ID: 1178122359

View in Genome Browser
Species Human (GRCh38)
Location 21:29482155-29482177
Sequence CTGTATGTATAAAAGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178122352_1178122359 28 Left 1178122352 21:29482104-29482126 CCTGCCCTGGCCTGGTTTCTGAG 0: 1
1: 0
2: 4
3: 54
4: 431
Right 1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1178122355_1178122359 18 Left 1178122355 21:29482114-29482136 CCTGGTTTCTGAGATGACTCTTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1178122353_1178122359 24 Left 1178122353 21:29482108-29482130 CCCTGGCCTGGTTTCTGAGATGA 0: 1
1: 0
2: 3
3: 22
4: 204
Right 1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1178122354_1178122359 23 Left 1178122354 21:29482109-29482131 CCTGGCCTGGTTTCTGAGATGAC 0: 1
1: 0
2: 1
3: 13
4: 201
Right 1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178122359 Original CRISPR CTGTATGTATAAAAGGAGCT TGG Intronic
902598375 1:17524590-17524612 GTGTATGTATAAAATGACCTTGG + Intergenic
903832933 1:26185338-26185360 ATATATGTATAAAAGCAGTTTGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904863230 1:33556356-33556378 CTGTAGGTCTAACAGGAGCCTGG - Intronic
905131888 1:35767413-35767435 CTGTATGAATAAAACAAGATTGG + Intronic
905859919 1:41343368-41343390 CTGCCTTAATAAAAGGAGCTGGG + Intergenic
910999119 1:93144157-93144179 CTCTATGGTTAAAAGTAGCTTGG + Intergenic
911013012 1:93301613-93301635 GTGTGTGTATAAAAGGAGCCAGG + Intergenic
911160269 1:94676877-94676899 CTGAAGATATAAAAGGAGCTTGG - Intergenic
915418429 1:155760332-155760354 CTGTGTGTCTGGAAGGAGCTGGG + Intronic
915998760 1:160593631-160593653 CTGGCTGCATAAAATGAGCTGGG + Intergenic
916372146 1:164110073-164110095 CATTTTTTATAAAAGGAGCTAGG - Intergenic
916871073 1:168915386-168915408 CTGTATATATAAGGGGAGCTTGG - Intergenic
918904966 1:190479226-190479248 CTGTATGTAAATCACGAGCTGGG + Intergenic
919599958 1:199610417-199610439 CTGAGTGAATAAAAGGAGGTAGG - Intergenic
919947736 1:202333327-202333349 CTGTTTGTATATAGGGTGCTTGG - Exonic
920836823 1:209518853-209518875 CTGAAAGTATAGAAGCAGCTTGG + Intergenic
921374358 1:214458851-214458873 ATGGATGTGTAAATGGAGCTGGG - Intronic
921576088 1:216836595-216836617 CTCTGTGTGTACAAGGAGCTTGG + Intronic
922348071 1:224713658-224713680 CTATATGTATATAAGCTGCTTGG - Intronic
1064550819 10:16499182-16499204 CTGTAAGGATTAAATGAGCTGGG + Intronic
1066078240 10:31902783-31902805 CTGTATGTGTCAAATGGGCTGGG + Intronic
1066651853 10:37663958-37663980 CTGAATGTATAAAAGTAAATTGG + Intergenic
1067035612 10:42914257-42914279 CTGAATGTATAAAAGTAAGTTGG + Intergenic
1068832527 10:61513063-61513085 CTGTATGGAAAACAGGATCTTGG - Intergenic
1073028915 10:100509103-100509125 CTGTATGAATAAAAAGTGTTTGG + Intronic
