ID: 1178118212

View in Genome Browser
Species Human (GRCh38)
Location 21:29439188-29439210
Sequence CAGTTTTACTTTAGGGCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178118212_1178118215 7 Left 1178118212 21:29439188-29439210 CCTAATGCCCTAAAGTAAAACTG 0: 1
1: 0
2: 0
3: 23
4: 196
Right 1178118215 21:29439218-29439240 TGAAAGATGTACATTTTATCAGG 0: 1
1: 1
2: 1
3: 29
4: 333
1178118212_1178118216 10 Left 1178118212 21:29439188-29439210 CCTAATGCCCTAAAGTAAAACTG 0: 1
1: 0
2: 0
3: 23
4: 196
Right 1178118216 21:29439221-29439243 AAGATGTACATTTTATCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 195
1178118212_1178118218 15 Left 1178118212 21:29439188-29439210 CCTAATGCCCTAAAGTAAAACTG 0: 1
1: 0
2: 0
3: 23
4: 196
Right 1178118218 21:29439226-29439248 GTACATTTTATCAGGAGGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 154
1178118212_1178118217 14 Left 1178118212 21:29439188-29439210 CCTAATGCCCTAAAGTAAAACTG 0: 1
1: 0
2: 0
3: 23
4: 196
Right 1178118217 21:29439225-29439247 TGTACATTTTATCAGGAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178118212 Original CRISPR CAGTTTTACTTTAGGGCATT AGG (reversed) Intronic
901828014 1:11875135-11875157 TAGTTTTGCTTTAGGTCTTTGGG + Intergenic
902074330 1:13771059-13771081 CAGTTTTGTTTAAGGGAATTTGG - Intronic
905834391 1:41104902-41104924 CACTCTTACTTTTGGCCATTAGG + Intronic
906806162 1:48780721-48780743 CAGTTTTAGTTTTGTGCATATGG - Intronic
909421752 1:75474991-75475013 CGATTTTACTTTATGCCATTTGG - Intronic
909821581 1:80069496-80069518 CAATTTTAGTTTTGGGGATTCGG + Intergenic
911887139 1:103317620-103317642 CAGATTTAATTAATGGCATTTGG - Intergenic
918134991 1:181664029-181664051 CTTTTTTATTTTAGAGCATTTGG + Intronic
918401942 1:184172352-184172374 CGGCTTCACTTTAGGGCATGTGG + Intergenic
918876797 1:190057225-190057247 CAGTTTTACTCTTCTGCATTTGG + Intergenic
919746191 1:201010546-201010568 CCCTTTTACTTTAGGGAGTTGGG - Intronic
920652707 1:207850837-207850859 TAGATTTTCTTTAGGGCATCTGG - Intergenic
921614517 1:217250618-217250640 CAGTTTTGGTGTAGGGCATTTGG + Intergenic
922093418 1:222419780-222419802 CAGGTTTACTTAAGTGGATTAGG + Intergenic
923753180 1:236765805-236765827 GAGTTTTAAATTAGAGCATTTGG + Intergenic
924127631 1:240872002-240872024 CACTCTTGCTTTAAGGCATTAGG - Intronic
1062860934 10:808645-808667 CAGTTTTACTTTATGCCATGTGG - Exonic
1065525598 10:26617162-26617184 AAGTTTTAAATTAGTGCATTGGG - Intergenic
1065533036 10:26691680-26691702 AAGTTTTAAATTAGTGCATTGGG - Intergenic
1068389794 10:56380329-56380351 AAGTTTTACTTTAGGGTAGGGGG - Intergenic
1068675712 10:59767390-59767412 CACTTGTACTTTAGTCCATTTGG - Intergenic
1068881606 10:62055243-62055265 CAGCCTTACTTTAGGGCTTATGG - Intronic
1070362750 10:75707044-75707066 TAGTTTTGCTTTAGTGCCTTGGG + Intronic
