ID: 1178124098

View in Genome Browser
Species Human (GRCh38)
Location 21:29498971-29498993
Sequence TTTGCCTCATTTGGAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1054
Summary {0: 1, 1: 0, 2: 6, 3: 82, 4: 965}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178124098 Original CRISPR TTTGCCTCATTTGGAAAATC AGG Intronic
900800837 1:4736039-4736061 CTTTCCTCATTTGGAAAACAGGG + Intronic
901174748 1:7290889-7290911 ATTTCCTCATTTGCAAAATGAGG - Intronic
901250883 1:7778821-7778843 GTTTCCTCATTTGTAAAATGGGG + Intronic
902131053 1:14260809-14260831 TGAGCCTCATCTGGAAAATGGGG - Intergenic
902403422 1:16170578-16170600 GTTTCCTCATTTGTAAAATGTGG - Intergenic
903459785 1:23512586-23512608 GTTTCCTCATGTGGAAAAACAGG + Intronic
903675328 1:25061158-25061180 GTTTCCTCATCTGGAAAATGGGG + Intergenic
903687254 1:25140810-25140832 ATTGCCTCATCTGTAAAAACAGG + Intergenic
903798992 1:25952507-25952529 TTAGCCTCATTTTGTAGATCAGG - Intergenic
903988845 1:27250517-27250539 ATTTCCTCATTTGTAAAATGGGG - Intronic
904024753 1:27495666-27495688 TTCCCCTCATTTGTAAAATGAGG - Intergenic
904234269 1:29104109-29104131 GTTTCCTCATTTGTAAAATGTGG + Intronic
904379105 1:30099522-30099544 GTTTCTTCATCTGGAAAATCAGG - Intergenic
904393369 1:30200083-30200105 GTTTCCTCATTTGCAAAATGGGG - Intergenic
904416380 1:30363459-30363481 GTTTCCTCATTTGTAAAATGGGG + Intergenic
904849456 1:33446414-33446436 TTTGAGTCATTTGGAAGAGCAGG + Intergenic
905128063 1:35729897-35729919 TTTTCCTCAACTGGAAAATGGGG - Intronic
905270916 1:36786900-36786922 GTTTCCTCATCTGGAAAATGGGG - Intergenic
905283276 1:36862738-36862760 GTTGCCTCATCTGCAAAATGGGG + Intronic
905734952 1:40318260-40318282 TTTTCCTCATCTGTAAAATGGGG + Intergenic
906634243 1:47397679-47397701 GTTTCCTCATTTGTAAAATAAGG - Intergenic
906727953 1:48057794-48057816 GTTTCCTCATTTGTAAAATAGGG - Intergenic
906807638 1:48794583-48794605 TTTGCCTCATTTGGTCTCTCAGG + Intronic
906860372 1:49352821-49352843 TTAGCCTCATCTGTAAAATAAGG - Intronic
906916741 1:50020403-50020425 GTTTCCTCATTTGTAAAATGGGG - Intronic
906941246 1:50257346-50257368 GTTTTCTCATTTGGAAAATGGGG + Intergenic
907016524 1:51020548-51020570 GTTTCCTCATTTGTAAAATGAGG - Intergenic
907374451 1:54024356-54024378 GTTTCCTCATTTGAAAAATGGGG + Intergenic
907517997 1:55005548-55005570 TTTGCCTCGTCTGTAAAATGGGG + Intronic
907561915 1:55399016-55399038 GTTTCCTCATCTGGAAAATGGGG - Intergenic
907579346 1:55557602-55557624 GTTGCCTCATGTGTAAAATAGGG + Intergenic
907724723 1:57008574-57008596 TTTTCTTCATTTGAAAAATAAGG - Intronic
907823775 1:57995951-57995973 GTTGCTTCATTTGGAAAATGAGG + Intronic
907955688 1:59226136-59226158 ATTTCCTCATTTGTAAAATGAGG - Intergenic
908138225 1:61155055-61155077 GTTTCCTCATTTGTAAAATGGGG + Intronic
908151209 1:61304818-61304840 TTTCCCTCATTTTGTACATCAGG - Intronic
908173098 1:61527417-61527439 TGTGCCTCATTTATAAAATGAGG + Intergenic
908577909 1:65480695-65480717 TTTTCCTCTTTTGTAAAATGGGG - Intronic
908672636 1:66564971-66564993 TTTTCTTCATTTGGAAAATGAGG - Intronic
908754260 1:67453712-67453734 GTTTCCTCATTTAGAAAATGAGG - Intergenic
908756036 1:67469747-67469769 TGTTCCTCATCTGGAAAATGAGG + Intergenic
908766605 1:67559991-67560013 ATTTCCTCATTTGTAAAATTAGG - Intergenic
908768794 1:67577200-67577222 GTTTCCTCATTTGTAAAATAGGG + Intergenic
909525379 1:76616228-76616250 TTTAACTCAGTTAGAAAATCTGG + Intronic
909684137 1:78326993-78327015 CTTTCCCCATTTGTAAAATCAGG + Intronic
909696662 1:78475093-78475115 TTTGCCTCATGTGCAAAATGGGG + Intronic
910044328 1:82893307-82893329 GTTTCCTCATCTGGAAAATTAGG - Intergenic
912049980 1:105517259-105517281 ATTTCCTTATTTGTAAAATCTGG - Intergenic
912184492 1:107258609-107258631 GTTTTCTCATTTGGAAAATCAGG - Intronic
912455040 1:109791629-109791651 ATTGCCTCATCTGTAAAATGGGG - Intergenic
913243374 1:116850226-116850248 CTTTCCTCATTTGAAAAATTGGG - Intergenic
913536044 1:119773631-119773653 TTAGCCCCATTTGGAAGATATGG + Intergenic
913543122 1:119840889-119840911 TTTATCTCATTTTGAAAAGCAGG + Intergenic
913957695 1:143319655-143319677 TTTCCTACATTTGGAAAATGGGG + Intergenic
913974354 1:143442610-143442632 TTGTCCTCATTTGGAAAAGGAGG - Intergenic
914068744 1:144268224-144268246 TTGTCCTCATTTGGAAAAGGAGG - Intergenic
914110411 1:144698130-144698152 TTGTCCTCATTTGGAAAAGGAGG + Intergenic
914254263 1:145948302-145948324 TTTCCCTCATCTGTAAAATATGG - Intronic
914835997 1:151207466-151207488 GTTTCCTAATTTGGAAAATGAGG - Intronic
914885806 1:151583455-151583477 GTTCCCTCATTTGTAAAATGAGG + Exonic
915161574 1:153923977-153923999 TTTTCCTCATTTGTAAAGTAGGG - Intergenic
917637396 1:176950262-176950284 GTTGCCTCATATGCAAAATGGGG - Intronic
917761068 1:178158529-178158551 TTTACCTAATTTGTAAAATAGGG + Intronic
917922773 1:179764824-179764846 GTTGCCTCATTTGTAAAAAGGGG + Intronic
918188090 1:182145302-182145324 TCAGCCTCATTTGGTAAATGAGG + Intergenic
918642463 1:186859818-186859840 CCTGCCTCATCTGGAAAATAGGG + Intronic
918902981 1:190449936-190449958 TTTGCTACATTTGGCAACTCTGG - Intronic
919659169 1:200226688-200226710 TGTGCCTCATTTGTAAAATCGGG - Intergenic
919706375 1:200680310-200680332 GTTTCCTCATTTGTAAAATGGGG - Intergenic
919776867 1:201199887-201199909 ATTTCCTCATTTGCAAAATGTGG + Intronic
920949765 1:210561457-210561479 GTTTCCTCATCTGGAAAATGGGG + Intronic
920950454 1:210567381-210567403 TTTTCCTCATCTGGAAATTAAGG + Intronic
