGAGGTTAGAAGG - Intergenic
1118872155 14:69752480-69752502 ATCTCTGTCTGGAGGGGAAAGGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119490483 14:75028366-75028388 ATCTTTGACTGGATGGGAGTTGG - Intronic
1119691559 14:76676795-76676817 CTCTTTTTTTGGGGGGGAGTGGG - Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120218621 14:81707333-81707355 CTCTTTGTCAGATGGGTAGATGG + Intergenic
1121737464 14:96228452-96228474 CTCTTAGTCGGGTGGGGAGCTGG + Intronic
1123016346 14:105377368-105377390 CTCTGTGGCTGGATGGGAGGAGG + Intronic
1123141323 14:106081916-106081938 CTCTTTATCTGGGGAGGTGAGGG + Intergenic
1123166490 14:106330137-106330159 CTCTTTATCTGGGGAGGTGAGGG + Intergenic
1123169171 14:106355173-106355195 CTCTTTATCTGGGGAGGTGAGGG + Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1126153676 15:45545752-45545774 CTCATCCTCTGGAGGGGAGGTGG + Intergenic
1126518378 15:49559604-49559626 CTGCTTGTCTGGAGAGGAGTGGG - Intronic
1126657334 15:50993168-50993190 TCCTTTGACTGGAGGGTAGAGGG + Intronic
1127285466 15:57529045-57529067 CTCATTGTCTTGAGAGGAAATGG + Intronic
1128617383 15:69120921-69120943 CTTATTATCTGGAGGGAAGATGG + Intergenic
1129101134 15:73265208-73265230 TTGTTTGTCTGGAGGGGATGAGG + Intronic
1130897818 15:88184292-88184314 CTATGTGTCTGCAGGGGAGGAGG + Exonic
1131809925 15:96162473-96162495 ATATTTCTCTGGAGGGCAGAGGG - Intergenic
1132683105 16:1151957-1151979 CTCTTTGTCTGGAGGGAGAAGGG + Intergenic
1132836905 16:1958737-1958759 CTGTTTGTCTGTAGGGTTGATGG + Intergenic
1134076568 16:11296182-11296204 CGCCCTGTCTGGAGGTGAGAGGG - Intronic
1135111703 16:19695377-19695399 CTCTTTCTCTGGTGGAGAGAGGG + Intronic
1135327956 16:21539387-21539409 GTCTCTGTCTGGAAGGAAGATGG + Intergenic
1136610677 16:31363151-31363173 CTTTTTTTCTGCAGTGGAGAAGG + Exonic
1137262285 16:46841429-46841451 CTCTTTTTTTGGTGGGGAGTGGG - Intergenic
1138700220 16:58854901-58854923 CTCTTTGGCTTGGGGGTAGAAGG + Intergenic
1139349739 16:66327568-66327590 CTATTTACCTGGAGTGGAGATGG - Intergenic
1139420720 16:66848052-66848074 GTATTTGTGGGGAGGGGAGAAGG - Intronic
1140672934 16:77296820-77296842 CTTTTTTTTTGGAGGGGAGGAGG - Intronic
1141025397 16:80541570-80541592 CTCTTTTTCTGGGGGGGAGGGGG - Intronic
1141127992 16:81414951-81414973 CACATTGTTTGGAGAGGAGAAGG + Intergenic
1141223392 16:82092264-82092286 CTCTTGGGGTGGAGGGGAGGTGG - Intronic
1142499675 17:325320-325342 CTCATGTTCCGGAGGGGAGATGG - Intronic
1142557508 17:789912-789934 CCCTCTGCCTGGAGGGGAGAAGG - Intronic
1143168128 17:4909279-4909301 GTCTTTGTGTGGAGTGGAGAGGG - Intergenic
1144168790 17:12638390-12638412 CCCTTTTATTGGAGGGGAGAAGG - Intergenic
1145053620 17:19683314-19683336 CTCTTTGTTTGGTGGGGGGAGGG - Intronic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1146745110 17:35321816-35321838 TGCTCTGTCTGGTGGGGAGAGGG - Intergenic