1074079432 10:110156150-110156172 CAGTTTTACTGAAGGGCACCAGG + Intergenic
1074327984 10:112471521-112471543 CAGTGTGACTTTAAGTCATTTGG - Intronic
1074425691 10:113349226-113349248 CATCTTTATTTTATGGCATTGGG - Intergenic
1074790073 10:116877751-116877773 CAGCTTTACTTAAGACCATTGGG + Intronic
1084875468 11:72129126-72129148 CATTTTTGCTTCAGGGCCTTTGG + Intronic
1085716055 11:78874404-78874426 CTGTATTACATTAGGACATTTGG - Intronic
1085922071 11:80969254-80969276 GAGTTTTACATGAAGGCATTGGG + Intergenic
1086811275 11:91313321-91313343 CATTTTTACTCTATGGTATTTGG - Intergenic
1087741439 11:101892089-101892111 GAATTTTTCTTGAGGGCATTTGG - Intronic
1090613441 11:128492791-128492813 CAGTTTTACTTTAGAGAAAAGGG + Intronic
1091149118 11:133310469-133310491 AAGTTATACTTTATGGCATAAGG + Intronic
1092758908 12:11791291-11791313 CACTGTTACTTTAGAGGATTTGG + Intronic
1093415604 12:18916993-18917015 TAGTTTAACTTTAGGACATAAGG - Intergenic
1094407014 12:30127196-30127218 CATGATTACTTTAGGGCTTTTGG - Intergenic
1095196715 12:39327887-39327909 TAGATTAACTTTAGGGTATTTGG - Intronic
1095311539 12:40703569-40703591 CAGGTTTGATTTAGGGAATTAGG + Intronic
1097468387 12:59956303-59956325 CATTTTTACATAAGGTCATTTGG - Intergenic
1097480998 12:60126069-60126091 CATTTTTATTTTAGGCCTTTGGG - Intergenic
1100032993 12:90215698-90215720 CATTGGTACTTTAGGGCACTGGG + Intergenic
1102531299 12:113548311-113548333 CAGGTTCACCTTAGGGCAATAGG + Intergenic
1103122246 12:118390067-118390089 CTGTTTGACTTAAGGACATTTGG + Intronic
1104280109 12:127369063-127369085 CTCTTTAACTTTAGGGCATGTGG - Intergenic
1105227109 13:18446310-18446332 CTGTTTTCCTTTTGAGCATTTGG + Intergenic
1105846203 13:24296387-24296409 CAATGTTACTTTATGGTATTTGG - Intronic
1107706107 13:43107641-43107663 CAATTTTTTTTTAGGGAATTTGG + Exonic
1111120069 13:83836156-83836178 CAGTTTTATTTTTCTGCATTTGG - Intergenic
1111350446 13:87021860-87021882 CTGCTTTACTTTACTGCATTTGG - Intergenic
1111563444 13:89983382-89983404 TAGGTTTTCTTTAGAGCATTAGG - Intergenic
1111686404 13:91506966-91506988 CATGGTTACTTTGGGGCATTGGG - Intronic
1112263230 13:97897694-97897716 CATTTTTACTTTAGATTATTTGG + Intergenic
1113319862 13:109222834-109222856 CAGTTATACTTTCTGGCACTGGG + Intergenic
1117879408 14:60296554-60296576 TAGTTTTTCTTTTAGGCATTAGG + Intronic
1119815679 14:77564755-77564777 GAGTTTTAGTTTTGGCCATTGGG - Intronic
1120817178 14:88873258-88873280 CTGTCTTCCTTTAGGGCCTTTGG + Intronic
1122372808 14:101238043-101238065 CAGATTCATTTTAGGGCACTTGG - Intergenic
1126775634 15:52098311-52098333 CATTTTTTTTTTAGGGAATTTGG + Intergenic
1127603862 15:60566664-60566686 CAGATTTCTTTTAGGGAATTCGG + Intronic
1128191612 15:65705557-65705579 CATTGTTAATTTAGGGAATTTGG - Intronic
1128293158 15:66494894-66494916 CTGACTTACTTGAGGGCATTTGG + Intronic