921307572 1:213812525-213812547 TTTTCTTCATGTGGAAATTCAGG + Intergenic
921360496 1:214327085-214327107 ATTTCCTCATCTGGAAAATTGGG - Intronic
921364227 1:214358556-214358578 GTTTCCTCATCTGTAAAATCAGG + Intronic
921498755 1:215874178-215874200 TTTTCATCACTTAGAAAATCTGG - Intronic
921887808 1:220324057-220324079 GTTTCCTCATATGGAAAATTGGG - Intergenic
922537665 1:226393633-226393655 TTTGCCTGATTTAGAATTTCAGG - Intronic
923458094 1:234183315-234183337 TTTGTATCATTAAGAAAATCTGG - Intronic
923642998 1:235784614-235784636 GTTGCCTCATATGTAAAATTGGG + Intronic
924078546 1:240367467-240367489 TTTGCCTTATTTAAGAAATCCGG + Intronic
924775686 1:247113266-247113288 TTTGCCACAGTGGGAAAAACAGG + Intergenic
1062785670 10:262699-262721 TTTGCCACAAATGAAAAATCAGG + Intergenic
1062868487 10:877609-877631 GTTTCCTCATTTGTAAAATGGGG + Intronic
1064152935 10:12880214-12880236 TTTTCCTCATCTGTAAAATGGGG + Intergenic
1064383647 10:14869954-14869976 TTTTACTCATTTGTAAAATAAGG - Intronic
1064952181 10:20865372-20865394 GTTTCCTCATTTGTAAAATAGGG - Intronic
1065067146 10:21981596-21981618 ATTTCCTCATTTGTAAAATGGGG + Intronic
1065112497 10:22453576-22453598 TTTCCCTCATTGGGAACAACTGG + Intronic
1065225211 10:23536455-23536477 TCTGCCCCATTTGAAAAATGGGG + Intergenic
1065424756 10:25588221-25588243 ATTTCTTCATTTGGAAAATGAGG - Intronic
1066610195 10:37237272-37237294 GTTGCCTCTTTTGTAAAATGAGG + Intronic
1066759977 10:38740928-38740950 TTTCCTACATTTGGAAAATGGGG - Intergenic
1066961640 10:42231840-42231862 TTTCCTACATTTGGAAAATGGGG + Intergenic
1067369934 10:45673251-45673273 ATTGCCTCATCTGGAAAATGGGG + Intergenic
1067423081 10:46175226-46175248 TTTGCCTCATTTGGTCCATTTGG - Intergenic
1068605097 10:58996560-58996582 TTTTCCTCACTGGTAAAATCGGG + Intergenic
1068619165 10:59159631-59159653 TTTTCCTCATCTGTAAAATGTGG + Intergenic
1068876768 10:62005307-62005329 CTTGCCCCATCTGTAAAATCGGG + Intronic
1068958062 10:62838618-62838640 TTTTTCTCATTTGTAAAATGGGG - Intronic
1069249611 10:66251867-66251889 GTTTCCTCATTTGCAAAATGGGG - Intronic
1069335832 10:67348893-67348915 TTTGCCCCATTTAAAAAATTGGG - Intronic
1069845585 10:71368631-71368653 TATGCCTCAGCTGGAAAATTGGG + Intergenic
1069853180 10:71423741-71423763 TTTTCACCATTTGGAAAATGAGG + Intronic
1069872583 10:71542314-71542336 TTTTCCTCATATGGAGAATGAGG + Intronic
1069991051 10:72316412-72316434 GTTACCCCACTTGGAAAATCAGG - Intergenic
1070974843 10:80598161-80598183 GTTTCCTCATTTGTAAAATGGGG + Intronic
1070996832 10:80791569-80791591 TTTTGCTCATTTTGAAAATTGGG + Intergenic
1071173897 10:82900688-82900710 TTTTCTTCATTTGTAAAATGGGG - Intronic
1071400280 10:85261951-85261973 ATTTCCTCATTTGCAAAATAAGG + Intergenic
1071644855 10:87353618-87353640 TTTGCCTCATTTGGTCCATTTGG + Intergenic
1071867512 10:89752006-89752028 TTTTCCTCATTTGTAAAATGTGG + Intronic
1071898498 10:90091844-90091866 TTTTCCTAATTTGGAAAAATTGG + Intergenic
1071957306 10:90772883-90772905 GTTTCCTCATTTGTAAAATAGGG - Intronic
1072741019 10:97909432-97909454 GTTTCCTCATTTGTAAAATGGGG + Intronic
1072843864 10:98806266-98806288 TTTTCCTCATTTGAAAACTGAGG - Intronic
1073271378 10:102267133-102267155 TCTGTTTCATTTGGAAAATGGGG + Intronic
1073477685 10:103765091-103765113 GTTTCCTCATCTGGAAAATGGGG - Intronic
1074426426 10:113355445-113355467 ATTTCCTCATTTGTAAAATGGGG + Intergenic
1074510234 10:114104842-114104864 TTTTCCTCATATGCAAAATGGGG - Intergenic
1074883420 10:117676220-117676242 TTTTCCTCATTTGTAAAATGGGG - Intergenic
1074905574 10:117860452-117860474 TGTGCCTCATCTGTAAAATAGGG - Intergenic
1074928542 10:118099355-118099377 GTTTGCTCATTTGTAAAATCGGG - Intergenic
1075597908 10:123745797-123745819 TTAGCCTAATCTGGAAGATCTGG + Exonic
1075882299 10:125863967-125863989 GTTGCCTCATCTGAAAAATGTGG - Intronic
1075903378 10:126061356-126061378 TATGCCTCATCTGTAAAATAAGG - Intronic
1076159938 10:128235955-128235977 TTTTCCTCATCTGTAAAATGGGG - Intergenic
1076285437 10:129291318-129291340 TTTGTCTCATCTGTAAAATGGGG - Intergenic
1078000035 11:7486235-7486257 TTTGTCTCATCTGTAAAATGGGG + Intronic
1078001542 11:7500576-7500598 GTTTCCTCATTTGGAAAATGGGG + Intronic
1078065366 11:8075419-8075441 GTTGCTTCATTTGTAAAATGGGG + Intronic
1078069562 11:8099382-8099404 TTTTCTTCATTTTTAAAATCAGG + Intronic
1078571313 11:12460351-12460373 TTTTCCTCATCTGTAAAATGAGG + Intronic
1078667008 11:13334112-13334134 GTTGCCTCATTGGTAAAATGAGG - Intronic
1078950988 11:16134160-16134182 TGTGCCTCATCTGTAAAATGGGG - Intronic
1079152314 11:17911199-17911221 TTTTTCTCATTTGTAAAATGAGG - Intronic
1079244039 11:18740411-18740433 GTTTCCTCATCTGGAAAATGGGG - Intronic
1079469062 11:20760879-20760901 CTTGGCCCCTTTGGAAAATCGGG + Intronic
1079568350 11:21911319-21911341 ATTTCCTCATTTGTAAAATAAGG + Intergenic
1080666088 11:34337637-34337659 GTTTCCTCATTTGTAAAATGAGG + Intronic
1080689375 11:34543508-34543530 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1080755073 11:35189533-35189555 GTTTCCTCATTTGTAAAATGGGG - Intronic
1080862430 11:36161310-36161332 ATTTCCTCATTTAGAAAATGGGG - Intronic
1081229864 11:40572617-40572639 TTTGCCTCATTTTTTAAACCAGG - Intronic
1081798826 11:45842995-45843017 GTTTCCTCATTTGTAAAATGGGG - Intergenic
1082009392 11:47440159-47440181 TTTTCCTCATCTGTAAAATGGGG + Intronic
1082797989 11:57392182-57392204 GTTGTCTCACTTGGAAAATGGGG - Intronic
1082824204 11:57566446-57566468 ATTTCCTCATTTGTAAAATGCGG + Intronic