1074540220 10:114358980-114359002 CTGTATGTATATACGAATCTAGG - Intronic
1074561254 10:114537388-114537410 CTGTATATTTCAAAGTAGCTGGG - Intronic
1074617375 10:115082961-115082983 CTGCATGTTTAAAAGAAGATCGG + Intergenic
1075225088 10:120621525-120621547 CTGTATTTAGAAGAGGAGATGGG - Intergenic
1078224646 11:9380920-9380942 CTGTATCCAAAAAAGGAGCTTGG - Intergenic
1081704654 11:45174381-45174403 CTGTGTGTATACAAAGAACTAGG + Intronic
1087282436 11:96226648-96226670 CTTTATATATAATATGAGCTAGG - Intronic
1089911531 11:122105565-122105587 CTGTGGGTTTGAAAGGAGCTGGG - Intergenic
1090181041 11:124699696-124699718 CTGCATATAAAAAAGGCGCTAGG - Intergenic
1090358228 11:126154978-126155000 CTGCATGTATGAGAGGCGCTGGG - Intergenic
1090369480 11:126238356-126238378 CTGTGTGTACATAAGGGGCTTGG + Intronic
1090558394 11:127901507-127901529 CTCTATATGTCAAAGGAGCTAGG + Intergenic
1091932169 12:4404713-4404735 ATATATATATAAAATGAGCTGGG + Intergenic
1093435877 12:19134012-19134034 CTGTTTTTATAAGATGAGCTAGG - Intronic
1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG + Intergenic
1100708658 12:97229485-97229507 CTGTATGTATAATGTGATCTGGG - Intergenic
1102529776 12:113537772-113537794 CTGGATGTTTAAAGGAAGCTGGG - Intergenic
1104701877 12:130911116-130911138 CTGTAGATATAAAAGGAGCGGGG + Intergenic
1105340788 13:19523387-19523409 CTTTATTCATAAAAGCAGCTAGG - Intronic
1105382629 13:19901778-19901800 CTTTTTTTAAAAAAGGAGCTGGG + Intergenic
1106451352 13:29885662-29885684 ATGTATGTATAAGAGAAGGTAGG + Intergenic
1107222720 13:38004845-38004867 ATATATATATAAAAGTAGCTGGG + Intergenic
1109550609 13:63893951-63893973 TTGTATATTTAAAAGTAGCTAGG + Intergenic
1110309245 13:74028216-74028238 CTGTAAGTATAAAAAGTGCATGG + Intronic
1112973446 13:105288078-105288100 CTGTATCTATAAAAGGAATATGG - Intergenic
1114829774 14:26126747-26126769 CTGTATGTAAACAAAGAGCCTGG + Intergenic
1115955691 14:38776710-38776732 ATGTATGTATAATAAGGGCTAGG + Intergenic
1120622837 14:86786920-86786942 ATATATGTATAAAAGGAAATAGG + Intergenic
1123674432 15:22695052-22695074 CACTCTGTATAAAAGGTGCTGGG - Intergenic
1124326444 15:28768040-28768062 CACTCTGTATAAAAGGTGCTGGG - Intergenic
1126245357 15:46498669-46498691 CTGTTTGTATAAAAGATGTTAGG - Intergenic
1127237875 15:57075392-57075414 CTTCATGAATGAAAGGAGCTGGG - Intronic
1127323519 15:57870960-57870982 CTGGATGTATAGAATGAACTGGG - Intergenic
1128103285 15:65023727-65023749 CTGTATGGATTACAGGGGCTGGG + Exonic
1131998046 15:98151833-98151855 GTGTGTGTATAAATGAAGCTGGG + Intergenic
1134178012 16:12024297-12024319 ATATATATATAAAATGAGCTGGG - Intronic
1134770882 16:16808495-16808517 CTGTGTGTCTAAAAGGAGAGGGG + Intergenic
1135851147 16:25965116-25965138 TTCTATGAAGAAAAGGAGCTCGG + Intronic
1138950944 16:61912155-61912177 CCGTATTTATAAAAGGAGTATGG + Intronic