1130679514 15:85984103-85984125 CAGTTTTACATCAGGGTCTTAGG + Intergenic
1136737910 16:32479151-32479173 CTGTTTTGCTTTAAGGTATTAGG + Intergenic
1138293173 16:55865385-55865407 CAGTCTGACTTTAGCGCATTTGG - Intronic
1140871346 16:79109427-79109449 CTTTTTTACTTTAGGGCATAGGG + Intronic
1140953553 16:79841591-79841613 CAGTTTGCCTTTGGGCCATTTGG + Intergenic
1203015163 16_KI270728v1_random:350426-350448 CTGTTTTGCTTTAAGGTATTAGG - Intergenic
1203033498 16_KI270728v1_random:623584-623606 CTGTTTTGCTTTAAGGTATTAGG - Intergenic
1144201388 17:12945441-12945463 CAGTATTTATTTAGGGCATGCGG + Intronic
1148668952 17:49395832-49395854 CAGTTTTACACAAGGGCCTTAGG - Intronic
1151033208 17:70766356-70766378 TATTTTGATTTTAGGGCATTAGG + Intergenic
1151236667 17:72725178-72725200 CAGTTTTTCTTTTTGCCATTTGG - Intronic
1153740946 18:8127105-8127127 TAGTTTTACTTTTGGTCTTTTGG - Intronic
1155043557 18:22084957-22084979 CAGGTTTAATTTAGGAAATTTGG - Intergenic
1156680928 18:39587298-39587320 ATGTTTTATTTTAAGGCATTAGG - Intergenic
1156750086 18:40441977-40441999 TAGTTTTACTTTGTGGGATTCGG - Intergenic
1156983986 18:43327138-43327160 CAGTTTTATTTTGTGGCATATGG - Intergenic
1158155549 18:54421963-54421985 CACTTTTACTTTATGCCATAAGG - Intergenic
1159313562 18:66740550-66740572 CACTTTAACTTCAGGTCATTAGG + Intergenic
1159323690 18:66888552-66888574 TATTTATACTTTAGAGCATTTGG - Intergenic
1159876556 18:73818027-73818049 CAGTTTTACTTTTTTGCATGTGG - Intergenic
1159903845 18:74072735-74072757 CTATGTTATTTTAGGGCATTTGG - Intergenic
1161469697 19:4450313-4450335 CAGTTTTAGTTCATGGCTTTTGG - Intronic
1166907860 19:46125918-46125940 CAGCTTTACTATTGGGCATTGGG + Intergenic
1167698393 19:51027902-51027924 CAGTTTCCCTTCAGTGCATTTGG + Intronic
1168127285 19:54292226-54292248 CAGTTTTATTTTAGGGAATGTGG + Intergenic
1168173083 19:54602690-54602712 CAGTTTTATTTTAGGGGATGTGG - Intronic
1168662421 19:58178163-58178185 CATCTTTTCTTTAGGCCATTAGG - Intergenic
925253554 2:2463067-2463089 CATTTTTGCTTTTGGGAATTGGG - Intergenic
927684104 2:25158986-25159008 TAGTTTTATTTTAGGGAAGTGGG + Exonic
927736937 2:25532675-25532697 CAGTGTTATTTTAGGGGAATTGG - Intronic
929047056 2:37800360-37800382 CAGTGTTAGTTTTGGTCATTGGG - Intergenic
930473138 2:51846020-51846042 CAGTTGTGCTTTGGGTCATTGGG - Intergenic
931024632 2:58095431-58095453 CAATTTTGCATTAGGTCATTAGG + Intronic
931104888 2:59044476-59044498 CAGTGCTACTTTAGGTCATAGGG + Intergenic
933502018 2:83125057-83125079 CAGATTTATTTTCTGGCATTAGG - Intergenic
933608875 2:84413606-84413628 CTGAGTTACTTTAGGGCAGTTGG - Intergenic
936475357 2:112834927-112834949 CAGTTGTAGCTAAGGGCATTTGG - Intronic
936717639 2:115207323-115207345 CAGTTTTACTTTGGTGCAATAGG + Intronic
937736817 2:125301302-125301324 CTGTTTTACTTTAGGACATGGGG - Intergenic
