ID: 1178121388

View in Genome Browser
Species Human (GRCh38)
Location 21:29473719-29473741
Sequence GCTCACAGACAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178121388 Original CRISPR GCTCACAGACAGAGGGAGCA GGG (reversed) Intronic
900590693 1:3458207-3458229 GCTCACAGACATGGGGAGACAGG + Intronic
901117832 1:6862781-6862803 GGTCACAGACAGAAGGCCCAGGG - Intronic
901671473 1:10858537-10858559 GGTCCAAGACAGAGGGAACATGG + Intergenic
902601239 1:17541001-17541023 GCCCACAGTCACAGGGAGCTTGG - Intronic
902615283 1:17620343-17620365 CCTCACAGCCAGAGGAATCAGGG - Intronic
903140447 1:21335801-21335823 GACCACAGACACAGGGAGCTGGG + Intronic
903800407 1:25963068-25963090 GCCCTCAGGCTGAGGGAGCAGGG + Intronic
904359375 1:29962061-29962083 GCTCACAGTCAGGAGGGGCATGG - Intergenic
904562413 1:31407483-31407505 GCTCACAGACGGAAAGAGCCAGG + Intergenic
905018977 1:34795434-34795456 GAGCACAGACAGAGTCAGCATGG + Exonic
906290568 1:44617097-44617119 GCGCACAGACGGAGGGGGCATGG - Intronic
906696009 1:47823935-47823957 CCTTCCAAACAGAGGGAGCAAGG - Intronic
906901493 1:49841838-49841860 TCTCACAGTCAGGCGGAGCAGGG + Intronic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
912723987 1:112042930-112042952 TCTCACAGACAGAGCCACCAGGG - Intergenic
913663908 1:121030157-121030179 ACTCACAGACAGAAAGACCAAGG + Intergenic
914015302 1:143813436-143813458 ACTCACAGACAGAAAGACCAAGG + Intergenic
914016164 1:143820537-143820559 GCAGAAAGACAGAAGGAGCAGGG - Intergenic
914162516 1:145147789-145147811 ACTCACAGACAGAAAGACCAAGG - Intergenic
914221566 1:145686599-145686621 GGTCAAAGTCAGAAGGAGCAAGG - Exonic
914474131 1:148009465-148009487 GGTCAAAGTCAGAAGGAGCAAGG - Intergenic
914654783 1:149729078-149729100 GCAGAAAGACAGAAGGAGCAGGG - Intergenic
915028318 1:152854135-152854157 GCTCACAGAGTGATGGAACACGG + Intergenic
915102414 1:153509905-153509927 GCTGGCAGAAAGAGGGAGCATGG - Intergenic
915979416 1:160410726-160410748 GGCAACAGGCAGAGGGAGCAGGG - Intronic
917504657 1:175616651-175616673 ACGCCCAGACAGTGGGAGCATGG - Intronic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
920066487 1:203273236-203273258 GCTCACCGGCAGAGGGCGCCAGG + Intronic
920530025 1:206695070-206695092 GCTCACAGAGAGGAGGAGGAAGG + Intronic
920541474 1:206781681-206781703 GCTCATAGACTAAGGGAGAAGGG + Intergenic
921033081 1:211351004-211351026 GGCCAGAGACAGAGAGAGCAGGG - Intronic
921075289 1:211695734-211695756 TCTCACAGACAGCTGGAGGAGGG - Intergenic
921436238 1:215126497-215126519 GCTTACAGACTGAGTGAGAATGG + Intronic
921973892 1:221179922-221179944 GCTCATAGACATAGACAGCAAGG - Intergenic
922485268 1:225969127-225969149 AGTTCCAGACAGAGGGAGCAAGG + Intergenic
922785710 1:228281369-228281391 GCACACACACAGAGGGGGCCAGG - Intronic
922996048 1:229962478-229962500 GCTCACAGTCCAAGGCAGCAGGG + Intergenic
923057501 1:230438105-230438127 ATTCCCAGGCAGAGGGAGCATGG - Intergenic
923385259 1:233459836-233459858 GGTCAGAGGCAGAGGGGGCAGGG - Intergenic
924141250 1:241026202-241026224 CCTCACACACAGAGGGAACTCGG + Intronic
1063102272 10:2961156-2961178 GCTCAGAGAGAGAGGGAGAGAGG - Intergenic
1064400173 10:15014496-15014518 GCTCTCTGATAGTGGGAGCAAGG + Intergenic
1066113872 10:32222560-32222582 GCATGCAGACAGAGGGAGAACGG - Intergenic
1069299714 10:66890892-66890914 GAGCACAGAGAGAAGGAGCAGGG + Intronic
1069640022 10:69948812-69948834 TGTCACAGACAGAGGGAGGGTGG + Intronic
1070159996 10:73860552-73860574 GCCCAAAGACAGAAGGAGAAAGG + Intronic
1070335760 10:75454049-75454071 GGTAACAGACGGAGGGGGCAGGG + Intronic
