ID: 1178117428

View in Genome Browser
Species Human (GRCh38)
Location 21:29431804-29431826
Sequence TAACCACTCAGCTCCGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178117428_1178117430 1 Left 1178117428 21:29431804-29431826 CCTACCACGGAGCTGAGTGGTTA 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1178117430 21:29431828-29431850 CAGATAAATGCTATTATTGAAGG 0: 1
1: 0
2: 6
3: 35
4: 281
1178117428_1178117431 6 Left 1178117428 21:29431804-29431826 CCTACCACGGAGCTGAGTGGTTA 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1178117431 21:29431833-29431855 AAATGCTATTATTGAAGGACAGG 0: 1
1: 0
2: 2
3: 29
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178117428 Original CRISPR TAACCACTCAGCTCCGTGGT AGG (reversed) Intronic
903007663 1:20309334-20309356 GAAAAACTCAGCTCCGTGGGGGG + Intronic
904685055 1:32253669-32253691 TGCCCACTCAGCACCTTGGTGGG + Intronic
905872592 1:41413559-41413581 TAACCCCACAGCCCCCTGGTGGG - Intergenic
923282907 1:232461877-232461899 GGACCACTCAGATCCATGGTGGG + Intronic
1063102265 10:2961096-2961118 TGACAGCTCAGCTCCTTGGTGGG - Intergenic
1063616793 10:7607324-7607346 TAACCACTCAACTCTGCTGTTGG - Intronic
1064186567 10:13167204-13167226 TAAAGACTCAGCTCCCTGGCTGG - Intronic
1067512026 10:46904138-46904160 TCTCCTCACAGCTCCGTGGTTGG - Intergenic
1067650221 10:48147686-48147708 TCTCCTCACAGCTCCGTGGTTGG + Intergenic
1070174234 10:73956791-73956813 TAAACACTCAGTTCCTTGTTTGG + Intergenic
1071728337 10:88222048-88222070 TTACCACTCAGCTGAGGGGTTGG + Intergenic
1076684611 10:132192396-132192418 TTTCCACTCAGGTCCCTGGTTGG - Intronic
1076699602 10:132264590-132264612 TGGCCCCTCAGCTCCCTGGTGGG - Intronic
1078618293 11:12884777-12884799 TAGCCACTCAGCTGCTTGGAAGG - Intronic
1085394852 11:76202079-76202101 ATACCACTCAGCACCGTGGGCGG - Intronic
1089367068 11:117927215-117927237 TTCCCACACAGCTGCGTGGTCGG - Intronic
1091858225 12:3756023-3756045 TTACCACTGTGCTCCTTGGTGGG + Intronic
1096577048 12:52559226-52559248 TCCTCACTCAGCTCCGTGGCTGG + Intergenic
1103201455 12:119091335-119091357 TAGCCACTCAGCTTGGTGGTAGG + Intronic
1113807391 13:113117766-113117788 TACCCACCCAGCACCGCGGTCGG - Intronic
1118062778 14:62158885-62158907 CAACTGCTCAGCTCAGTGGTGGG + Intergenic
1122226389 14:100282989-100283011 TAACCTTTCAGCTCCAAGGTGGG + Intergenic
1131366347 15:91845295-91845317 AAACCACTAAGTTCTGTGGTGGG + Intergenic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133710064 16:8392791-8392813 CAACCACTCAACTCCGCTGTTGG + Intergenic
1134817025 16:17214140-17214162 GAACCACTCATCTCCCTGGGAGG + Intronic
1136001023 16:27292826-27292848 TTTCCACTCAGCTCTCTGGTAGG - Intergenic
1139532775 16:67551165-67551187 TAACCACCCAGGTCTGAGGTGGG + Intergenic
1141672518 16:85500071-85500093 TAACACCACTGCTCCGTGGTGGG - Intergenic
1147149316 17:38504914-38504936 CAGTCTCTCAGCTCCGTGGTGGG + Intronic