1139048578 16:63095042-63095064 TTGTATGTCTAAAAGGAGCATGG - Intergenic
1139073101 16:63408027-63408049 TTTCATGTTTAAAAGGAGCTAGG - Intergenic
1139765652 16:69227071-69227093 CTGTTTGAATAAAAGGCCCTTGG - Intronic
1140671955 16:77287963-77287985 CTGGAGGTATATAAGGTGCTTGG + Intronic
1143313595 17:6014054-6014076 CTTTAGGAATAAAAGGAGCAAGG + Intronic
1146975368 17:37106880-37106902 TTGTATTTATAAAAGCACCTGGG - Intronic
1149811529 17:59678634-59678656 CTGAAGGTACAAAATGAGCTTGG - Intronic
1150293701 17:63996886-63996908 CTGACTGTAGAAGAGGAGCTGGG - Intergenic
1150438666 17:65173840-65173862 ATGGATGAATGAAAGGAGCTTGG + Intronic
1154475540 18:14752358-14752380 CTGTTTGAATACAAAGAGCTTGG - Intronic
1158133472 18:54179348-54179370 CTGGCTTTATAAAATGAGCTTGG - Intronic
1158451074 18:57565876-57565898 CTGTATATTTAACTGGAGCTGGG - Intronic
1159895545 18:73992275-73992297 CTGTCTGTATGTAAGTAGCTAGG - Intergenic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
926444630 2:12927200-12927222 GTGTATTTATAAAAGCAGGTAGG - Intergenic
928844934 2:35659953-35659975 CTCTTTGTATAAAAGTAACTGGG - Intergenic
928975017 2:37077467-37077489 CTGAATATACAAAATGAGCTGGG - Intronic
929908228 2:46065110-46065132 CTGTTTGCAGAAAAGAAGCTTGG - Intronic
931351395 2:61491959-61491981 CTGTATGTATCAATGGAAATAGG - Intronic
933743516 2:85553339-85553361 CTGTGTGTATAAGAGGAGCCGGG - Exonic
936784522 2:116078011-116078033 CAGTTTGTATAACAGGAGCCAGG + Intergenic
938415572 2:131101103-131101125 TTATATGTATAAAAGTAGCCAGG - Intergenic
939857561 2:147378309-147378331 ATATATGTAAAATAGGAGCTGGG + Intergenic
941356125 2:164494605-164494627 GTGTATGCATAAATGTAGCTGGG + Intronic
941751366 2:169138220-169138242 TTATATGTATAAAAGGAGTAGGG - Intronic
942033769 2:171990550-171990572 ATGTATATATAAAATTAGCTGGG - Intronic
942262169 2:174178111-174178133 CTTTAGGTATAAAAAGAGTTTGG - Intronic
942385002 2:175433173-175433195 TTGTATTTAAAAAAGAAGCTTGG + Intergenic
942508056 2:176664902-176664924 CTGTGTCTATAAAAGGAGCTTGG + Intergenic
945217305 2:207447267-207447289 CTGTAACTACAAAAGGAGCAGGG - Intergenic
946389751 2:219408434-219408456 CTGTGTCTGTAAAAGGAGCGTGG + Intergenic
1169506254 20:6214323-6214345 CTTTTTGTACAAAAGCAGCTCGG + Intergenic
1169779254 20:9291958-9291980 ATCTATTTATAAAAGTAGCTTGG + Intronic
1170415511 20:16134636-16134658 CTGCATGTTGAACAGGAGCTAGG - Intergenic
1170528334 20:17263643-17263665 ATGTATGTAAAAGAGGTGCTAGG - Intronic
1170910444 20:20561403-20561425 CTGTATGTATGAAAGGAGGCAGG - Intronic
1173417345 20:42868817-42868839 CTGTATGAAAAAAGGGATCTTGG + Intronic
1177778963 21:25602554-25602576 CTGTATGTATATCAAGAACTAGG + Intronic
1177811872 21:25933440-25933462 CTGTATATTTAAAAATAGCTAGG - Intronic