1070737239 10:78871637-78871659 GCTCTCAGAGAGAGGGAGAAAGG - Intergenic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1071554537 10:86592273-86592295 CTTCACAGAGAGTGGGAGCAGGG + Intergenic
1071892650 10:90028436-90028458 ACTCAGGCACAGAGGGAGCAGGG - Intergenic
1072213517 10:93268621-93268643 GCTCAAAGTCAGAGGGATAAAGG - Intergenic
1072607929 10:96999497-96999519 GGTCACAGATGGAGGGAGCCAGG + Exonic
1073596649 10:104807174-104807196 GCACACACACACAGAGAGCAAGG - Intronic
1075040138 10:119101618-119101640 TGTCACAGACAGATGGAGCTGGG - Intergenic
1075553374 10:123410883-123410905 GCTCACAGAATGAGAGAACAGGG + Intergenic
1077412817 11:2411325-2411347 GCACACAGCCAGCGGGGGCAGGG - Intronic
1077906485 11:6538646-6538668 GCTGGCTGACAGAGGCAGCACGG + Exonic
1077995203 11:7446802-7446824 GCTCACAGACAGAAAGGGCAGGG - Intronic
1078332412 11:10436146-10436168 ATTGAAAGACAGAGGGAGCAGGG + Intronic
1078806530 11:14711286-14711308 ACTCTCAGATAGAGTGAGCAGGG + Intronic
1080682609 11:34490402-34490424 GCCCAGAGACTGAGTGAGCAAGG - Intronic
1080922876 11:36726367-36726389 GCACAGAGACAGAGGGAGGGAGG + Intergenic
1081254838 11:40879595-40879617 ACTCACAGATAAAGGGAGGATGG + Intronic
1083999064 11:66286260-66286282 GCTCAGAGCCAGTGGGAGCCGGG + Intronic
1084117918 11:67052657-67052679 GCTCCCAGACAGAGGGGGCCTGG - Intergenic
1084163677 11:67365079-67365101 GCTCTCACAAAGTGGGAGCAGGG + Exonic
1084261169 11:67979693-67979715 GCTCTCTGATAGCGGGAGCAAGG + Intergenic
1084459897 11:69290902-69290924 GCTCACAGGCAGAAGGGTCAGGG + Intergenic
1084629255 11:70335378-70335400 ACTCATGGACACAGGGAGCACGG - Intronic
1084807465 11:71588861-71588883 GCTCTCTGATAGCGGGAGCAAGG - Intronic
1084811485 11:71614404-71614426 GCTCTCTGACAGCGGGAGCAAGG - Intergenic
1084954940 11:72686036-72686058 ACTCACAGACAGAGGGTCCGCGG + Exonic
1085290305 11:75394392-75394414 GTTCACAGAGAGAGGGTACATGG - Intergenic
1085855119 11:80167590-80167612 GCTCAAAGGCAAAGGCAGCAAGG - Intergenic
1089079000 11:115760687-115760709 GCTGTGAAACAGAGGGAGCATGG - Intergenic
1090131037 11:124142230-124142252 GCTCACAGATGGTGGCAGCAGGG - Intronic
1090903417 11:131052673-131052695 GCTCAGAGACAGAGAGAGAGAGG - Intergenic
1091054119 11:132402448-132402470 GCTCCCAGACAGAGTGCCCAGGG - Intergenic
1091122854 11:133070999-133071021 GTTCACCTACAGAGGGAGCTTGG + Intronic
1093496179 12:19760882-19760904 ACTCAAGGACAGAGGGAACATGG - Intergenic
1095511732 12:42958412-42958434 GCATACACACAGAGGCAGCAAGG - Intergenic
1096523816 12:52198939-52198961 GCCCAGAGACAGAGGGAGGGAGG - Intergenic
1097182249 12:57178189-57178211 GCAGACAGACAGAAGGACCAAGG - Intronic
1097676693 12:62610670-62610692 GCTTATAGACAGAGGGGGTAAGG - Intergenic
1098167478 12:67713231-67713253 GTACAGAGACAGAAGGAGCAGGG - Intergenic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1100818891 12:98412664-98412686 TCCCACAGACAGAGGGAGGGAGG + Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1102194464 12:111014727-111014749 GCACCAAGGCAGAGGGAGCAGGG - Intergenic
1102500510 12:113349013-113349035 GGTCAGGAACAGAGGGAGCAAGG - Intronic
1102576548 12:113859471-113859493 GCTCACAGGGAGGGGAAGCAGGG - Intronic
1104053793 12:125214277-125214299 GCTGAGAGACAGAGGGAGGCTGG - Intronic
1106579021 13:31001697-31001719 GCTCAGAGAGTGAGGCAGCATGG + Intergenic
1106938553 13:34750686-34750708 TCTCAAAGACAGAGAGAGAAAGG + Intergenic
1107948732 13:45443271-45443293 GAGCACAGACTGAGGGAACAGGG + Intergenic
1108595155 13:51943091-51943113 GCTCACAGCCTGGGGGAGGACGG - Intronic
1109438716 13:62341327-62341349 TCTCACAGAGAGAGGGAGAGGGG - Intergenic
1112005612 13:95251130-95251152 GGTCACAGAGACAGGGAGCTGGG - Intronic
1112517498 13:100067295-100067317 CCTCAGAGACAGAGGTTGCAGGG + Intergenic