1147320636 17:39643769-39643791 CTCTTTCTCTGGAGAAGAGCAGG + Intronic
1147895236 17:43746277-43746299 CTCATAGTCCAGAGGGGAGACGG + Intergenic
1148106923 17:45123892-45123914 CTCTTTGTCTGGAAAGAGGAGGG - Intronic
1148110918 17:45144357-45144379 GCCTCTGTGTGGAGGGGAGAGGG + Intergenic
1148404562 17:47398928-47398950 TTCTTTCTTTGGAGGGGACAAGG + Intronic
1149651411 17:58278696-58278718 CTCTTTGTTAGGTTGGGAGAGGG - Intronic
1150432433 17:65129169-65129191 CTCTTTGTAAGGAGCTGAGAGGG - Intergenic
1150602937 17:66666195-66666217 AGGTTTGTCTGTAGGGGAGAAGG - Intronic
1151360055 17:73583478-73583500 CTCTTTATTTGGTGGGGAGCTGG - Intronic
1151643782 17:75415749-75415771 CTCATAGTCTAAAGGGGAGAGGG - Intergenic
1151930289 17:77227874-77227896 CTCTGCGGCTGGTGGGGAGAAGG + Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1155165723 18:23230891-23230913 CTTTTTGCCTGGAGGGGTCACGG - Intronic
1156405919 18:36782580-36782602 CTCTTTTTTTGGTGGGGAGATGG + Intronic
1156415752 18:36887794-36887816 CTCTTTGTATGGAGAGGAGGTGG + Intronic
1157086692 18:44587424-44587446 CCCTTTGAAAGGAGGGGAGATGG - Intergenic
1157337525 18:46752551-46752573 CCCTTGGTCAGGAGGGGAGAAGG - Intronic
1157775231 18:50389327-50389349 GTCTTTTTCTGGGGGGGAGAGGG + Intronic
1158532222 18:58273921-58273943 CTCTCTGTGTGGATGGGAGAGGG - Intronic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1161207846 19:3051144-3051166 CACTTTGGCTGCAGTGGAGATGG + Intergenic
1161249095 19:3270871-3270893 CTCTGTGGCGGGTGGGGAGATGG + Intronic
1161602570 19:5193482-5193504 CTCTTTGTCTGGGGGGCTGTGGG + Intronic
1162080436 19:8214792-8214814 CCCATTGTGTGGAGGGGAGGAGG - Intronic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1163382873 19:16980259-16980281 CTCTGTGTGTGCAGGGGACAGGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163526278 19:17823556-17823578 CTTTTTGTCTGGTGAGGGGACGG - Intergenic
1164414697 19:28037278-28037300 TTCTGTGTCCTGAGGGGAGAGGG - Intergenic
1165139095 19:33688471-33688493 CCCTTTGCCTGGAGTGGAGGTGG - Intronic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166476034 19:43125415-43125437 CTCTATGTCGGGAAGGGTGAGGG + Intronic
1167449905 19:49560927-49560949 CTCTTTGTTTGGAGGTAAGAGGG + Intronic
1168468813 19:56624903-56624925 CTGGTTCTCTGGATGGGAGAGGG - Exonic
925117333 2:1390931-1390953 CTCTTTGTCAGATGGGTAGATGG + Intronic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
925921190 2:8639095-8639117 CACTTTGTCTGGAGAGGAGGAGG - Intergenic
926391747 2:12400808-12400830 CTATTTCTCTGCAGGAGAGAAGG - Intergenic
926420206 2:12688355-12688377 GTCTCTGTCTGGCAGGGAGATGG + Intergenic
927646076 2:24877775-24877797 CTCTCTGTCTGGTGGTCAGATGG - Intronic
929620762 2:43351635-43351657 CTCTTTATCTGGCAGGGAGAGGG + Intronic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
929779426 2:44948362-44948384 TTCATTGGCTGGAGGGCAGAAGG + Intergenic