1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG + Intronic
949839198 3:8301851-8301873 CTGTAAGTAGAAAAAGAGGTGGG + Intergenic
950941373 3:16896369-16896391 CTGAAAGCACAAAAGGAGCTGGG + Intronic
950986767 3:17379721-17379743 GTGTATGTATAAAAACAGCATGG - Intronic
954603289 3:51889159-51889181 CTGTATGGAGAAAAGGAACTTGG - Intergenic
954777266 3:53031105-53031127 CTGTATCTATATGAGGAGTTGGG - Intronic
955641385 3:61089199-61089221 CAGTATGTATATATTGAGCTGGG - Intronic
955718036 3:61851414-61851436 CTGTATTCCTAAAAGCAGCTCGG - Intronic
959562847 3:107802234-107802256 CTGGATGTCAAAAAGGAGCATGG - Intronic
960133313 3:114080621-114080643 CTGGAGGTAGAAAAGGAGCTAGG + Intronic
961015235 3:123463238-123463260 CTGTAGGGATAAAAGCAGATTGG + Intergenic
961240504 3:125406737-125406759 CTGTCTGTAAAAAATTAGCTGGG - Intergenic
963490114 3:145989093-145989115 CTGGTTGTATAAAAGAAGCCTGG + Intergenic
966029330 3:175325687-175325709 CTGTATTTATGAAATGACCTGGG - Intronic
967637452 3:191819941-191819963 CTGTCTGAATAATAGGAGGTGGG - Intergenic
967708260 3:192677432-192677454 GTGTATGTATAAAACGCTCTGGG - Intronic
969095903 4:4732543-4732565 CTGTATGTAGGAAAGATGCTTGG - Intergenic
969242842 4:5912427-5912449 CTTTATGAAGAAAAGGAGCTGGG + Intronic
971387517 4:26154829-26154851 CTGGTTGTTTAAAAGGAGCCTGG - Intergenic
972392406 4:38626282-38626304 CTGTATATACAAAAGGCCCTGGG + Intergenic
972517952 4:39826873-39826895 ATGTATGTAGTAAAGGAGTTTGG - Intronic
972617431 4:40713271-40713293 CTGCATGTTTAAAGTGAGCTAGG - Intergenic
973594668 4:52474527-52474549 CTGTCTGTATAATATGAGTTAGG - Intergenic
973725750 4:53773997-53774019 CTGCTTGTTTAAAAGGAGCTTGG - Intronic
974456101 4:62130872-62130894 CTGTGTATATACAAGCAGCTGGG + Intergenic
974773735 4:66451627-66451649 CTGAAGGTACAAAAGCAGCTTGG + Intergenic
975793048 4:77975835-77975857 CTGGACTTATAAAATGAGCTGGG + Intergenic
976119531 4:81764199-81764221 ATGTATGTATAAAGAGAGCAGGG + Intronic
977274632 4:94961233-94961255 CTGTATATATAATAGGTGGTGGG - Intronic
977494637 4:97759597-97759619 ATGTATGTAGAAAAGAAGGTTGG + Intronic
978306869 4:107338546-107338568 TTGTATGTATAGTATGAGCTAGG - Intergenic
978852048 4:113350384-113350406 ATATATTTATAAAAGCAGCTTGG + Intronic
979153686 4:117354735-117354757 CTGATTGTATACAAGGAGCAGGG + Intergenic
979488725 4:121299443-121299465 CTTTATTTATAAAAGGACCCTGG + Intergenic
979876709 4:125900704-125900726 CTGTTTGTTTAAAAGGATCCTGG - Intergenic
980315896 4:131199881-131199903 CTGTCTCTATAAAAGGGTCTAGG - Intergenic
980658740 4:135827614-135827636 CTGTGTGTATAACATGAGCTTGG - Intergenic
980678874 4:136128689-136128711 CTGTTTGTTTAAAAAGAGCCTGG + Intergenic
981251247 4:142603852-142603874 CTGTTCTTATAAAATGAGCTAGG - Intronic