1113043877 13:106133243-106133265 GCTAAAAGACACAAGGAGCAAGG + Intergenic
1113794406 13:113048894-113048916 GGTCACAGGCAGGGGCAGCAGGG + Intronic
1113868224 13:113543070-113543092 GGTCACAGACAGAGGTAGGGCGG - Intronic
1114614255 14:24059897-24059919 GCTCACCAACAGAGGAGGCAGGG + Intronic
1115764862 14:36613343-36613365 ACACACACACACAGGGAGCATGG + Intergenic
1118630420 14:67697402-67697424 GTTCACAGTCAGAGAAAGCAGGG + Intergenic
1119328321 14:73775491-73775513 GCTCCCCGAGGGAGGGAGCAGGG - Intronic
1120850380 14:89164154-89164176 CCTCCCAGACATAAGGAGCATGG - Intronic
1121632012 14:95428128-95428150 CCTCACAGAAAGAGGAGGCAAGG + Intronic
1121957480 14:98227346-98227368 GCCCACAGAAAGAGGGAGAGAGG + Intergenic
1122097710 14:99383595-99383617 GCTCACAAAGAGACGGGGCAGGG - Intergenic
1122150477 14:99723183-99723205 TCTCAGAGACAGAGAAAGCAGGG - Intronic
1122243680 14:100385691-100385713 GTTCACAGACAAGGGGAGGAAGG - Intronic
1122310596 14:100791892-100791914 GCCCACTCAGAGAGGGAGCATGG - Intergenic
1122339926 14:101021298-101021320 GCTCACACTTGGAGGGAGCAGGG + Intergenic
1125373239 15:39000466-39000488 GGTCTCAGTCAGGGGGAGCAGGG - Intergenic
1126301357 15:47200228-47200250 ACTCACAGATTGAGGAAGCAAGG - Intronic
1127728900 15:61780038-61780060 TCTCACAGACAGGGAGAGGAAGG - Intergenic
1128092242 15:64926852-64926874 GCCCACTGACAGAGTGAGGAAGG + Intronic
1128561942 15:68674446-68674468 GCTCACAGGAAGGGGCAGCAGGG - Intronic
1129524065 15:76203055-76203077 GCTGACCTACAGAGGGTGCAGGG - Intronic
1130793919 15:87188301-87188323 GGACACACACAGAGGGAGAAAGG + Intergenic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1131114425 15:89785195-89785217 GCTCACAGGCAGAGAGAACGTGG + Exonic
1131837155 15:96402271-96402293 GAACACAGAAAGAGGGAGGAAGG + Intergenic
1132662528 16:1068030-1068052 GTCCAGAGACAGAGGGAGCTGGG - Intergenic
1132858202 16:2056954-2056976 TCCCAAAGACAGAGGCAGCAGGG - Intronic
1133807208 16:9134821-9134843 GCTCACAGACAGGTGCAGCCAGG - Intergenic
1135131130 16:19854652-19854674 GCGCACAGTCAGATGGAGCGGGG - Intronic
1135500853 16:22994649-22994671 GCTCAGAGCCAGAGGAAGGAAGG - Intergenic
1135882963 16:26277267-26277289 GCTCTTGGACAGAGGCAGCAGGG - Intergenic
1138235005 16:55374687-55374709 ACTGACACACAGAGGGAGGAAGG + Intergenic
1138541349 16:57689596-57689618 GCTGACACAAAGAGGGAGAACGG + Intergenic
1139299876 16:65935781-65935803 GATTAGAGACAGAGGGAGAAGGG - Intergenic
1139606697 16:68023707-68023729 GCTCACAGACAGAGAGGGTGAGG - Intronic
1139962652 16:70726719-70726741 GCTCACAGATAGAGCGAAGATGG - Intronic
1141709511 16:85689570-85689592 GCTGACAGATAGAGGGATGAGGG + Intronic
1141894530 16:86950358-86950380 GCACACAGACATAGGGGACATGG - Intergenic
1142108573 16:88319165-88319187 CCTCACAGACAGATGGAAGAGGG + Intergenic
1142244106 16:88961226-88961248 GTTCCCAGACAGGGGGCGCACGG + Intronic
1142683980 17:1566682-1566704 GAGGACGGACAGAGGGAGCAAGG - Intergenic
1143023379 17:3927981-3928003 GCTCAGAGAGGGAGGAAGCAGGG - Exonic
1143298441 17:5889238-5889260 GATCTAAGACAGAGAGAGCAAGG + Intronic
1143363155 17:6387755-6387777 GGCCACAGCCAGAGGGAGCCTGG + Intergenic
1143780596 17:9226833-9226855 GCTCAGATACAGGCGGAGCAAGG + Intronic
1143804239 17:9413237-9413259 GCTCACAGGCAGACTGACCAGGG + Intronic
1143999790 17:11042214-11042236 TCAAACAGACAGAGGGAGCAAGG - Intergenic
1144624417 17:16837547-16837569 GCAGAGAAACAGAGGGAGCAGGG + Intergenic
1144882010 17:18435173-18435195 GCAGAGAAACAGAGGGAGCAGGG - Intergenic
1145150223 17:20509213-20509235 GCAGAGAAACAGAGGGAGCAGGG + Intergenic
1145289571 17:21532749-21532771 GCTCAAAAAGAGAGGGAACAGGG - Exonic