1083623512 11:64060318-64060340 GTTTCCTCATCTGTAAAATCGGG + Intronic
1083713499 11:64562767-64562789 TTTACCTTCTTTGGAAAAACTGG + Intronic
1083854507 11:65386164-65386186 TTTTCCTCATCTGTAAAATGAGG - Intergenic
1084311182 11:68317228-68317250 GTTTCCTCATCTGCAAAATCGGG + Intronic
1084532183 11:69734089-69734111 TTCGCCCCAGTTGGAATATCTGG + Intergenic
1084852871 11:71957548-71957570 TTTGCCCCATTTGTAAAATGAGG + Intronic
1084907698 11:72360934-72360956 ATTTCCTCATTTGGAAATTGAGG - Intronic
1085134173 11:74070116-74070138 TTTGTCTCATTTGTAAAACAGGG + Intronic
1085136925 11:74099340-74099362 TTTTCCTCATCTGTAAAATGAGG - Intronic
1085251983 11:75150119-75150141 CATGCCTCATTTGTAAAATCAGG + Intronic
1085319920 11:75567836-75567858 TTGGCCTCATTTGTAAAACGAGG - Intronic
1085488923 11:76895610-76895632 TTTCCCTCATTTGCAAAATGAGG + Intronic
1085488925 11:76895614-76895636 TTTTCCTCATTTTGCAAATGAGG - Intronic
1085704849 11:78777890-78777912 TGTGGCCTATTTGGAAAATCAGG + Intronic
1085751179 11:79162608-79162630 GTTTCCTCATCTGCAAAATCAGG - Intronic
1085808700 11:79660611-79660633 GTTTCCTCATCTGGAAAATGGGG - Intergenic
1086379951 11:86242261-86242283 GTTTCCTCATTTGTAAAATGTGG + Intergenic
1086404745 11:86489903-86489925 GTTGCCTCATTTAAAAAATGGGG - Intronic
1086461469 11:87009897-87009919 TGTGATTCATTGGGAAAATCAGG + Intergenic
1086931874 11:92702461-92702483 TTTTCTTCATCTGGAAAATGGGG + Intronic
1087084979 11:94208557-94208579 GTTGGCTCATTTTAAAAATCAGG - Intergenic
1087433996 11:98089914-98089936 TTTGGGTCATTGGGAAAATGAGG + Intergenic
1087651831 11:100877041-100877063 CTTGCCTTATTTGGTAAATGTGG + Intronic
1087765058 11:102141900-102141922 TTTTCCTCATTTGTAAAATTCGG + Intronic
1087999088 11:104852558-104852580 GATGCCTCATTTATAAAATCAGG + Intergenic
1088545792 11:110957393-110957415 GTTTCCTCATTTGTAAAATTGGG + Intergenic
1088622213 11:111697555-111697577 GTTTCCTCATTTGAAAAATAGGG - Intronic
1088629499 11:111761033-111761055 TCAGCCTCCTTTGGAAAATCTGG - Exonic
1088788074 11:113200616-113200638 TTTTCCTCATCTGGAAAATGAGG + Intronic
1088967164 11:114735479-114735501 GTTGTCTCATTTGCAAAATGGGG + Intergenic
1089131629 11:116216841-116216863 GTTTCCTCATTTGAATAATCGGG - Intergenic
1089201820 11:116729251-116729273 TTAGCCCCGTTAGGAAAATCTGG + Intergenic
1089203550 11:116740255-116740277 ATTTCCTTATTTGTAAAATCAGG - Intergenic
1089333139 11:117703964-117703986 TTTTCCTCATCTGTAAAATGGGG - Intronic
1089414504 11:118275955-118275977 TTTCCCTCATCTGCAAAATGAGG - Intergenic
1089749183 11:120638328-120638350 TTTCCTACATTTGGAAAATGGGG - Intronic
1089788682 11:120926493-120926515 GTTTCCTCATCTGGAAAATGGGG - Intronic
1089802962 11:121052387-121052409 GTTTCCTCATTTGTAAAATAGGG - Intronic
1090552403 11:127836974-127836996 TTTTCCTCCTTTGTAAAATGTGG + Intergenic
1090681329 11:129060916-129060938 GTTTCCTCATTTGTAAAATGGGG - Intronic
1090704293 11:129322564-129322586 GTTTCCTCATTTGGAAAATGGGG + Intergenic
1090813627 11:130270470-130270492 GTTTCCTCATCTGTAAAATCAGG - Intronic
1090961553 11:131561821-131561843 TTTGCCTCATCTATGAAATCAGG + Intronic
1090969519 11:131628297-131628319 TTTTTCTCATTTGCAAAATGTGG + Intronic
1091089005 11:132751630-132751652 GTTTCCTCATTTGGAAAATGGGG - Intronic
1091365673 11:135017990-135018012 TTTGGCTCATTTAAAAAATTGGG - Intergenic
1091446900 12:548951-548973 GTTACCTCATCTGGAAAATAGGG - Intronic
1091536678 12:1416741-1416763 CTTTCTTCATTTGTAAAATCAGG + Intronic
1091754599 12:3043288-3043310 TTTGCCTCATCTGTAAAATGGGG - Intergenic
1092648062 12:10601297-10601319 GTTTCCTCATTTGTAAAATGGGG - Intergenic
1092826321 12:12403136-12403158 TTTTCCTCATTTGGCAGATGAGG + Intronic
1092995929 12:13950436-13950458 TATTCCTTATTTGGAAAATAAGG + Intronic
1093045486 12:14439281-14439303 TTTCCTTCATTTGCAAAATAAGG - Intronic
1093987773 12:25556322-25556344 ACTTCCTCATTTGGAAAATGGGG - Intronic
1094358179 12:29600990-29601012 TTTGCTTCATTTGCCAAATTCGG - Intronic
1094587872 12:31794546-31794568 TTTTCCTCATCTGTAAAATGAGG - Intergenic
1095210307 12:39486152-39486174 GTTTCCTCATTTGAAAAATGGGG + Intergenic
1095408577 12:41895411-41895433 TTTACCAAATTTGGAAAATTGGG + Intergenic
1095598712 12:43990726-43990748 TGTACCTCATTTGTAAAATAAGG - Intronic
1095638656 12:44461037-44461059 GTTGCCTCATTTGTAAAATACGG + Intergenic
1095739882 12:45595055-45595077 TTTTCCCCACTTGCAAAATCAGG + Intergenic
1095841928 12:46702693-46702715 TTTTTCTTATTTGGAAAATGAGG - Intergenic
1096197318 12:49657022-49657044 TCTGCCTCATCTGCAAAACCAGG - Intronic
1096639671 12:52984100-52984122 GTTTCCTCATTTGTAAAATTAGG - Intergenic
1096828438 12:54296779-54296801 GTTTCCTCATTTGTAAAACCAGG + Intronic
1097171646 12:57117937-57117959 GTTTCCTCATTTGTAAAATGAGG - Intronic
1097299725 12:58005217-58005239 GTTTCCTCATTTTGAAAATGGGG + Intergenic
1097886633 12:64735338-64735360 TTTTCCTCATCTGCAAAATAGGG + Intronic
1097908585 12:64945620-64945642 TTTTCCTCATTTGAAAAATCTGG + Intergenic
1098378369 12:69841950-69841972 TTAGCCTCATTTTGAAAATGAGG + Intronic
1098480517 12:70953525-70953547 ATTTCCTCATTTGTAAAATGGGG - Intergenic
1098619229 12:72571848-72571870 ATTTCCTCATTTGTAAAATGGGG - Intronic
1098796316 12:74892912-74892934 ATTGCCTCATCTGGAAAATATGG - Intergenic
1098933244 12:76446046-76446068 GTTTCCTCATTTGTAAAATGGGG + Intronic
1098942643 12:76555664-76555686 GTTTTCTCATTTGTAAAATCAGG - Intronic
1099103216 12:78468943-78468965 TGTGCCTCATTTGTTAAATGTGG - Intergenic