981650926 4:147057899-147057921 CAGTATTTTTAAAAGGATCTTGG - Intergenic
982786944 4:159547257-159547279 GTGTATGTATACAAGGAACATGG + Intergenic
987956798 5:24751017-24751039 CCGAATGTCTAAAAGAAGCTCGG - Intergenic
990180344 5:53153945-53153967 CTATAGGTATAAATGGAGGTAGG + Intergenic
992019896 5:72612195-72612217 CTGGACGTAGAAAAGGTGCTGGG - Intergenic
992258501 5:74946528-74946550 ATGTATGCATAAAATGAGCAGGG + Intergenic
992618819 5:78572330-78572352 ATGTATGTATTAAAAGAGTTAGG + Intronic
993550788 5:89271207-89271229 CTGTCTGTAGAAAATGAGCAGGG - Intergenic
996869910 5:128179153-128179175 CTGTAATTATAAAAGGGGGTGGG - Intronic
997804368 5:136900602-136900624 CTGTCTTCATAAAATGAGCTCGG + Intergenic
998065752 5:139156977-139156999 CTGTGTATAGAAAAGGAGCAAGG - Intronic
998402098 5:141853386-141853408 GTGTCTGTATATAAGGACCTTGG - Exonic
1000767210 5:165307136-165307158 TTGTATAGATAAAAGAAGCTTGG - Intergenic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1005384921 6:25276722-25276744 CTGTATGTTTCAAAAGAGATGGG + Intergenic
1006870613 6:37247770-37247792 CTGTAAGTGTTGAAGGAGCTTGG + Intronic
1007454683 6:41967457-41967479 CTTCATCTATAAAAGGAGCTGGG + Intronic
1008083016 6:47213678-47213700 CTGGCTGTATAAAATGAGTTAGG - Intergenic
1008526673 6:52413990-52414012 GTGTGTGTCTAAAAGGATCTGGG + Intergenic
1011138178 6:84122201-84122223 CTGTATTTATAGAATGAGTTTGG - Intergenic
1012252887 6:96998459-96998481 CTATATGTATTAAAGGACTTGGG - Intronic
1012410926 6:98956178-98956200 TTGTATGTTTCAAAGGAGATGGG - Intergenic
1013566569 6:111370388-111370410 CTGTGTGTTGAAAAGGGGCTGGG + Intronic
1014677529 6:124385472-124385494 CTTTATGTTTAAAAAGATCTAGG - Intronic
1014677757 6:124388568-124388590 TTGTATTTATAAAAGGAAGTAGG - Intronic
1016385321 6:143525294-143525316 CTTTATGTTTAAAAATAGCTAGG - Intergenic
1016386135 6:143532636-143532658 CAGTATGTATAACAGCAGCAAGG + Intergenic
1019891057 7:3946813-3946835 CTCTGTGTTTAAAGGGAGCTGGG + Intronic
1019990625 7:4688025-4688047 ATGTATTTAAAAAAGCAGCTGGG - Intronic
1020534762 7:9382780-9382802 CTGTTTGTTTAAAAGAAGCCTGG + Intergenic
1020534908 7:9384845-9384867 CTGGTTGTTTAAAAGGAGATTGG + Intergenic
1021955327 7:25818634-25818656 CTCTATGTTTAAAAGAAGTTGGG - Intergenic
1024603645 7:51008173-51008195 CTGTATCTGTAAGAGGAGCATGG + Intergenic
1024783898 7:52884274-52884296 ATGTATGTTTAAAAGGAACATGG + Intergenic
1027927872 7:84490443-84490465 CTGTATGGATAAAAGTAGACTGG - Intronic
1029357026 7:100059711-100059733 CTGTTTTTTTAAAAAGAGCTGGG - Intronic
1030646186 7:112064356-112064378 CTGTCTGCATCAAAGGACCTTGG + Intronic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1032749625 7:134825695-134825717 TTGTAAGTATAAAATGACCTTGG - Intronic
1033676753 7:143548474-143548496 CTGAGTTTATAAAATGAGCTGGG + Intergenic