1145900324 17:28486718-28486740 CATCACAGACATAGGCAGCAGGG + Intronic
1145956135 17:28856174-28856196 GCCCACCCACAAAGGGAGCAGGG - Intronic
1148789249 17:50164200-50164222 TCTCAGAGACAGAGGGAGGGAGG - Intronic
1148961776 17:51399317-51399339 GCTGACAGACACAGGCAGCCAGG - Intergenic
1150283089 17:63940685-63940707 GCACACAGAGTGAGGGAGGAGGG - Exonic
1150927694 17:69550931-69550953 GCTCACAGAGATAGGGAGATAGG + Intergenic
1151024402 17:70660232-70660254 GCTTAGGGACAGAGGGAGTATGG + Intergenic
1152023555 17:77794653-77794675 GGAGACAGGCAGAGGGAGCAAGG + Intergenic
1152240615 17:79159029-79159051 GCTCACAGACAGAGACACCAAGG + Intronic
1152449480 17:80367974-80367996 TCTCCCAGGCAGATGGAGCACGG - Exonic
1153555422 18:6307790-6307812 GTTCACAGGGAGAGGGAGAATGG + Intronic
1153917726 18:9760636-9760658 CCCGACAGACAGAGGGAGAAGGG - Intronic
1155182339 18:23358675-23358697 GCTGACACACAGTGGGTGCAGGG - Intronic
1155771859 18:29711899-29711921 GTACACAGACAGAGGCAGGAGGG + Intergenic
1156200340 18:34823820-34823842 GCTTACAGACAGAGGTAAGAAGG + Intronic
1156346411 18:36260790-36260812 GCTCAGAGACAGTGGCAGCATGG - Intronic
1160046573 18:75392185-75392207 TCTCAGAGAAAGAGGGAGGAAGG + Intergenic
1160623085 18:80184442-80184464 TCTCAGCCACAGAGGGAGCAAGG + Intronic
1160856275 19:1219263-1219285 ACTCACAGGCCCAGGGAGCACGG - Intronic
1161541211 19:4852425-4852447 GCCCACATACAGAGGGAAGACGG - Intronic
1162362515 19:10228570-10228592 CCTCCCAGAAAGAGGAAGCAGGG + Intronic
1163175603 19:15562366-15562388 GCTCACAGTCAGAGCAAGGACGG + Intergenic
1163254905 19:16149890-16149912 GCTCACAGTCTGAGGTAGAAAGG - Intronic
1163382180 19:16976398-16976420 GCCCAGAGACAGAGGTTGCAGGG + Intronic
1163477103 19:17532845-17532867 GCTCAGGGACTGAGGGAGGAAGG + Intronic
1164481003 19:28610909-28610931 GCTCTCTGACACTGGGAGCAAGG - Intergenic
1165450210 19:35878060-35878082 GCTGGCAGCCAGAGGAAGCAAGG - Exonic
1165593563 19:36991726-36991748 GCTCAAAAACAAAGGGAACAAGG - Intronic
1165843849 19:38805610-38805632 GGGCCCAGACAGAGGGATCAGGG - Intronic
1166137785 19:40787639-40787661 GGGCACAGGCAGAGGGATCAGGG + Intronic
1168161362 19:54512503-54512525 ACACACACACAGAGAGAGCAGGG - Intergenic
1168287484 19:55341901-55341923 GCTCTCTGCCAGAGGCAGCATGG + Exonic
1168312205 19:55465996-55466018 GCTGGCAGGCAGAGGGACCAAGG - Intergenic
1168413857 19:56156789-56156811 GCACACAGAAGGGGGGAGCATGG - Intronic
925790048 2:7475457-7475479 ACACACACACAGAGGGAGGATGG + Intergenic
927474021 2:23398420-23398442 ATTCACAGACAGAGGTAGAATGG + Intronic
929094921 2:38254375-38254397 GCTGACAATCAGAGTGAGCAAGG + Intergenic
929542895 2:42835989-42836011 GATGACACACAGAGGGAGAAAGG - Intergenic
929872409 2:45770298-45770320 GTTTCCAGACAGAGGAAGCATGG - Intronic
929878095 2:45813711-45813733 GAACACAGACAGACCGAGCAGGG + Intronic
930174172 2:48284724-48284746 GCACATAGAAAGAGGGAGGAGGG - Intergenic
930311602 2:49748578-49748600 GGCCACAGCCTGAGGGAGCAAGG - Intergenic
930570321 2:53077839-53077861 GCTCAGGCACAGTGGGAGCAAGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932515840 2:72348158-72348180 GCTCACAGGTAGAAGGAGTAAGG + Intronic
933766998 2:85716460-85716482 GCTCAGAGCCAGAGAGAGCAGGG + Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
936776251 2:115976931-115976953 ACTCCCAGACAGAGGGACAAGGG + Intergenic
937211854 2:120278832-120278854 GCACAGAAACAGCGGGAGCAGGG - Intronic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
937752734 2:125497474-125497496 GTACAGAGACAGAGGGAGGAGGG - Intergenic
940185387 2:150978927-150978949 GCTAACAAACAGAGGAAGCAGGG + Intergenic