930108490 2:47658335-47658357 CTCCAGGTCTGGAGGGGAGGCGG - Intergenic
930685538 2:54303353-54303375 CTTTTTTTTTGGAGGGGGGAGGG - Intronic
931489826 2:62733227-62733249 CTCTTTATCTGGATAGGAGTTGG + Intronic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932217566 2:69976701-69976723 CTCTGTGCCTGGAGGGGGAAAGG - Intergenic
932817362 2:74872646-74872668 CTGTTTCTGTGGAGGGGATAAGG - Intronic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
934766215 2:96881544-96881566 CTCTTTGTCTGGAGGAGGCCCGG + Intronic
937281937 2:120723411-120723433 CACTTTGTCTGGAGGAGTCAGGG + Intergenic
937287716 2:120763629-120763651 CCCTCTGTCTGCAGGGGAGTGGG - Intronic
940684835 2:156834584-156834606 CTCCATCTCTGGAGGGGAGGAGG - Intergenic
940912343 2:159219698-159219720 CTCTTTGTCTAGAGAAGAAAGGG - Exonic
941662758 2:168212315-168212337 CTCTTTCCCTGCAGGTGAGATGG - Intronic
942538973 2:176995659-176995681 CTCTAAGTGTGGAGGAGAGAAGG - Intergenic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
945043823 2:205764574-205764596 CTCCTCGTCTGGGGAGGAGAAGG - Intronic
945326774 2:208491511-208491533 CTCTTAGTCTGTAAGAGAGAAGG - Intronic
945453606 2:210022857-210022879 CTCTTATTCTGGAGGGGATGGGG + Exonic
945715639 2:213354764-213354786 CTCTTTGTCAGATGGGTAGATGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946737957 2:222773475-222773497 CTTTTTGGGAGGAGGGGAGAGGG - Intergenic
947166668 2:227268874-227268896 CTCTTTGGCTCAAGGGGAGCAGG + Intronic
947937075 2:234016466-234016488 TTCTTTCTCTAGAGGGGTGAGGG + Intronic
948109740 2:235445079-235445101 CATTTTGTCTGGAGGAAAGAGGG - Intergenic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
949035872 2:241815527-241815549 CTCTTTATCTGCAGAGGAGAAGG + Intronic
1169530157 20:6476513-6476535 CTCTGTGTGTGGTGGGGGGATGG + Intergenic
1170630243 20:18058811-18058833 CTTTATGCCTGGAGGGGAGAGGG + Intronic
1172069250 20:32244499-32244521 CACTTTGCCTGCTGGGGAGATGG + Intergenic
1173577006 20:44118681-44118703 CTCTTTGTGGGTTGGGGAGAAGG - Intronic
1173703921 20:45096364-45096386 CTCTCTGCATGGAGGGGACAGGG + Intronic
1174431856 20:50475913-50475935 CTCATTGTCGGGAGGCGAGTTGG + Intergenic
1175179816 20:57137867-57137889 TTCTTTGTCTGGCGGGGGGGAGG - Intergenic
1175632374 20:60552555-60552577 CTCTATGTCAGGAGGGGTCATGG + Intergenic
1175714091 20:61244036-61244058 GCCTGTGTCTGGAGGGGAAATGG + Intergenic
1176294200 21:5062073-5062095 CTTTTTATTTGGAGGGGGGATGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1179645889 21:42775920-42775942 CTCTATCTCGGGAGGAGAGACGG + Intergenic
1179863059 21:44201575-44201597 CTTTTTATTTGGAGGGGGGATGG + Intergenic
1179959169 21:44758705-44758727 ATCATTGTCTGGAGGGCACATGG + Intergenic
1180626908 22:17199575-17199597 TCCTTTTTCCGGAGGGGAGATGG - Intronic
1181577491 22:23804546-23804568 CTTTTTTTTGGGAGGGGAGATGG + Intronic