938192828 2:129299348-129299370 GAGTTTCTCTTTAGGGCAATAGG - Intergenic
939608158 2:144277508-144277530 CAGTTTTGCATTAGGGTATGTGG - Intronic
940513915 2:154655540-154655562 CAGTTTTATTTTAGGGCTCTTGG - Intergenic
941576867 2:167243639-167243661 CAGTTTTAATTTCCAGCATTTGG - Exonic
942546746 2:177073184-177073206 CAGTTTTAGTCTATGACATTAGG - Intergenic
944664499 2:201948592-201948614 CATGTTTACTTTGGGGCTTTAGG - Intergenic
944683379 2:202096921-202096943 CAGTCTTACCTCAGTGCATTCGG + Intronic
945638758 2:212395483-212395505 CTTTTTTATTTTAGGACATTAGG - Intronic
946198544 2:218055679-218055701 TAGTTTTAGTTTAGGGCTTTAGG - Intronic
948343554 2:237276076-237276098 CAGTTTTAATTTTCTGCATTTGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1174711234 20:52707560-52707582 GAGATTTATTTTAGGGAATTGGG + Intergenic
1177686968 21:24449531-24449553 CAGTTTTTAATTTGGGCATTGGG + Intergenic
1178118212 21:29439188-29439210 CAGTTTTACTTTAGGGCATTAGG - Intronic
1178332578 21:31712059-31712081 CAATTTTACCTTAGGGCATGAGG + Intronic
1179050443 21:37884599-37884621 GACTTTTACTTTGGGGCTTTGGG - Intronic
1180719784 22:17899071-17899093 CAGTTTAATTTTAGGTGATTTGG - Intronic
1183840103 22:40492417-40492439 CAGTTCTGCTTTTTGGCATTTGG - Intronic
950081930 3:10228797-10228819 CAGTGTTTCCTGAGGGCATTTGG + Intronic
950113586 3:10435953-10435975 CTGCTTTCCTTTAGGGGATTTGG + Intronic
951056399 3:18151131-18151153 CATTTTCACTTTAGGCTATTTGG + Intronic
951575752 3:24112040-24112062 CAGATTTACTTTGGGGACTTTGG + Intergenic
951679906 3:25283816-25283838 CAACTCTACTTTTGGGCATTTGG + Intronic
952139800 3:30465995-30466017 GACTTATACTTTAGGGCAGTGGG + Intergenic
953658826 3:44875560-44875582 CAGTTTTACTTCAGGGAGTCCGG + Intronic
955002531 3:54940408-54940430 CAGTTTAATTTTACAGCATTAGG - Intronic
955005618 3:54965876-54965898 CAGTTCTAGTTCAGGGCATCAGG + Intronic
956319503 3:67980944-67980966 ATTTTTTAGTTTAGGGCATTGGG + Intergenic
957213357 3:77289903-77289925 CAATTTTACTTTATGTCTTTAGG - Intronic
957213370 3:77290009-77290031 CAATTTTACTTTATGTCTTTAGG - Intronic
957213837 3:77294440-77294462 CAATTTTACTTTATGTCTTTAGG - Intronic
957213851 3:77294546-77294568 CAATTTTACTTTATGTCTTTAGG - Intronic
959660879 3:108866944-108866966 CAGTTTTCTTTTAGGTTATTTGG - Intergenic
960772114 3:121206007-121206029 CATTTTTACTTTAGGGAAAGAGG + Intronic
964335124 3:155646577-155646599 CAGTTTTACTCAAGGACTTTAGG - Intronic
967258966 3:187623238-187623260 CAATTTTCCTTTAGGCCAATAGG - Intergenic
971171253 4:24235499-24235521 CAGTGCTACTTTAGGGTATGAGG - Intergenic
972919089 4:43915996-43916018 CAGTTTCACTTTTCGGCATATGG - Intergenic
973291029 4:48470793-48470815 CAGTTTCACATTGGGTCATTTGG + Intergenic
974339650 4:60599071-60599093 CAGTTTTAGTTTTATGCATTTGG + Intergenic