940421160 2:153479942-153479964 GCTGAAAGAAAGAGGGAGGAAGG - Intergenic
940639564 2:156332599-156332621 CCTCACGGAGGGAGGGAGCAGGG + Exonic
941284952 2:163599495-163599517 GCTCACTGAGAGAAGGACCAAGG + Intronic
942509106 2:176677024-176677046 GTTCAGAGACAGAGGGAGCGGGG + Intergenic
943427107 2:187750440-187750462 GCTCACAGACATTAAGAGCATGG + Intergenic
943880585 2:193139902-193139924 GCTCACAGGCAGAAGGGGCTTGG - Intergenic
944457855 2:199914153-199914175 GAACACAGACAGAGGAAACATGG - Intronic
946183719 2:217964963-217964985 ACCCCCAGAGAGAGGGAGCAGGG + Intronic
947133845 2:226956796-226956818 ACACAGAGACAGAGGGATCATGG + Intronic
947565327 2:231189776-231189798 GCTCACAGAGGGAGGGAGGGAGG + Intergenic
947824878 2:233098811-233098833 TCTCACAGACAGTGGCACCAGGG + Intronic
948399321 2:237671658-237671680 GGACACAGACACGGGGAGCAGGG - Intronic
948892551 2:240914575-240914597 GCTCCCAGCCAGAGGGTGGAGGG - Intergenic
1168956259 20:1836536-1836558 GCTCAAAGGAAGAGGGAGCGGGG - Intergenic
1169001640 20:2172228-2172250 GGTTCCAGGCAGAGGGAGCAGGG - Intronic
1169949943 20:11032787-11032809 ACTCACAGAGAGAGGGCGCTAGG + Intergenic
1169990249 20:11495270-11495292 GGTGAGAGACAGAGGGAGGAAGG + Intergenic
1170421920 20:16201482-16201504 GCACAGAGACAGAGGGAGAGGGG - Intergenic
1171337217 20:24395321-24395343 CCTCACAGACAGAGAAAGCAAGG + Intergenic
1172619135 20:36307782-36307804 GCTCAGAGGCAGAGAGAGCCAGG - Intronic
1172844672 20:37922751-37922773 GCTCAGAGATGGAGGGAGCTGGG + Intronic
1173337440 20:42124294-42124316 GCTCACAGACAGATGGAGGCAGG - Intronic
1174796619 20:53527830-53527852 GTCCACAGACTGAGGGAGGAGGG + Intergenic
1175015385 20:55784568-55784590 GTTCACAGACAGAGAGAGAGTGG - Intergenic
1175822542 20:61918175-61918197 GTCCAGAGACAGAGGGACCAAGG + Intronic
1176033620 20:63025800-63025822 GCTCAGAGACAGGAGGAGCCTGG - Intergenic
1178121388 21:29473719-29473741 GCTCACAGACAGAGGGAGCAGGG - Intronic
1178493902 21:33071125-33071147 TCTCCCAGACGCAGGGAGCAGGG - Exonic
1178494603 21:33076124-33076146 GCTGACAGACAAGGGCAGCAGGG + Intergenic
1178507214 21:33171752-33171774 GCACACAGGCAGAGGGAGAGGGG + Intergenic
1179004895 21:37504860-37504882 GCTCCCAGCCAGGGTGAGCAGGG + Intronic
1179434671 21:41352000-41352022 TGTCACACACACAGGGAGCAAGG - Intronic
1180160949 21:45998445-45998467 GCCCACAGCCAGATGGAGGAGGG - Intronic
1180631474 22:17233094-17233116 GCGCTGAGACAGAGGGAGGAAGG + Intergenic
1181047594 22:20222969-20222991 GATCCCAGACAGAGGGAGAGAGG + Intergenic
1181556594 22:23674997-23675019 GACCCCAGACAGTGGGAGCAGGG + Intergenic
1182749973 22:32633589-32633611 CCTCCGAGGCAGAGGGAGCAAGG + Intronic
1182925598 22:34121141-34121163 GCTCACACTCAGAGGGAGTGTGG - Intergenic
1183705409 22:39472469-39472491 TCCCACACAGAGAGGGAGCAAGG + Intronic
1183725498 22:39586962-39586984 GCCCACAGACAGTGGGACCCTGG + Intronic
1184558726 22:45248693-45248715 TCTCATTGACAGATGGAGCAGGG - Intergenic
1184915321 22:47564886-47564908 GCACCCAGACACAGGAAGCAGGG + Intergenic
1185058040 22:48591483-48591505 GAGCACAGACAGAGGCAGCTGGG + Intronic
1185163914 22:49246073-49246095 GTTCAGAGACAGAGAGAGGATGG + Intergenic
950464959 3:13148267-13148289 CCTCACAGAGGGAGGGAGGAGGG + Intergenic
950637253 3:14323817-14323839 ACTCACAGACTGATGGAGGATGG + Intergenic
950715205 3:14842895-14842917 CCGCACAGACAGAGGGGCCAGGG - Intronic
950737845 3:15025044-15025066 GCCCAAAGACAGAAGGTGCAAGG - Intronic
952836792 3:37609650-37609672 GCTCACAGACATTGTGGGCAAGG + Intronic
954449868 3:50566050-50566072 ACCCACAGACAGAGGATGCAGGG - Exonic
954751092 3:52814099-52814121 GGTCAGAGACAGAGGAAGCCTGG + Intronic
961380431 3:126493051-126493073 GCAGACAGACAGAGGGCCCAAGG - Intronic