1147369966 17:39985596-39985618 TACTCAGTCAGCTCCGTGGATGG + Intronic
1150422219 17:65047896-65047918 TAACCATTTAGCTCCATGATTGG - Intronic
1157603292 18:48908874-48908896 AAAGCACTCAGCTCCGTGTTTGG + Intergenic
1168304560 19:55428562-55428584 TGACCCCTCAGCTAGGTGGTGGG + Intergenic
931806963 2:65816881-65816903 TAAGCACTCAGCTCTATTGTGGG + Intergenic
1175600491 20:60268746-60268768 TAACCAATCAGCTCAGGGATAGG + Intergenic
1178117428 21:29431804-29431826 TAACCACTCAGCTCCGTGGTAGG - Intronic
1179278516 21:39913694-39913716 TATCAGCTCAGCTGCGTGGTTGG + Intronic
1179887232 21:44319394-44319416 AGGCCACCCAGCTCCGTGGTGGG + Exonic
1181592070 22:23891661-23891683 TGACCCCTTACCTCCGTGGTAGG - Intronic
952312393 3:32201746-32201768 AAACCACTCTGCTGCCTGGTGGG + Intergenic
955533311 3:59897528-59897550 TAAATACTCAGTTCCGTGCTTGG + Intronic
956928056 3:74010659-74010681 TAACCACTGTTCTCCCTGGTAGG + Intergenic
958189597 3:90168036-90168058 TAAACACTGAGCTCCGTTCTAGG - Intergenic
960862895 3:122169371-122169393 GAACCACTCATCTGAGTGGTTGG - Intergenic
966850257 3:184160571-184160593 CAGCCATTCAGCTCCATGGTGGG + Intronic
968805374 4:2768495-2768517 TTACCACTCAACTCCGGTGTTGG + Intergenic
971789773 4:31154472-31154494 TAACCACTCAGTTCCATGAGGGG - Intergenic
972351266 4:38238044-38238066 TAACCTCTCTGCTCAATGGTAGG + Intergenic
977562024 4:98542247-98542269 TAAGCACACAGCTCCATGGGTGG - Intronic
985915337 5:2914149-2914171 TAACCACTCAGCCCTGTGCCTGG + Intergenic
989451056 5:41587216-41587238 TATGCACTCAGCTGTGTGGTGGG - Intergenic
993844263 5:92920856-92920878 TAAGCATTCAGCTCACTGGTAGG + Intergenic
995485129 5:112632658-112632680 TTACCACTCAGCTCCCATGTAGG + Intergenic
1000383646 5:160651938-160651960 ACACCACTCAGCTCAGTGGTGGG + Intronic
1008762620 6:54871352-54871374 TATCTACTCAGCACCATGGTGGG + Intronic
1016720268 6:147288387-147288409 TAGCTACCCAGCTCAGTGGTAGG - Intronic
1024931487 7:54669094-54669116 TAACCACTCAGCTACTAGCTGGG - Intergenic
1028307884 7:89289682-89289704 GAATCACTCATCTCAGTGGTGGG + Intronic
1031063564 7:117078761-117078783 TAACCACTCAGTTAATTGGTTGG + Intronic
1035647159 8:1233442-1233464 CAACCATTCAGGCCCGTGGTAGG - Intergenic
1036127125 8:6073445-6073467 TAAACACTCAGCACCATGGCAGG + Intergenic
1040926880 8:52694088-52694110 TAAACACTCAGCTCTGTTCTTGG - Intronic
1048534863 8:135283746-135283768 TAAACCCTCAGCTCGGGGGTTGG - Intergenic
1055419001 9:76116643-76116665 TAAACACTCAGCTCAGTATTTGG - Intronic
1056935688 9:90913622-90913644 TAACCACTCTCCTCGGTGGCTGG + Intergenic
1059550164 9:115221011-115221033 TAAACACTCAGCTCTCAGGTTGG - Intronic
1194793508 X:98181000-98181022 GACTCACTCAGCTCCGTGATGGG + Intergenic
1195229857 X:102835531-102835553 TAACCACTCTGCTCTCTGGGAGG - Intergenic
1198657547 X:138931442-138931464 TAGACTCTCAGCTCCCTGGTGGG - Intronic
1202237386 Y:22727280-22727302 TAATAACTCAAATCCGTGGTTGG - Intergenic