1099258409 12:80344754-80344776 TTAGAATCATTTGGAAAGTCAGG + Intronic
1099289853 12:80762939-80762961 TTTACCTCTTTTGTAAAATGGGG - Intergenic
1099886881 12:88542365-88542387 TGTTCCTCATTTGAAAAATTAGG + Intronic
1099959322 12:89381342-89381364 GTTTTCTCATTTGTAAAATCAGG - Intergenic
1100619549 12:96258075-96258097 GTTGCCTCATCTGTAAAATGGGG - Intronic
1100725472 12:97404027-97404049 ATTGTCTCATTTGACAAATCAGG + Intergenic
1100775052 12:97964752-97964774 ATTGCCTCATCTGTAAAATGGGG - Intergenic
1101052846 12:100881656-100881678 GTTTCCTCATCTGGAAAATGAGG + Intronic
1101081224 12:101186852-101186874 ATTTCCTCATCTGTAAAATCAGG + Intronic
1101238113 12:102810655-102810677 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1101257466 12:102992709-102992731 TTTCCCTCATTTGTAAACTTAGG + Intergenic
1101400813 12:104385124-104385146 GTTTCCTCATCTGTAAAATCAGG + Intergenic
1101514666 12:105423693-105423715 TTTGCCTCAGCTGGAAAATGTGG + Intergenic
1101717360 12:107322018-107322040 GTTGCCTCATCTGTAAAATAGGG + Intronic
1101854683 12:108432457-108432479 GTTTCCTCATTTGTAAAATGGGG - Intergenic
1101953037 12:109191086-109191108 GTTTCCTCATATGGAAAATGGGG - Intronic
1102169765 12:110833478-110833500 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1102253290 12:111402014-111402036 GTTTCCTCATCTGGAAAATGGGG - Intergenic
1102410849 12:112717068-112717090 TGAGCCTCATCTGGAAAATGGGG - Intronic
1102458320 12:113084743-113084765 GTTTCCTCATTTGAAAAATGGGG - Intronic
1102583903 12:113909934-113909956 TTTTCCTCATCTGTAAAATGGGG - Intronic
1102591190 12:113958041-113958063 CTTGCCTCTTCTGGAAAAACAGG + Exonic
1102788204 12:115621252-115621274 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1103063956 12:117881645-117881667 ATTTCCTCATTTGTAAAATGAGG - Intronic
1103594627 12:122016793-122016815 TGTGCCTCATCTGTAAAATGGGG - Intergenic
1103717108 12:122951185-122951207 TTTTTCTCATTTGTAAAATGGGG - Intronic
1103875857 12:124126643-124126665 TTTCCCTCATCTGTAAAATGAGG - Intronic
1103956076 12:124577611-124577633 TTTTCCTCATCTGTAAAATGGGG + Intergenic
1104097535 12:125571272-125571294 GTTCCCTCATTTGTAAAATGAGG + Intronic
1104169458 12:126266043-126266065 TGTGCCTCATCTGTAAAATGGGG - Intergenic
1104199009 12:126568952-126568974 TTTCCCTGATGTGGAAAATGGGG + Intergenic
1105043496 12:132981497-132981519 TTTTGCTCATTTGCAAAATTGGG + Intergenic
1105487290 13:20848300-20848322 TTTGAATCAGTTAGAAAATCTGG + Intronic
1105533331 13:21240659-21240681 ATTTCCTCATCTGGAAAATTGGG + Intergenic
1106071088 13:26411663-26411685 TTTTCCTCATCTGAAAAATGGGG - Intergenic
1106158040 13:27175510-27175532 CTTTCCTCATCTGGAAAATAAGG + Intergenic
1106206289 13:27598617-27598639 GTTTCCTCATTTGAAAAATGGGG - Intronic
1107536046 13:41333707-41333729 TTTTTCTCATTTGGAACATGGGG + Intronic
1108152885 13:47554634-47554656 TTTGCCTCAAATTGGAAATCTGG + Intergenic
1108295002 13:49007046-49007068 TTTGCTTCATCTGCAAAATAAGG - Intronic
1108500481 13:51065741-51065763 GTTGTCTCATTTGGAAAATGGGG + Intergenic
1108937919 13:55908919-55908941 TTTGCCTAATTTTTAAAAACTGG - Intergenic
1109070991 13:57768119-57768141 TTTTCATCATTGGGAACATCAGG + Intergenic
1109279591 13:60340688-60340710 TATGACTCATTTGAAAAATGGGG + Intergenic
1109335099 13:60984048-60984070 TTTTACTCATTTTGAAAATGAGG - Intergenic
1109727543 13:66363297-66363319 TTTTCCTCATTAGGAAATTTAGG + Intronic
1110218393 13:73048059-73048081 TTTACCTCCTTTGAATAATCAGG + Intergenic
1110329311 13:74252521-74252543 TGTTCCTCATTTGGAAGAGCAGG + Intergenic
1110529215 13:76576911-76576933 GTTTCCTCATTTGGAAAATAAGG - Intergenic
1110554701 13:76845729-76845751 TTTGTCTCATATGGAAATTTTGG + Intergenic
1111806817 13:93048871-93048893 TTTTGCTCATTTAAAAAATCAGG - Intergenic
1111807191 13:93052474-93052496 TTTTGCTCATTTAAAAAATCAGG - Intergenic
1112043529 13:95572450-95572472 GTTTCCTCATTTGTAAAATGAGG + Intronic
1112476261 13:99733609-99733631 TTGGACTAATTTGGAAAATATGG + Intronic
1112695392 13:101942798-101942820 TTTGCTTCACTTGTATAATCAGG + Intronic
1112853877 13:103741477-103741499 TTTGCCTCATTTGGAACTCAGGG + Intergenic
1113152532 13:107280864-107280886 TTTAGCTCATTAGAAAAATCAGG - Intronic
1113268122 13:108642066-108642088 ATTTCCTCATTTGAAAAATGAGG + Intronic
1114414536 14:22532307-22532329 TATCCCTCATTTGTAAAATGAGG + Intergenic
1115232281 14:31174000-31174022 GTTCCCTCATTTGTAAAATGGGG + Intronic
1115378149 14:32702022-32702044 TTTGTTTCATTTTGAACATCAGG - Intronic
1116001972 14:39253420-39253442 TTTCCCTAATTTGAAAAATGGGG - Exonic
1116370849 14:44129658-44129680 TTTGGCTTATTTTAAAAATCAGG - Intergenic
1116604540 14:46972940-46972962 TTTGGCCCATTTTAAAAATCAGG - Intronic
1116882548 14:50185889-50185911 GTTTCCTCATTTGTAAAATGAGG - Intronic
1116976244 14:51119336-51119358 GTTTCCTCATTTGGGAAATGGGG + Intergenic
1117065739 14:52011897-52011919 TTTGTCTCATTTGCAAAATGAGG + Intronic
1117372389 14:55090443-55090465 TTTGCCTGATGTGGAAAAACTGG - Intergenic
1117882348 14:60324418-60324440 GTTGTCTTATTTGTAAAATCGGG + Intergenic
1118021420 14:61719428-61719450 GTTCCCTCATTTGTAAAATAGGG + Intronic
1118472009 14:66082737-66082759 ATTTCCTCATTTGTAAAATTAGG + Intergenic
1118737750 14:68714339-68714361 GTTTCCTCATTTGTAACATCGGG + Intronic
1118845635 14:69545956-69545978 ATTTCCTCATTAGGAAATTCTGG - Intergenic
1118859690 14:69653035-69653057 GTTTCCTCATTTGTAAAATGGGG - Intronic