961534930 3:127564545-127564567 GCACAAAGCCAGAGGGAGCCTGG + Intergenic
962967874 3:140371143-140371165 GCTAACAGATAAAGGGAGCCAGG + Intronic
963119622 3:141765009-141765031 GATCACAGACAGAAGGGGCAAGG - Intergenic
963834917 3:150048388-150048410 GTTCACACACAGAGGCAGCAAGG - Intronic
964195798 3:154062873-154062895 GCGCAGAGACAGAGGGAGGGAGG - Intergenic
964230399 3:154460209-154460231 GGTGACAGACACAGGGAGAAAGG - Intergenic
964253632 3:154749758-154749780 GATAACAGCCAGTGGGAGCAAGG + Intergenic
966223104 3:177569986-177570008 ACACACAGACAGAGGGAAGATGG - Intergenic
966687943 3:182716215-182716237 GCTCCCACACAGAAGGAGCTGGG - Intergenic
966910387 3:184556312-184556334 GATCACAGTCACAGGGAGAAAGG - Intronic
966944196 3:184766175-184766197 GGTAACAGACAGAGCTAGCAAGG - Intergenic
967276808 3:187784263-187784285 TGTCCCAGACAGAGGGAACATGG + Intergenic
968254942 3:197261196-197261218 GCTAACAGACACAGGGGACATGG + Intronic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969155387 4:5205462-5205484 GCACACAGAGACAGGGAGGAGGG + Intronic
969502994 4:7565073-7565095 GCTCAGAGGGAGGGGGAGCAAGG + Intronic
969676197 4:8615669-8615691 GCTCGCAGACATTGGGAGCCTGG - Intronic
969734168 4:8975852-8975874 GCTCTCTGACAGCGGGAGCAAGG - Intergenic
969789016 4:9479150-9479172 GCTCTCTGATAGCGGGAGCAAGG - Intergenic
969884685 4:10204878-10204900 GCTCACTGACAGTGGGAGTATGG + Intergenic
970213779 4:13737679-13737701 GGTCAGAGACGGAGGGAGCCAGG + Intergenic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
971324265 4:25631306-25631328 ACTCAAAGAAAGAAGGAGCATGG + Intergenic
971336397 4:25727609-25727631 GATCACAGACAAAGGCAGCCAGG - Intergenic
971373547 4:26037815-26037837 GCACACAGATAGCAGGAGCATGG - Intergenic
972783222 4:42303854-42303876 GCTCACAGAGAGAGGGGAAAAGG - Intergenic
973215747 4:47667373-47667395 GCAAACAGAGAGAGGGAGCTGGG - Intronic
977156651 4:93582267-93582289 GGTCAGAGACAGAGGGAGATTGG - Intronic
977697465 4:99982132-99982154 GCCCCCACACAGAGGGAGCCTGG - Intergenic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
978198827 4:106001073-106001095 GTTCTAAGACAGAGGAAGCATGG + Intronic
978312212 4:107396948-107396970 TCTCTCAGACAGAGGTAGAAAGG - Intergenic
978758338 4:112328200-112328222 GCCCACAGACAGAAGGAACCTGG - Intronic
979619433 4:122782609-122782631 GCCTACAGACACAGGGAGTATGG + Intergenic
980881223 4:138711859-138711881 CCTTAAAGACAAAGGGAGCATGG - Intergenic
980964396 4:139506849-139506871 AGTCACAGACAGAGGAAGCAAGG + Exonic
981310919 4:143297411-143297433 GCCCACAGACAGAAGGGCCAGGG - Intergenic
981980383 4:150784674-150784696 GTACAGAGACAGAGGGAGCGGGG - Intronic
983721907 4:170865689-170865711 CCTCAGAAACACAGGGAGCAAGG - Intergenic
984472473 4:180194056-180194078 GCTCACAGCCAGATGGTGCCTGG + Intergenic
985781274 5:1873152-1873174 TCGCAAAGACAGAAGGAGCAAGG + Intergenic
986008127 5:3684939-3684961 CCCCAGAGACAGAGGGACCAGGG - Intergenic
986615922 5:9617415-9617437 TCTCACACACACAGGGAGGAAGG + Intergenic
986643543 5:9894431-9894453 ACACACAAACAGAGGCAGCAGGG + Intergenic
987033157 5:13994215-13994237 GGTCAAAGGCAGAGTGAGCATGG - Intergenic
987841319 5:23225792-23225814 GCACAAAGACAGAGGGAGGGGGG - Intergenic
988441746 5:31241623-31241645 GCTGTAAGACAGATGGAGCAGGG - Intronic
990553160 5:56904343-56904365 ACATACAGAGAGAGGGAGCAAGG + Intergenic
990759728 5:59115054-59115076 GGTCAAAGAAAGAGGGAGAAGGG + Intronic
994315368 5:98326884-98326906 ACTCAAAGACAGAGGGTGGAAGG - Intergenic
995714890 5:115072661-115072683 ACTCCCATACAGAGGGAGGAGGG + Intergenic
995738568 5:115329789-115329811 GTACAGAGACAGAGGGAGCGGGG - Intergenic