974441114 4:61918904-61918926 CAGTTTTACTTGCGTGCCTTTGG + Intronic
974548919 4:63348358-63348380 CAGTTTTATCACAGGGCATTCGG + Intergenic
976891029 4:90048080-90048102 CAGTTCTACTCTATGGCTTTTGG - Intergenic
978385983 4:108175713-108175735 CACTTTTAATTTAGGACATTTGG - Intergenic
979821703 4:125181963-125181985 CAGTTGTATTTTAGGAAATTGGG + Intergenic
979950715 4:126890121-126890143 CAGATTGAATTTAGGCCATTGGG + Intergenic
980809028 4:137851921-137851943 CTGTTTTACTTCAGGATATTGGG + Intergenic
981922743 4:150103532-150103554 CAATTTAACTTTATGGAATTTGG - Intronic
982952484 4:161717149-161717171 CAGTTTGAATTAAGGGCATTTGG - Intronic
983432129 4:167664171-167664193 CAGTTTTACTTTTGTGCATGTGG - Intergenic
984575697 4:181445635-181445657 CAGTTTTCCTCTTGGCCATTTGG + Intergenic
984581405 4:181514531-181514553 GAGTTTTACTTTAGCTCACTTGG + Intergenic
986020857 5:3801156-3801178 CAGTTACACTTCAAGGCATTGGG + Intergenic
987149145 5:15021160-15021182 CAGTTTTACTTTGGGACTTTGGG + Intergenic
988347116 5:30051637-30051659 CTGTTTTACTTTAGATCATCAGG - Intergenic
989689907 5:44129397-44129419 CTTTTTGACTTTAGGGCTTTGGG + Intergenic
990088130 5:52004127-52004149 CAGTTTTTCTTTGGGTCTTTGGG + Intergenic
992663226 5:78982419-78982441 CTGTATTACTTTTGGACATTTGG - Intronic
992794460 5:80243210-80243232 AAGATTTACTATAGGGAATTAGG - Intronic
994315901 5:98332664-98332686 CAGTTTTACTTTTCTGCATATGG + Intergenic
994443506 5:99841425-99841447 CAGTTGTAATTGAGGGCATTGGG + Intergenic
994553419 5:101264886-101264908 TAGTTATACTTTAGGTGATTAGG + Intergenic
994856882 5:105133841-105133863 CATGTTTACTTTAGTGTATTGGG - Intergenic
995763949 5:115595624-115595646 GAGTTTTTCTTGAAGGCATTAGG - Intronic
996270666 5:121601062-121601084 CAGTTTTACTCTTGTGCATGTGG + Intergenic
1001302233 5:170542076-170542098 CAGTTTGACTTTTGGGCGTATGG - Intronic
1003304174 6:4911439-4911461 CAGTTTTGCCCTAGGTCATTAGG + Intronic
1003717350 6:8662152-8662174 TACCTTTAATTTAGGGCATTTGG + Intergenic
1004699481 6:18065578-18065600 CTGTTTTACTTTAGATCATCAGG - Intergenic
1005041431 6:21603781-21603803 CAGTTTCAATTCAGGGCAGTTGG + Intergenic
1007361721 6:41361724-41361746 CAGTTTTACTTTATGGCCCAGGG - Intergenic
1007541554 6:42650653-42650675 CATTTTTATTGTAGGGGATTTGG + Intronic
1008438644 6:51506714-51506736 CAGTTTTATTTTTCTGCATTAGG - Intergenic
1011120547 6:83947350-83947372 CAGTTTTAGTTTTGTGCATATGG - Intronic
1011470613 6:87704033-87704055 TAGTTTTAATTTAGGATATTTGG + Intergenic
1014178913 6:118362159-118362181 CATTTTTATTTTAGTGAATTTGG - Intergenic
1014600849 6:123410307-123410329 CTGTTTTACTTTATGTGATTGGG - Intronic
1015248335 6:131100294-131100316 CAGTTTTAGTTTTGTGCATATGG + Intergenic
1015944526 6:138486550-138486572 AAGCTTTACTTTAGGGCACTGGG - Intronic
1017361724 6:153580365-153580387 CATGTTTACTTTAGTCCATTTGG - Intergenic