1119425583 14:74532700-74532722 GTTTCCTCATTTGTAAAATGAGG + Intronic
1119502506 14:75142287-75142309 GTTTCCTCATTTGAAAAATGAGG - Intronic
1119504859 14:75163737-75163759 TCTACCTCATTTGTAAAATAAGG + Intronic
1119506246 14:75175814-75175836 GTTTCCTCATTTGTAAAATGGGG + Intronic
1119548387 14:75490259-75490281 GTTTCCTCATTTGTAAAATGAGG - Intergenic
1119824344 14:77644640-77644662 GTTCCCTCATCTGCAAAATCAGG - Intergenic
1119859717 14:77927340-77927362 TTTTCCTCTTTTGTAAAATAGGG + Intronic
1120938344 14:89920558-89920580 TTTCCCTCATGTGTAAAATGGGG + Intronic
1121021037 14:90580353-90580375 GTTTCCTCATTTGGACAATGGGG - Intronic
1121149708 14:91621037-91621059 TTTTCCTCATTTGTAAAATGAGG + Intronic
1121354325 14:93200991-93201013 GTTTCCTCCTTTGGAAAATGTGG - Intronic
1121608081 14:95256022-95256044 GTTTCCTCATTTGTAAAATGGGG - Intronic
1122097619 14:99383092-99383114 TTTTCCTCCTGTGGAAAATGGGG + Intergenic
1122208761 14:100161295-100161317 GTTTCCTCATCTGGAAAATGAGG - Intergenic
1122363518 14:101181327-101181349 TTTTTCTCATTTGCAAAATCAGG - Intergenic
1122583250 14:102785006-102785028 TTTTCCTCATCTGCAAAATGGGG - Intronic
1123443386 15:20305539-20305561 TTTCCTACATTTGGAAAATGGGG - Intergenic
1123831143 15:24138800-24138822 TTTGGCACATTTAAAAAATCAGG - Intergenic
1124199192 15:27662485-27662507 TTTGCCACTTTTAAAAAATCAGG - Intergenic
1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG + Intronic
1125083307 15:35700590-35700612 TTTTCCCCATTTGTAAAATGGGG + Intergenic
1125135608 15:36337437-36337459 TTTGGCCCATTTTTAAAATCAGG + Intergenic
1125493683 15:40169377-40169399 GTTTCCTCATTTGTAAAATGGGG - Intronic
1125580849 15:40784519-40784541 GTTTCCTCATTTGTAAAATGAGG - Intronic
1126476100 15:49066716-49066738 TTTGGCTAATTTGGTAATTCTGG - Intergenic
1126703922 15:51390134-51390156 ATTTCCTCATTTGCAAAATGGGG + Intronic
1126863582 15:52912823-52912845 TTTGCTTCATTGGCAAAATATGG + Intergenic
1127391607 15:58509456-58509478 TTTGCTTCATTTTGCAAATGGGG - Intronic
1127597988 15:60506251-60506273 GTTTCCTCATTTGTAAAATGAGG + Intronic
1127886239 15:63203718-63203740 ATTACCTCATTTGGAAAATAGGG - Intronic
1128076140 15:64826882-64826904 TTTTTCTCATTTGAAAAATAAGG - Intergenic
1128796137 15:70468163-70468185 TTTTCCTCATCTGTAAAATGGGG - Intergenic
1129079729 15:73028295-73028317 TTTCCCTCAAATGCAAAATCTGG - Intergenic
1129139796 15:73587276-73587298 TTTTCCTCATTTTTAAAATGAGG - Intronic
1129464117 15:75714217-75714239 GTTTCCTCATTTGTAAAATTGGG + Intergenic
1129643658 15:77409864-77409886 GTTTCCTCATTTGTAAAATAAGG - Intronic
1129798593 15:78396580-78396602 GTTGCCTCATCTGTAAAATAAGG - Intergenic
1130165021 15:81446854-81446876 TTTTGCTCATTTTTAAAATCAGG - Intergenic
1130436659 15:83906437-83906459 TTTTCCTCATCTGTAAAATCAGG + Intronic
1130608867 15:85342371-85342393 TTTTCCTCATCTGAAAAATCGGG + Intergenic
1130906654 15:88245349-88245371 GTTTCCTCATCTGAAAAATCTGG - Intronic
1131324470 15:91429265-91429287 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1131337475 15:91563023-91563045 TTTTTCTCATTAGTAAAATCAGG + Intergenic
1131443939 15:92480073-92480095 ATTGCCTCATGTGAAAAATGTGG - Intronic
1131542594 15:93287668-93287690 CTTTCCTCATTTGAAAAATGGGG + Intergenic
1131964201 15:97821636-97821658 TTTGGCCCATTTTTAAAATCAGG + Intergenic
1132166695 15:99599637-99599659 TTTGCATCAGTTGGATAAACAGG - Intronic
1132175660 15:99711927-99711949 ATTTCCTCATCTGGAAAATGGGG + Intronic
1132522621 16:398455-398477 TCTTCCTCATGTGGAAAGTCGGG + Intronic
1132998038 16:2833966-2833988 TTATCCTCATTTGCAAAATGAGG + Intronic
1133424151 16:5673091-5673113 TCTGCATCCTTTGGAAAAGCAGG + Intergenic
1133825705 16:9276227-9276249 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1133912404 16:10078006-10078028 TTTTCCTCATCTGCAAAATGCGG + Intronic
1133926031 16:10193066-10193088 ATTGCCTCATCTTGAAAATGAGG - Intergenic
1134018391 16:10905267-10905289 GTAGCCTCATCTGGAAAATGGGG - Intronic
1134209705 16:12265986-12266008 GTTTCCTCATTTGTAAAATGGGG - Intronic
1134317450 16:13132221-13132243 GTTGCCTCATTTGTAGAATGGGG + Intronic
1134320474 16:13158129-13158151 TGTGCCTCATCTGTAAAATGGGG + Intronic
1134566476 16:15256338-15256360 TTTTCCTCATCTGTAAAATGGGG - Intergenic
1134736020 16:16500361-16500383 TTTTCCTCATCTGTAAAATGGGG + Intergenic
1134839132 16:17387366-17387388 TTTTCCTCCTTTGAAAAATGGGG + Intronic
1134885170 16:17784508-17784530 TTTTCCTCATCTGAAAAATAGGG - Intergenic
1134931504 16:18211798-18211820 TTTTCCTCATCTGTAAAATGGGG - Intergenic
1135033603 16:19058456-19058478 ATTTCCTCATTTGTAAAATAGGG - Intronic
1135089605 16:19502704-19502726 GTTTCCTCATTTGTAAAATGAGG + Exonic
1135358355 16:21789860-21789882 TTAGACTCATTTGGGAAAACAGG - Intergenic
1135456858 16:22605985-22606007 TTAGACTCATTTGGGAAAACAGG - Intergenic
1135935882 16:26779572-26779594 TTTTCCTCATATGCAAAATGGGG + Intergenic
1135982514 16:27159294-27159316 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1136122154 16:28144811-28144833 GTTTCCTCATTTGTAAAATGAGG - Intronic
1136722828 16:32338348-32338370 TTTCCTACATTTGGAAAATGGGG + Intergenic
1136841151 16:33544347-33544369 TTTCCTACATTTGGAAAATGGGG + Intergenic
1136863166 16:33714660-33714682 TTTCCTACATTTGGAAAATGGGG - Intergenic
1137038684 16:35590098-35590120 GTTTCCTCATTTGTAAGATCCGG - Intergenic
1137965699 16:52931138-52931160 TTTTCCTTATGTGGAAAATGAGG - Intergenic