1181867821 22:25873359-25873381 CTCTTGGTCTGGAGAGGATGGGG - Intronic
1183805884 22:40210626-40210648 CCCTTTGACTGCAGTGGAGACGG + Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
949612843 3:5720593-5720615 CCCTTTGTCTGCAGAAGAGATGG + Intergenic
949958866 3:9294754-9294776 CTGTTTCTTTGGAGAGGAGAAGG - Intronic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950554513 3:13687146-13687168 CTCCTTGTGTGGAGGGAGGACGG + Intergenic
951164001 3:19462542-19462564 CCCTTTGTCAGGTGGGTAGATGG + Intronic
952849994 3:37719940-37719962 TTATTTTTCTGGAGGGCAGAGGG + Intronic
952917056 3:38254598-38254620 CTTTTTTTGTGGAGGGGGGACGG + Exonic
952954580 3:38549188-38549210 CTCTGTGTCTGGAGAGGAGCTGG + Exonic
953330381 3:42048059-42048081 CTCTTGGAGTGGAGGAGAGAGGG - Intronic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
954419798 3:50412821-50412843 AGTTTTATCTGGAGGGGAGAGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956978134 3:74606031-74606053 CACTTTTTTTTGAGGGGAGAGGG - Intergenic
957836711 3:85603288-85603310 TTCTTTTTTTGAAGGGGAGAAGG + Intronic
957987644 3:87591616-87591638 GTCTCTGTCAGGAGGGGAGAGGG - Intergenic
959831771 3:110871495-110871517 CTTTTTTTCTGGAAGGTAGAGGG + Intergenic
961026194 3:123560164-123560186 CTCCTTGTCTGGAGGGGAGCAGG + Intronic
961652520 3:128423964-128423986 CCCTTTGCCTGGGGGGGTGATGG + Intergenic
962429137 3:135303222-135303244 CTCATTGTCTGGTCAGGAGATGG - Intergenic
963284503 3:143420015-143420037 CTCTTTGTCTAAATGGGACATGG + Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964849735 3:161082115-161082137 CTCAGTGTCTGAAAGGGAGAGGG - Intergenic
965165856 3:165194143-165194165 CTCCTCGCCGGGAGGGGAGAAGG + Intronic
966738225 3:183207322-183207344 CTCTTTGCCTGGAAGAAAGAGGG + Intronic
967133998 3:186497651-186497673 CTCTATGTCGGGGAGGGAGAGGG + Intergenic
967271863 3:187739113-187739135 CTCTCTGGCTGGAGAGGAGGGGG - Intronic
968447387 4:658550-658572 CTCTCTGTGTGGTGGGGACACGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970421119 4:15906347-15906369 CCCTTTGTATGGAGGGGAAGCGG - Intergenic
970461551 4:16279236-16279258 CCCTCTCTCTGGAGTGGAGAGGG + Intergenic
972371419 4:38427200-38427222 CTATTTGTCTGGAGAAGAGAGGG - Intergenic
972678699 4:41285141-41285163 CCCTTTCTCTGGAGGAGTGAAGG - Intergenic
974182950 4:58406764-58406786 CTGTTTCTGTGGAGGGGAAATGG - Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
980642272 4:135596229-135596251 CTCTTGGTCTGGAGAGCACATGG + Intergenic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
982284776 4:153723975-153723997 CTCTTTGGGTGGAGGGGACATGG - Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
982934001 4:161447991-161448013 GTGTTTGTTTGGAGTGGAGAGGG + Intronic
983656415 4:170089623-170089645 CTCATGGTCCGGATGGGAGAAGG + Exonic