997105120 5:131009233-131009255 GTTCAGAGACAGAGAGGGCAGGG + Intergenic
997468621 5:134104305-134104327 GCTCACACTCAGTGGGTGCAGGG + Intergenic
997789864 5:136749183-136749205 TCTCACAGTGAGAGAGAGCATGG - Intergenic
998159441 5:139804846-139804868 GCACACACACAGAGGGAACTGGG - Intronic
998229964 5:140354838-140354860 GCTCACAGGCTCAGGGACCATGG + Intergenic
998251553 5:140557107-140557129 GCTCGGAGACAGACGGAGAATGG - Intronic
998463887 5:142327755-142327777 CATCTCAGGCAGAGGGAGCATGG + Intergenic
999731621 5:154479791-154479813 GTCCAAAGACAGAGGGAGAAAGG + Intergenic
1000732492 5:164853630-164853652 GCTTACAGAGAGAGGGAGAAGGG + Intergenic
1000858352 5:166428151-166428173 GCTCAAAGTGAGAGGGAGCTGGG + Intergenic
1000930485 5:167245266-167245288 CCTCCCAGACAAAGGGTGCACGG + Intergenic
1002086712 5:176780488-176780510 GCTCAGAGCCAGAGAGAGAAGGG - Intergenic
1002698340 5:181104922-181104944 GGTGGCAGACAGAGTGAGCAGGG + Intergenic
1002708558 5:181179986-181180008 GGTGGCAGACAGAGTGAGCAGGG - Intergenic
1002829833 6:809677-809699 GCTCACAGGCAGAGGAAGTGTGG - Intergenic
1003959747 6:11198026-11198048 GCTCACGGACCGAGCAAGCAGGG + Intronic
1004010564 6:11681998-11682020 GTTAGCAGGCAGAGGGAGCAGGG + Intergenic
1006806590 6:36793214-36793236 GCTCTCAAACAGAGGAGGCAGGG + Intronic
1007554816 6:42756937-42756959 GCTCAAAGAGAGAGGGAGAGAGG - Intronic
1007658827 6:43469632-43469654 GCTCAGGGAAAGAGGGAGCTGGG + Intergenic
1009380259 6:63019194-63019216 ACTCAAAGAGAGAGGGAGAAAGG + Intergenic
1010317929 6:74471848-74471870 GCTCTCTGACACTGGGAGCAAGG - Intergenic
1013906052 6:115221298-115221320 TCCCACAGAGAGAGGGAGAAAGG + Intergenic
1015973507 6:138766676-138766698 GGTCAGAGGCAGAGGGAGAAAGG - Intronic
1016379277 6:143457635-143457657 GGTCACAGACAGTGGGAGGTAGG + Intronic
1016860772 6:148716601-148716623 ACTCATATAGAGAGGGAGCAGGG - Intergenic
1017600644 6:156077101-156077123 GCTCGCAGACAGAAGGAGCAGGG + Intergenic
1017691673 6:156972021-156972043 GCCTACACACAGAGTGAGCATGG + Intronic
1018190871 6:161308143-161308165 GTTCAGAGACAGAGGGAGGTGGG + Intergenic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1018988992 6:168659333-168659355 GCCAAGAGACAGAGGGAGCAAGG + Intronic
1019705292 7:2494547-2494569 GCTCACATCCAGAGGGGGAAGGG + Intergenic
1020307075 7:6843581-6843603 GCTCTCTGATAGCGGGAGCAAGG + Intergenic
1023088102 7:36592499-36592521 GCTCTCACACAGAGGGACAATGG + Intronic
1024030779 7:45457852-45457874 GTTCACAGAAGGAGAGAGCAAGG + Intergenic
1024628035 7:51225161-51225183 ACTCACAGGCAGAGGAAGCCAGG - Intronic
1025022463 7:55490316-55490338 TCTCCCAGACAGATGGAGCGGGG + Intronic
1025250957 7:57351070-57351092 GCTCACACATGGAGGCAGCATGG + Intergenic
1025851440 7:65247822-65247844 GCTTTCAGAAAGAGGGAGCTGGG + Intergenic
1026953888 7:74364725-74364747 GCTCAGAGACCAAGGGAGCTGGG + Intronic
1027201403 7:76066075-76066097 GCTCAGAGCCAGAGGGTGCCAGG - Intronic
1029078226 7:97952525-97952547 GCTCTCTGATAGCGGGAGCAAGG + Intergenic
1029152614 7:98491655-98491677 ACACCCAGACAGATGGAGCAGGG - Intergenic
1029404557 7:100366784-100366806 GCTCAGCGATAGAGGGAGCCAGG + Intronic
1029428044 7:100509625-100509647 GCTCTGAGAGAGAGAGAGCAAGG + Intergenic
1030673873 7:112365072-112365094 GCTGCCAGCCTGAGGGAGCATGG - Intergenic
1031074453 7:117199334-117199356 GCACCAAGACAGAGGGTGCAGGG - Intronic
1032968262 7:137128543-137128565 GATTAAAGACAGAGTGAGCATGG + Intergenic
1033519362 7:142145411-142145433 GATCAGAGAGAGAGGGAGGAAGG - Intronic
1033599667 7:142879901-142879923 GGGCACAGACATAGGGAGAATGG - Intronic
1034718683 7:153267458-153267480 GCTCCCAGACATGGGGACCAGGG - Intergenic