1138047777 16:53743800-53743822 ATTGCCTCATCTCTAAAATCAGG - Intronic
1138206954 16:55132410-55132432 TTTTCCTCATTTGTAAAGTGGGG - Intergenic
1138590001 16:57994482-57994504 GTTGCCTCATCTGTAAAATGGGG - Intergenic
1139176838 16:64699724-64699746 TTTTCTTCATTTGTAAAAACTGG + Intergenic
1139253393 16:65518517-65518539 TTTTCTTTATTTGGAAAATGAGG - Intergenic
1139337254 16:66241505-66241527 GTTGCCCCATTTGTAAAATGAGG + Intergenic
1139347582 16:66314078-66314100 ATTTCCTCATTTGCAAAATGGGG - Intergenic
1139351014 16:66335766-66335788 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1140751591 16:78029110-78029132 TTTTCCTCATCTGTAAAATTAGG - Intronic
1140917935 16:79510285-79510307 TTGCTCTCATTTGGAAAATGAGG + Intergenic
1141194001 16:81845964-81845986 GTTTCCTCATTTGTAAAATAGGG + Intronic
1141460197 16:84174051-84174073 TTTTCCTCATCTGGGAAATTGGG - Intronic
1141568464 16:84919531-84919553 TTTGCTCCATTTGTTAAATCTGG + Intronic
1141806730 16:86346938-86346960 TTTGTCTCATCTGTAAAATGGGG - Intergenic
1141814181 16:86398266-86398288 TTTGCCCCAAGTTGAAAATCTGG + Intergenic
1141822590 16:86457256-86457278 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1141827656 16:86492486-86492508 ATTCCCTCACTTGGAAAATGGGG + Intergenic
1203003603 16_KI270728v1_random:179416-179438 TTTCCTACATTTGGAAAATGGGG - Intergenic
1203124658 16_KI270728v1_random:1562813-1562835 TTTCCTACATTTGGAAAATGGGG - Intergenic
1203135211 16_KI270728v1_random:1715823-1715845 TTTCCTACATTTGGAAAATGGGG - Intergenic
1203151316 16_KI270728v1_random:1844644-1844666 TTTCCTACATTTGGAAAATGGGG + Intergenic
1143423353 17:6813309-6813331 TTTCCCTCATCTGTAAAATGGGG - Intronic
1143746062 17:8995036-8995058 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1143964994 17:10750732-10750754 GTTTCCTCATTTGTAAAATCGGG + Intergenic
1144006819 17:11107988-11108010 TTTCCCCCATTTGGGAAATCAGG + Intergenic
1144095833 17:11900085-11900107 TTTTTTTCATTTGGAAAATGAGG - Intronic
1144463131 17:15474214-15474236 GTTTCCTCATTTGAAAAATGGGG - Intronic
1144466064 17:15498730-15498752 ATTTCCTCATCTGGAAAATGGGG - Intronic
1144838729 17:18172445-18172467 CTTTCCTCATCTGGAAAATGAGG + Intronic
1146511926 17:33456849-33456871 GTTGCCTCATCTGTAAAATGGGG + Intronic
1146686858 17:34846978-34847000 GTTTCCTCATTTGTAAAATAGGG - Intergenic
1146729935 17:35184644-35184666 GTTTCCTCATTTGTAAAATAGGG - Intronic
1146818019 17:35960246-35960268 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1147136132 17:38435098-38435120 TTTGCCTCATGGGGAAACTGAGG + Intronic
1147600688 17:41743500-41743522 TTTCCCTCATCTGTAAAATGGGG + Intergenic
1147716245 17:42510669-42510691 TTTGCCTCATTTGGACAACAAGG + Intronic
1147753486 17:42752358-42752380 TTTTCCTCATCTGTAAAATGGGG - Intergenic
1147887206 17:43692155-43692177 TTGGGCAAATTTGGAAAATCTGG - Intergenic
1148141385 17:45331601-45331623 ATTTCCTCATTTGCAAAATGGGG - Intergenic
1148338030 17:46854522-46854544 GTTGCCTCATCTGAAAAATTGGG - Intronic
1148754633 17:49966404-49966426 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1148799352 17:50213527-50213549 GTTTCCTCATTTGTAAAATGAGG - Intergenic
1149171483 17:53817018-53817040 TGTGTCTCATTTGTGAAATCAGG + Intergenic
1149345755 17:55733495-55733517 TTTCCCTTATTTGGAAAATGGGG + Intergenic
1149347929 17:55756988-55757010 GTTTCCTCATTTGCAAAACCTGG + Intronic
1149347944 17:55757421-55757443 GTTTCCTCATTTGCAAAACCAGG - Intronic
1149361739 17:55902218-55902240 TTTGACTCATTAGGAAACTGAGG - Intergenic
1149454717 17:56778603-56778625 GTTTCCTCATTTGCAAAATGGGG - Intergenic
1149456584 17:56793211-56793233 ATTTCCTCATTTGTAAAATGAGG - Intronic
1150025464 17:61669698-61669720 TTTTCCTCCTTTGTAAAATAAGG + Intergenic
1150198211 17:63323846-63323868 ATTTCCTCATTTGTAAAATGGGG - Intronic
1150260140 17:63782469-63782491 TTTGCCTAATTTTGCAAACCTGG + Intronic
1150589339 17:66548620-66548642 ATTGCCTTATTTGGAAAAAAAGG + Intronic
1152479974 17:80544529-80544551 TTTGCCGCTTTTTCAAAATCTGG + Intergenic
1153022560 18:643832-643854 TGTGCCTCATTTGAAAAACTGGG - Intronic
1153680124 18:7492537-7492559 ATTTCCTCATTTGTAAAATGGGG + Intergenic
1153917802 18:9761323-9761345 TTATCCTCATTTTGCAAATCAGG - Intronic
1154037294 18:10815391-10815413 ATTTCCTCATTTGGAAAATGAGG + Intronic
1154110212 18:11561320-11561342 GTTTCCTCCTTTGGAAAATAAGG - Intergenic
1155069347 18:22300033-22300055 TTTGCCACATTTGAAAAATATGG + Intergenic
1155612090 18:27677202-27677224 TTTCCCTCATTGGCAAAATGGGG - Intergenic
1155666797 18:28318618-28318640 ATTGCCTCATTGGGAAAACTGGG + Intergenic
1155780386 18:29825187-29825209 TTTGCCTACTTTGGAAGATTTGG - Intergenic
1155846368 18:30712811-30712833 TTTTTCTCATTTGGCAAATGAGG - Intergenic
1156227084 18:35119891-35119913 TTTGCATCATTTGTTGAATCAGG + Intronic
1156510716 18:37634408-37634430 TGTTCCTCATTTGAAAAATATGG - Intergenic
1157012175 18:43663323-43663345 TTTGCATTATTTGTTAAATCTGG - Intergenic
1157213995 18:45767169-45767191 TTTCTCCTATTTGGAAAATCTGG + Intergenic
1157482941 18:48067349-48067371 CTTCCCTTATTTGTAAAATCAGG + Intronic
1157761268 18:50267280-50267302 TTTGCCTTAGCTGGAAAATAAGG - Intronic
1157853688 18:51083712-51083734 GTTGCCTCATCTGTAAAATGAGG + Exonic
1157864190 18:51166760-51166782 TTCCCCTCATCTGTAAAATCAGG + Intergenic
1157942830 18:51947696-51947718 TTTGATTCATTTAGAAAATAAGG - Intergenic
1157965975 18:52208539-52208561 TTTGCTTCATTTTGTAAATGAGG - Intergenic