985127653 4:186711317-186711339 GACTTTATCTGGAGAGGAGAAGG - Intronic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG + Intronic
986800278 5:11252909-11252931 CTCTTGATTTAGAGGGGAGAAGG - Intronic
989253385 5:39341186-39341208 CTCTGTCTCTGCAGGGGGGACGG + Exonic
989475083 5:41865715-41865737 CTCTTTTTCATGGGGGGAGAAGG + Intronic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
991611201 5:68451139-68451161 CTCTTTTTTTGGAGGGGGGAGGG - Intergenic
992135022 5:73735938-73735960 GTCTCTGTATGGATGGGAGAGGG - Intronic
993838536 5:92846722-92846744 CTCTTTTTCTGCAGGGGGGGTGG - Intergenic
995726009 5:115180546-115180568 CTCACTGTCTGGAGGTGCGAGGG + Intronic
996468835 5:123835603-123835625 TTGTTTATCTGGAGGTGAGAAGG + Intergenic
997716867 5:136049056-136049078 ACCTTTGTCTGGCGGTGAGATGG + Intronic
998637339 5:143970835-143970857 CTCTCTGGGTTGAGGGGAGAGGG + Intergenic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
999450883 5:151677298-151677320 CTTTGTGGCTGCAGGGGAGATGG - Intronic
1001727248 5:173915376-173915398 CTCTTTGTGCGGTGGGGAAAGGG + Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002534493 5:179868813-179868835 CTCTGTGTCTGGACAGGACAGGG + Intronic
1004248647 6:14003823-14003845 CTCTTTTTCTGGAGGCTCGAGGG + Intergenic
1005569121 6:27127459-27127481 CTTTTTTTTTGGAGGGGAAAGGG + Intronic
1005643897 6:27823556-27823578 CTCTTTGTGTGATGGGAAGATGG + Intergenic
1006163148 6:32049580-32049602 CTCTTCCTCTGCAGTGGAGAAGG + Intronic
1006243588 6:32708667-32708689 CTCTTAGTCTGTAAGAGAGAGGG + Intergenic
1006269057 6:32949942-32949964 CTCTGTGTTTGGAGGGGCCATGG + Intronic
1006603801 6:35242703-35242725 CTCTTTGCCTGGAGGGGTCCGGG - Exonic
1007190409 6:40011771-40011793 TTCTTTCTCTTGAGAGGAGAAGG - Intergenic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1008646229 6:53517668-53517690 GTGTTTGTGTGGAAGGGAGAAGG + Intronic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011758298 6:90528448-90528470 CTCTTTATCTGGAGAGGGGTTGG + Intronic
1012475377 6:99610934-99610956 TTTTTTTTCTGGAGGTGAGAAGG + Intronic
1012839275 6:104309008-104309030 CTCTTTCTCAGAAGGGGTGAAGG - Intergenic
1013216545 6:108032625-108032647 CTCTTAGCCTAGAGGGGAGCTGG + Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1014084680 6:117329754-117329776 CCCCTTGGCTGGAGGGGAGGGGG - Intronic
1014783723 6:125593789-125593811 CTCTCTGTCTGGAGGAAGGAAGG + Intergenic
1015122117 6:129711201-129711223 TTTTTTTTTTGGAGGGGAGATGG - Intergenic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1016460777 6:144278596-144278618 CTCTCTGTATTGAGGAGAGATGG - Intergenic
1016464683 6:144313762-144313784 CTCTATTTCTGGGGGAGAGATGG + Intronic
1017818394 6:158031342-158031364 CTCTGTGGCTGGAGGTGTGAGGG + Intronic
1018222788 6:161597618-161597640 CTCTCTCTCTGGAGTGGAGAAGG + Intronic
1018934640 6:168265683-168265705 CTCTGTGGCTTGAGAGGAGACGG + Intergenic