1017482714 6:154873266-154873288 GCATTTTAATTTAGGGCATTTGG + Intronic
1018182320 6:161234837-161234859 CAGTTCAATATTAGGGCATTAGG + Intronic
1021119715 7:16785207-16785229 CTGTCTTCCTTTAAGGCATTTGG + Intergenic
1023430545 7:40086713-40086735 CAGTTTAATTCTAGAGCATTTGG + Intronic
1026046202 7:66906982-66907004 TAGTTTTATATAAGGGCATTTGG - Intergenic
1026362464 7:69615245-69615267 CAGTTTCACTTCAGGGTAGTGGG + Intronic
1027559878 7:79716324-79716346 CATTTTCACTTTATGGCATGAGG - Intergenic
1029446624 7:100616654-100616676 CAGCTTTACTTTAGGGGCATTGG + Intergenic
1029997550 7:105022866-105022888 CAGTTTTTCTGTAAGGCATATGG + Intronic
1030591033 7:111482017-111482039 CAGTTTTAGTTTATGAGATTGGG - Intronic
1031714323 7:125088960-125088982 CAGTTTTAATTTTTGGCATATGG + Intergenic
1031882924 7:127217343-127217365 CAGCTTTTCTTTAGGGTCTTTGG - Intronic
1033778601 7:144642976-144642998 CAGTTACATTTTAGGGAATTGGG - Intronic
1034853487 7:154518338-154518360 AAGTTTTACTTTAATGTATTTGG - Intronic
1039172282 8:34761261-34761283 CACTTTTCCTTCAGGGCATGGGG - Intergenic
1039778908 8:40764393-40764415 CATTTCTACTTCAGGCCATTTGG - Intronic
1043814657 8:84787413-84787435 CAGTATTACTGAAGGGCATTTGG + Intronic
1044635934 8:94324151-94324173 CAGGTTTATTTAAGGGTATTAGG - Intergenic
1049315277 8:141962890-141962912 CAGTTTTACATTAGGGCAAACGG + Intergenic
1050400741 9:5251003-5251025 CACATTTTCTTTGGGGCATTAGG - Intergenic
1052370970 9:27664136-27664158 GGGTTTTACTCTAGTGCATTGGG - Intergenic
1052438577 9:28463805-28463827 CTGTTTTAATTGAGTGCATTTGG + Intronic
1053372330 9:37573279-37573301 GAGTTCTCTTTTAGGGCATTTGG - Intronic
1057421634 9:94917654-94917676 CAGTGATACTATAGGGCAGTGGG - Intronic
1058526351 9:105862974-105862996 CAGTTTCACTCTTGGGCATATGG - Intergenic
1058746254 9:107993888-107993910 GAGATTTACTTTAAGGAATTGGG - Intergenic
1060609490 9:124949819-124949841 CAGATTTTCTTCTGGGCATTGGG - Intronic
1060879739 9:127109774-127109796 CAGTTGTGCTTTCTGGCATTTGG - Intronic
1061562148 9:131411790-131411812 CAGTTTTACTTTACAGAATTTGG + Intronic
1188400756 X:29741151-29741173 TAGTTTTAATTTATGACATTTGG + Intronic
1188642503 X:32523645-32523667 CAGTTTTCCTTTGGGTCATTGGG + Intronic
1188934999 X:36164326-36164348 CAGTTTTACTTTCTGTCTTTTGG + Intergenic
1192026775 X:67461392-67461414 CAGTTTTACTTTTCAGCATCTGG - Intergenic
1193597747 X:83467939-83467961 AAGTTTTGCTTTATGGTATTAGG - Intergenic
1193888892 X:87017864-87017886 CAGTTTCACTCTTGGGCCTTGGG - Intergenic
1194638388 X:96373501-96373523 CTGTTTTATTTTTGGGCATTCGG - Intergenic
1196393922 X:115239114-115239136 AGGTTTTACTTTTAGGCATTTGG - Intergenic
1199219984 X:145306540-145306562 CAGGTCTACTTCTGGGCATTGGG + Intergenic
1200405173 Y:2802953-2802975 CAGTTTTAGTTTCCTGCATTTGG + Intergenic