1035354778 7:158270505-158270527 GGTCATAGGCAGAGGGAGCCAGG - Intronic
1036130821 8:6108226-6108248 GATCACAGACAGAAGGAGCCTGG + Intergenic
1036410864 8:8499163-8499185 GCTCACAGCCAGGGGGAGCATGG + Intergenic
1036816663 8:11907639-11907661 GCTCTCTGACACGGGGAGCAAGG + Intergenic
1037007740 8:13803522-13803544 GCACACAGAGAGAGGGAGAGAGG - Intergenic
1037730916 8:21523525-21523547 GCCCACAGAGAGAGAGAGAAAGG - Intergenic
1038699100 8:29832986-29833008 GCAGACAGACAAAGGGAGCAGGG - Intergenic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1041125675 8:54636016-54636038 GCCAACAGAAAGAGGCAGCAGGG - Intergenic
1041465976 8:58157960-58157982 GCTCACAGCCATAAGGAGCCCGG + Intronic
1044764734 8:95559487-95559509 GCTCAGAGAAAGAGGAAGAAAGG - Intergenic
1046198802 8:110894666-110894688 GCAGACAGACAGGGGGAGCCAGG - Intergenic
1046826833 8:118701078-118701100 GGTCACACACAGAGGTAGGATGG - Intergenic
1048392534 8:133981396-133981418 ACTCACAGACAGAGGAACAAAGG + Intergenic
1048775658 8:137943469-137943491 GCTCACAGAATAAGAGAGCAGGG - Intergenic
1048957415 8:139548485-139548507 GCTCTCTGATACAGGGAGCAAGG + Intergenic
1049465329 8:142748801-142748823 CCTCACAGAGACTGGGAGCAAGG - Intergenic
1049594483 8:143477117-143477139 GCTTGCAGGCAGAGGGACCAAGG - Intronic
1049785787 8:144450089-144450111 GCTCAGAGACGGTGGCAGCAAGG - Exonic
1049813817 8:144588699-144588721 ACTCACAGCCGGAGGCAGCACGG + Intronic
1050193914 9:3059971-3059993 GCTTGAAGACAGAGGGAACAAGG + Intergenic
1050735724 9:8760579-8760601 ACAGACAGAGAGAGGGAGCAAGG - Intronic
1051748465 9:20317730-20317752 CCTGACACACAGAGAGAGCAAGG + Intergenic
1051993575 9:23184689-23184711 GATCAGAGACAGAGGGAGGGGGG - Intergenic
1056317031 9:85400092-85400114 TCTCACAAACAAAGGCAGCAGGG + Intergenic
1056332802 9:85535708-85535730 GCTATCAGACAGAGGGAGATGGG + Intergenic
1057309542 9:93933474-93933496 GCTCACACCCAGAGGGAGCCTGG + Intergenic
1058105597 9:100967571-100967593 GTCCACTGGCAGAGGGAGCAGGG + Intergenic
1059122931 9:111658875-111658897 TATCACAGAAAGTGGGAGCAGGG - Intronic
1059303627 9:113336055-113336077 GTTTACAGATAGAGGGTGCAGGG + Intronic
1060116387 9:120944675-120944697 ACTGACAGACAGAGAGAGAAAGG - Intergenic
1060401622 9:123353071-123353093 ACTCAGACACAGAGGGAGCAGGG + Intergenic
1060521898 9:124298709-124298731 GATCACAGACAAAAGGAGCCAGG - Intronic
1061326425 9:129867462-129867484 GCACAGGGACTGAGGGAGCAGGG + Intronic
1061371494 9:130200178-130200200 GCTCACACAGGCAGGGAGCAAGG + Intronic
1062127117 9:134869879-134869901 GCTTGCAGACAGTGGGAGCTCGG - Intergenic
1062721611 9:138047147-138047169 GCACACAGACAGAGGAAGGAGGG - Intronic
1203776279 EBV:74982-75004 GCTTACAGCCAGAGAGATCATGG - Intergenic
1186096778 X:6110886-6110908 GCACACAGACAGAGGACTCAAGG + Intronic
1188735389 X:33707473-33707495 TGTGGCAGACAGAGGGAGCAAGG - Intergenic
1189351833 X:40281328-40281350 GCTGCCAGACAGAGGGAGGGAGG - Intergenic
1190244680 X:48683536-48683558 GCTGCCAGCCAGAGGGAGGAGGG + Intronic
1192138992 X:68631515-68631537 GCTCAGAGCCAGAGGGAGATGGG + Intergenic
1194147128 X:90278726-90278748 CCTCACAGACAGAGGGTACAAGG - Intergenic
1196568057 X:117231500-117231522 GCTATCACACAGTGGGAGCAGGG - Intergenic
1196733293 X:118963004-118963026 GTTGACTGACAGAGGGAGTAGGG - Intergenic
1197662376 X:129188174-129188196 GTACACAGACAGAGGGAGGGGGG + Intergenic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1198861255 X:141072979-141073001 GCATACAGACAAAGGGATCAAGG + Intergenic
1198901437 X:141514400-141514422 GCATACAGACAAAGGGATCAAGG - Intergenic
1200493531 Y:3855494-3855516 CCTCACAGACAGAGGGTACAAGG - Intergenic