1158451182 18:57566984-57567006 GTTTCCTTATCTGGAAAATCAGG - Intronic
1158554992 18:58467676-58467698 GTTCCCTCATTTGGAAAAGCAGG + Intergenic
1158779522 18:60630188-60630210 TTTGTCTCATATGAAAAATGTGG - Intergenic
1159113900 18:64091559-64091581 TTATCCTCATTTTGCAAATCAGG + Intergenic
1160030354 18:75251817-75251839 TCTTACTCATTTGGAAAAGCTGG + Intronic
1161258765 19:3323986-3324008 TTTTCCTCATTTGTAAAATAAGG + Intergenic
1161475513 19:4482767-4482789 TTTTCCTCATCTGCAGAATCAGG + Intronic
1161624940 19:5320846-5320868 GTTTCCTCATCTGGAAAATGAGG - Intronic
1163111771 19:15165675-15165697 TTTTTCTCATTTGGAAAATGGGG - Intronic
1163966061 19:20748571-20748593 TTTGTCTTTTTTGGAAATTCTGG + Intronic
1164557346 19:29263716-29263738 GTTTCCTCATCTGGAAAATGGGG - Intergenic
1166092295 19:40517797-40517819 GTTTCCTCATCTGGAAAATGGGG - Intronic
1166225602 19:41393119-41393141 TTTCTCTCATTTGTAAAATGGGG + Intronic
1166261134 19:41642009-41642031 TTTACCTAATTTGTAAAATGTGG + Intronic
1166520979 19:43479825-43479847 TTTTGCTCATTTGTAAAATGGGG - Intronic
1166717319 19:44976827-44976849 TTTGCCTCATCTGCAAAATGGGG + Intronic
1167143109 19:47665785-47665807 TTTATCTCATCTGGAAAATGGGG + Intronic
1167153364 19:47722893-47722915 GTTTCCTCATCTGGAAAATGGGG + Intronic
1167849860 19:52193135-52193157 GTTTCCTCATCTGGAAAATGTGG - Intronic
1202691404 1_KI270712v1_random:97443-97465 TTTCCTACATTTGGAAAATGGGG + Intergenic
925020699 2:565440-565462 GTTTCCTCATCTGGAAAATGGGG - Intergenic
925810824 2:7698769-7698791 GTTCACTCATTTGGAAAATAAGG - Intergenic
926158429 2:10471115-10471137 TTTTCCTCATCTGTAAAATGGGG + Intergenic
926274242 2:11391500-11391522 GTTGCCTCATCTGTAAAATGGGG - Intergenic
926473985 2:13299200-13299222 GTTTCCTCATTTGTAAAATATGG + Intergenic
926704541 2:15827352-15827374 TTTGCCTCATTACGTAAAACGGG + Intergenic
926886865 2:17606035-17606057 GTTTCCTCATTTGTAAAATGGGG - Intronic
926887436 2:17611214-17611236 ATTGCCTCATCTGTAAAATGGGG - Intronic
927226700 2:20773232-20773254 GTTTCCTCATTTGTAAAATGGGG - Intronic
927365890 2:22295847-22295869 TTTGTCTCATTTCAAAAACCTGG - Intergenic
927702283 2:25276117-25276139 GTTTCCTCATCTGGAAAATAAGG + Intronic
927905564 2:26853457-26853479 GTTGCCTCATTTGTAAAATGAGG - Intronic
928200397 2:29244275-29244297 GTTTCCTCATTTGTGAAATCAGG + Intronic
928402552 2:30989784-30989806 GTTTCCTCTTTTGGAAAATAGGG - Intronic
928877858 2:36062065-36062087 TTTGCCTCCTTTGGTAACTTGGG - Intergenic
929241103 2:39654296-39654318 GTTTCCTCATTTGTAAAATGGGG + Intergenic
929254692 2:39797290-39797312 TTTGCCTCATTTTACAGATCAGG + Intergenic
929427082 2:41854631-41854653 ATTGCCTCATCTGTAAAATGGGG - Intergenic
929547587 2:42865799-42865821 GTTTCCTCATTAGTAAAATCGGG + Intergenic
929865179 2:45711438-45711460 ATTGCCTCATCTGTAAAATGGGG + Intronic
930056386 2:47255309-47255331 GTTTCCTCATCTGGAAAATGGGG + Intergenic
931050618 2:58410108-58410130 GTAACCACATTTGGAAAATCAGG - Intergenic
931173225 2:59827097-59827119 GTTTCCTCATTTGTAAAATGAGG - Intergenic
931214691 2:60229914-60229936 TTTTCCTCATTTATAAAATGAGG - Intergenic
931643673 2:64403111-64403133 TCGGTCTCATTTGGAAAATGTGG + Intergenic
931715083 2:65022409-65022431 TTTACCCCATTTGTAAAATGGGG + Exonic
931769916 2:65488580-65488602 TTTTTCTCATTTGTAAAATGGGG + Intergenic
932618613 2:73252228-73252250 CTTGCCTCATCTGTAAAATCGGG + Intronic
932774552 2:74519865-74519887 TTTCCCCTCTTTGGAAAATCTGG + Intronic
932806158 2:74785246-74785268 ATTTCCTCATTTGTAAAATGAGG + Intergenic
932943954 2:76204866-76204888 GTTTCCTCATTTGTAAAATGGGG + Intergenic
933183819 2:79256792-79256814 GTTTTCTCATTTGGAAAATGAGG + Intronic
933312482 2:80677849-80677871 GTTTCCTCATTTGTAAAATGGGG + Intergenic
933954987 2:87356507-87356529 TTTCCTACATTTGGAAAATGGGG - Intergenic
934179058 2:89603585-89603607 TTGTCCTCATTTGGAAAAGGAGG - Intergenic
934239177 2:90252721-90252743 TTTCCTACATTTGGAAAATGGGG - Intergenic
934274007 2:91563977-91563999 TTTCCTACATTTGGAAAATGGGG + Intergenic
934289344 2:91677855-91677877 TTGTCCTCATTTGGAAAAGGAGG - Intergenic
934323297 2:91985269-91985291 TTTCCTACATTTGGAAAATGGGG - Intergenic
934461616 2:94216075-94216097 TTTCCTACATTTGGAAAATGGGG - Intergenic
934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG + Intronic
935027387 2:99290218-99290240 TCTGTCTCCTTTGTAAAATCTGG - Intronic
935117362 2:100147851-100147873 TTTTCCTCATTGGTAAAATGAGG - Intergenic
935369552 2:102330622-102330644 TTTTCCTCATTTTAAAAATTGGG + Intronic
935380695 2:102448285-102448307 TTAGCCTCATCTGTAAAATGAGG + Intronic
935771370 2:106425506-106425528 GTTGCCTCATATGTAAAATGAGG - Intronic
935787555 2:106562771-106562793 TTTGACTTATTTGGAAAAGAAGG + Intergenic
935908703 2:107870443-107870465 GTTGCCTCATATGTAAAATGAGG + Intronic
935995108 2:108762661-108762683 GTTGCCTCATATGTAAAATGAGG + Intronic
936130486 2:109835557-109835579 GTTGCCTCATATGTAAAATGAGG + Intronic
936175535 2:110216906-110216928 CTTGACTCATTTGTAAAATAAGG + Intergenic
936214211 2:110535928-110535950 GTTGCCTCATATGTAAAATGAGG - Intronic
936328007 2:111522257-111522279 GTTGCCTCATCTGTAAAATGGGG - Intergenic
937030318 2:118733433-118733455 GTTTCCTCATCTGGAAAATGGGG + Intergenic
937635605 2:124152369-124152391 GTTTTCTCATTTGCAAAATCCGG - Intronic
937837879 2:126492119-126492141 TTTGCTTCATTTTGAAAACATGG - Intergenic
937850113 2:126624374-126624396 GTTTCCTCATCTGGAAAATAAGG - Intergenic