1018992275 6:168683234-168683256 CACTGTCTCTGGAGGGGAGGAGG - Intergenic
1019803670 7:3106789-3106811 CTTGTGGTCTGGTGGGGAGATGG - Intergenic
1020461094 7:8431041-8431063 CTCTTTTTTGGCAGGGGAGAGGG - Intergenic
1020509403 7:9034541-9034563 CTTTTTGTTAGGAGGGGTGAAGG + Intergenic
1020660183 7:10972958-10972980 CACTTTTTCTGCAGGGCAGATGG + Intergenic
1021481035 7:21117329-21117351 CTTTTTGTCTTTAGGGGAGAAGG - Intergenic
1021598855 7:22344140-22344162 CTCTTTGGGTGGAGGATAGAGGG - Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022974553 7:35545411-35545433 CTCTCTCTCTGCAGGAGAGAGGG + Intergenic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1023659355 7:42456799-42456821 CACTTTGTCTCGGAGGGAGATGG - Intergenic
1024906144 7:54382847-54382869 CTCTTTGTCTGAAATGGACATGG - Intergenic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027051090 7:75021676-75021698 CTCCTCGTCTTGAGGGGAGGCGG - Intronic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027140150 7:75650975-75650997 TTTTTTGTGTGGTGGGGAGAGGG - Intronic
1027520554 7:79201090-79201112 CTCTTTGTCAGGAGAGGGGTGGG + Intronic
1027633466 7:80638578-80638600 CTCTTTTTTTGGGGGGGGGAGGG + Intronic
1029236892 7:99127563-99127585 CTCTTTCTCTGGAGGCAAGCTGG + Intronic
1029609372 7:101618546-101618568 CTCTTTCTGGGGAGGAGAGAAGG - Intronic
1032212579 7:129929399-129929421 CTTTTTGTGTGGAGAGGAGAAGG - Intronic
1032656868 7:133939902-133939924 GACTTTTTCTAGAGGGGAGAAGG - Intronic
1033230670 7:139595013-139595035 CTCTCTGACTGGTGGAGAGACGG + Intronic
1033245517 7:139713953-139713975 CTCCTTGTCTCCAGAGGAGAAGG - Intronic
1033254974 7:139792630-139792652 CTCTTTATCTGCAGGGATGAGGG + Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1034098701 7:148433263-148433285 GTCATTATCTAGAGGGGAGAAGG + Intergenic
1034244140 7:149631819-149631841 CTCTTAGCCTGGAGGGGATGAGG - Intergenic
1034684581 7:152958951-152958973 CTTTTTCTCTGCAGGGGAGATGG - Intergenic
1035698611 8:1620944-1620966 TTGTTTGTCTGGAGAGCAGAGGG - Intronic
1036620171 8:10419739-10419761 CTCTTTGGGTGGAGGGCAGGCGG + Intronic
1037833768 8:22204336-22204358 CACTATGACTGGTGGGGAGAAGG - Intronic
1038660520 8:29492873-29492895 ATCTTGCTCTGGAGGGGAAAGGG + Intergenic
1039920933 8:41894153-41894175 TTCTTTGGGTGCAGGGGAGATGG - Intronic
1041776550 8:61529239-61529261 CTCTTTTGCTCGAGGGGAGCAGG - Intronic
1042502646 8:69526222-69526244 CTCTGTGACTGGATAGGAGAGGG - Intronic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1043817448 8:84819064-84819086 CTCTATGTCTGCAGGGAAAAAGG + Intronic
1044429878 8:92095942-92095964 CTGTTTGGATGGAGGTGAGATGG - Intronic
1044792247 8:95859454-95859476 CACTTTGGCTGGTGGGGAGGAGG + Intergenic
1045630203 8:104110008-104110030 CTTATTTTCTAGAGGGGAGATGG + Intronic
1046587270 8:116162764-116162786 CACTTTATCCGGAGGGGTGAGGG - Intergenic