1033695080 7:143780961-143780983 CTGAGTTTATAAAATGAGCTGGG - Intergenic
1034387046 7:150748709-150748731 CTGTATGTTAAATAGGTGCTGGG - Intronic
1036279771 8:7390878-7390900 CTGTGTGTGTAAATGGAGGTAGG - Intergenic
1036341748 8:7921005-7921027 CTGTGTGTGTAAATGGAGGTAGG + Intergenic
1036965893 8:13297977-13297999 TAGTATGTTTACAAGGAGCTTGG + Intronic
1037145734 8:15570466-15570488 CTGTGTGAATCAAAAGAGCTTGG + Intronic
1037385612 8:18337110-18337132 ATCTCTCTATAAAAGGAGCTTGG + Intergenic
1038358392 8:26852678-26852700 TTGCATCCATAAAAGGAGCTGGG + Intronic
1038598420 8:28912255-28912277 CTGTATTTCTAAAGGAAGCTGGG + Intronic
1040584150 8:48724379-48724401 CTGCATGTCAAAAAGAAGCTGGG - Exonic
1041837194 8:62229857-62229879 CTTTAAGTAAAAAATGAGCTAGG - Intergenic
1044488609 8:92784517-92784539 CTGTAACTATAAAAGTAACTTGG - Intergenic
1045164138 8:99583929-99583951 CTGTATTTAGGAAAGGAGATGGG + Intronic
1045440708 8:102207023-102207045 CTCTATGTATAAATGGTTCTCGG + Exonic
1047056809 8:121174145-121174167 CTGGAGGAATAAAAAGAGCTGGG + Intergenic
1047826443 8:128581597-128581619 TTGTTTGTAGAAAAGGGGCTGGG + Intergenic
1047993052 8:130306664-130306686 ATGTAAGGATGAAAGGAGCTAGG + Intronic
1050018208 9:1258209-1258231 TTGTATATTTCAAAGGAGCTAGG + Intergenic
1050023298 9:1307484-1307506 CTGTGTGCAAAAAAGGTGCTCGG + Intergenic
1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG + Intergenic
1050982644 9:12039477-12039499 CTGTCTTTATAAAATGAGTTAGG - Intergenic
1051846448 9:21456709-21456731 CTTTAGGTATAAATGGTGCTTGG + Intergenic
1051973287 9:22917455-22917477 TTTCATGTATAAAAGTAGCTTGG + Intergenic
1058116976 9:101095430-101095452 TTGCCTGTATAAATGGAGCTTGG + Intronic
1059826290 9:118032802-118032824 CTGTATGGATCCAAGGAACTGGG + Intergenic
1060935573 9:127513378-127513400 CTGTATCTTAAATAGGAGCTGGG + Intronic
1203441052 Un_GL000219v1:9040-9062 CAGTATGTAAAACAGCAGCTGGG - Intergenic
1185547676 X:958535-958557 GTGTAGGAATAAAAGCAGCTCGG + Intergenic
1186826455 X:13345065-13345087 CTTTCTGAATAAAAGGAGCCTGG - Intergenic
1187724760 X:22190896-22190918 CTGTATGTAAGAAAGAAGCTTGG + Intronic
1188249055 X:27869341-27869363 TTTTAAGTATAAAAGAAGCTTGG - Intergenic
1188769087 X:34130992-34131014 CAGTATGTATAGTAGGAGATTGG + Exonic
1190510250 X:51167064-51167086 CTGAATATATAAAATGAGATTGG - Intergenic
1192450986 X:71244752-71244774 CTGTATGTACAAAAGAAGAATGG - Intronic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1195909812 X:109877640-109877662 ATGTATGTATACAAGAAGCTAGG + Intergenic
1197897859 X:131335122-131335144 CTGTATGTATCAACAGGGCTAGG - Intronic
1201969687 Y:19777839-19777861 ATGTATATATAAAATCAGCTGGG + Intergenic
1202591374 Y:26487215-26487237 CTTTATTCATAAAAGCAGCTGGG + Intergenic