1047021024 8:120775171-120775193 CTTTGTGTTTTGAGGGGAGAAGG + Intronic
1048574218 8:135678290-135678312 CTATTTGTCAGGAGGAGAGGAGG - Intergenic
1049038344 8:140094169-140094191 TTCTTTGGCTGGAGGAGACATGG + Intronic
1049269460 8:141686533-141686555 CTCCACGTCTGGAGGGGAGACGG + Intergenic
1050285635 9:4099027-4099049 CACTTTGTCTTGAGGGCAGTGGG - Intronic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1050835663 9:10075669-10075691 CTCATTTTCTGGGGGGGAGGGGG + Intronic
1051857263 9:21582570-21582592 CACTTTGTCAGGGGGTGAGAGGG - Intergenic
1052215804 9:25964463-25964485 CTCTTGGTCTGGAGAGCACATGG - Intergenic
1052975290 9:34405699-34405721 CTCTTTGCCTGCAGGAGACAAGG + Intronic
1054891881 9:70259828-70259850 CTAGTTGTCTGAAGGGGAGAGGG - Intronic
1055916706 9:81409469-81409491 CGATTTCTCAGGAGGGGAGAGGG + Intergenic
1056316735 9:85397548-85397570 CTCTTTTTCTTGAGGGGAAAGGG - Intergenic
1056763434 9:89430261-89430283 CTCTTTGGCTGCTGGGGAGCAGG - Intronic
1057578759 9:96266772-96266794 CTCAATGCCTGGAGTGGAGAAGG - Intronic
1059451699 9:114375117-114375139 CTCATGGTCTGGAAGGGAAATGG + Intronic
1059471900 9:114511379-114511401 CTCTTTTTTTTGTGGGGAGATGG - Intergenic
1060399308 9:123338865-123338887 TTCTTTATCTGGAGGGCAGCTGG + Intergenic
1061218792 9:129236998-129237020 CTCAATATCTGAAGGGGAGAGGG - Intergenic
1061587671 9:131579162-131579184 CTCTCTCCCTGGAGGGGAGTGGG + Exonic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061829444 9:133281592-133281614 CTCTTGGTCTGCACGGGAGAAGG + Intergenic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1061897388 9:133655547-133655569 CTCTTTGTCTGCACGGGAGGAGG + Intronic
1062064596 9:134519490-134519512 CTCTTTGTAAGGAGAGGACACGG - Intergenic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062434522 9:136540963-136540985 CTCTTTGTTTTGAGGAGAGCTGG - Intronic
1186186930 X:7029793-7029815 CTCATTGGCTGGAGGGATGATGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1189407883 X:40741989-40742011 ATTTTTTTGTGGAGGGGAGAGGG + Intergenic
1189633093 X:42975737-42975759 CCCTTTGTCTGGAGAGCACAAGG - Intergenic
1193886993 X:86994519-86994541 CTCTTTCTTTGGAAAGGAGAGGG + Intergenic
1194159321 X:90431593-90431615 CTTTTTGTGGGGAGGGGGGAGGG + Intergenic
1194684271 X:96893303-96893325 TTCTTTGTGTGGAGTGGAGAGGG + Intronic
1195409329 X:104552403-104552425 CCCATTGTCTTGAGAGGAGAGGG - Intergenic
1197356190 X:125439423-125439445 CTCTTGGTCTGGAGAGCATATGG - Intergenic
1197386958 X:125813806-125813828 CTCTCTGTCTGGTAGGGTGAGGG - Intergenic
1199602928 X:149553625-149553647 CTCTTAGTCCAGAGGGGAGATGG - Intergenic
1199647461 X:149925850-149925872 CTCTTAGTCCAGAGGGGAGATGG + Intergenic
1200059975 X:153479835-153479857 CGCTCTGTCTGCAGGGGTGAGGG - Intronic
1201409848 Y:13688495-13688517 CCCAATCTCTGGAGGGGAGAAGG - Intergenic