938554278 2:132409962-132409984 TTTGGCCCATTTAGAAAATGGGG + Intergenic
939005191 2:136778697-136778719 TTTTCCTCATTAAAAAAATCTGG + Intronic
939089841 2:137767074-137767096 TTTGCATTATTTGGGAAAACTGG + Intergenic
939272082 2:139952438-139952460 TTTTACTCATTTGAGAAATCAGG - Intergenic
939368015 2:141259766-141259788 TTTGCCTCATCTCTAAAATGGGG + Intronic
939536427 2:143436624-143436646 TTTTCCTCATTAAGAAAATGAGG - Intronic
939679509 2:145112900-145112922 TTTTCTTCATTTGTAAAATGTGG + Intergenic
939880184 2:147622636-147622658 GTTTCCTCATTTGTAAAATGTGG - Intergenic
939986368 2:148833329-148833351 GTTTCCTCATTTGTAAAATGGGG + Intergenic
940150630 2:150596766-150596788 TTTGCTTGATTTGAAAAATTGGG - Intergenic
940875239 2:158891700-158891722 TTTTCCTCATCTGTAAAATAAGG + Intergenic
940963888 2:159816406-159816428 ATTTCCTCATGTAGAAAATCAGG - Intronic
941727831 2:168883570-168883592 TTTTGCTCATTTGTAAAATGGGG + Intronic
942076350 2:172360066-172360088 GTTTCCTCATTTGTAAAATAGGG + Intergenic
942089680 2:172477755-172477777 GTTTCCTCATTTGTAAAATAAGG - Intronic
942165831 2:173240136-173240158 GTTTCCTCATTTGCAAAATGGGG - Intronic
942322388 2:174747008-174747030 ATTTTCTCATTTGGAAAATAGGG + Intergenic
942559440 2:177204843-177204865 TTTGGCTCATTTGTAAATTAAGG - Intergenic
942714527 2:178876318-178876340 CTTTCCTCCTTTTGAAAATCAGG - Intronic
943055878 2:182978420-182978442 TTTGACAGATTTGGAAACTCTGG - Intronic
943060166 2:183034871-183034893 TTTTCCTCATCTGTAAAATGGGG - Intronic
943513027 2:188850145-188850167 GTTTCCTCATTTGTAAAATGTGG + Intergenic
943619744 2:190135677-190135699 GTTTCCTCATTTGAAAAATAGGG + Intronic
943746351 2:191466332-191466354 ATTTCCTCTTTTGGAATATCAGG - Intergenic
944044577 2:195394403-195394425 TTTGCCTAATTTCTAAAAACCGG - Intergenic
944062532 2:195584185-195584207 TTTGATTCATTTTGAATATCAGG + Intronic
944340353 2:198589007-198589029 TTTTCCTCATCTGTAAAATGGGG + Intergenic
944464352 2:199985165-199985187 TTTTCCTCATCTGTAAAATGGGG + Intronic
945142576 2:206702690-206702712 TTTACTTCATTTGTAAAATAAGG + Intronic
945253136 2:207781139-207781161 GTTTCCTCATCTGTAAAATCGGG - Intergenic
945276463 2:207992294-207992316 GTTTCCTCATTTGTAGAATCAGG + Intronic
945665665 2:212738477-212738499 GTTTCCTCATCTGGAAAATGGGG + Intergenic
945693015 2:213065665-213065687 GTTTCCTCATTTGTAAAATGAGG - Intronic
945697922 2:213132101-213132123 GTTACCTCATTTGTAAAATAGGG - Intronic
945797687 2:214385236-214385258 AGTGCCTCATTTGTAAAATGGGG + Intronic
946005101 2:216518259-216518281 TTTTCCTCATCTGTAAAATGGGG - Intronic
946675914 2:222159015-222159037 TGTGCCTCATCTGTAAAATAAGG + Intergenic
947847183 2:233254001-233254023 TTTGCCTCATCTATAAAATGGGG + Intronic
947906999 2:233772152-233772174 TTTCCCAAGTTTGGAAAATCTGG + Intronic
947924462 2:233909054-233909076 TGTGCCTCAGTTGTAAAATGAGG + Intergenic
947944589 2:234090736-234090758 TTTTCCTTATTTGTAAAATTGGG - Intergenic
1168812967 20:718216-718238 GTTTCCTCATTTGCAAAATGGGG + Intergenic
1168959452 20:1858812-1858834 TTTTCCTCATCTGTAAAATGGGG - Intergenic
1168972814 20:1942428-1942450 TTTGCCTGTTTTTGAACATCAGG - Intergenic
1169154309 20:3316435-3316457 GTTTCCTCATTTGTAAAATGAGG + Intronic
1169189130 20:3646121-3646143 GTTTCCTCATTTGTAAAATGGGG - Intronic
1169498878 20:6140369-6140391 ACTGCCTCATTTGTAAAATGGGG - Intergenic
1169725371 20:8723677-8723699 CTTGACTCATTTGTAAAATTAGG - Intronic
1170033131 20:11963066-11963088 ATTTCCTCATTTGTAAAATTTGG + Intergenic
1170137789 20:13094264-13094286 TTTTCCTCATCTGTAAAATGAGG + Intronic
1170159862 20:13299775-13299797 TTTGCCTCTCTTTGAAACTCTGG - Exonic
1170952509 20:20949812-20949834 TTTTCCTCATCTGCAAAATGAGG + Intergenic
1170971191 20:21118053-21118075 TTTTCCTCATTTCTAAAATGAGG - Intergenic
1172105784 20:32516647-32516669 GTTGCCTCATCTGTAAAGTCAGG - Intronic
1172210272 20:33192973-33192995 GTTTCCTCATCTGTAAAATCAGG + Intergenic
1172276302 20:33681484-33681506 GTTGCCTTATCTGGAAAATGGGG - Intronic
1172632530 20:36388670-36388692 TGTGCCTCATTTGTTAAATTGGG + Intronic
1172672205 20:36642281-36642303 TTTTCCTCATCTGAAAAATGGGG + Intronic
1172745212 20:37202230-37202252 TTTGTCTTGTTTGGAAATTCAGG + Intronic
1172876556 20:38167911-38167933 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1173054902 20:39602461-39602483 TTTGCTTCCTTTTCAAAATCAGG + Intergenic
1173215008 20:41072912-41072934 TTGGCTTCCTTTGGAAAGTCAGG + Intronic
1173269343 20:41517755-41517777 TTTTCCTCATCTGGAATATGGGG - Intronic
1173378474 20:42512791-42512813 TCTACCTCATTTAAAAAATCAGG + Intronic
1173706466 20:45114046-45114068 TTTTCCTCATCTGCAAAATGGGG + Intronic
1174383247 20:50171095-50171117 GTTTCCTCATTTGGAAAACAGGG + Intergenic
1174773164 20:53320244-53320266 GTTTCCTCATTTGAAAAAACAGG - Intronic
1175043436 20:56078288-56078310 CTTTCCTCATTTGCAAAATGTGG + Intergenic
1175189284 20:57200243-57200265 TGTGTCTCATCTGGAAAATGGGG - Intronic
1175202618 20:57288550-57288572 TTTTCCTCATCTGGAAAATAGGG + Intergenic
1175395455 20:58656137-58656159 TTTGCCTCATTTGTAAACTGAGG + Intronic
1175575144 20:60055456-60055478 GTTCCCTCATTTGTAACATCAGG + Intergenic
1175681716 20:60994192-60994214 GTTTCCTCATTTGTAAAATTAGG + Intergenic
1176865937 21:14055233-14055255 TTTCCTACATTTGGAAAATGGGG + Intergenic
1177145451 21:17402566-17402588 TTTTCTTCAATTGGAAAATGAGG + Intergenic
1178124098 21:29498971-29498993 TTTGCCTCATTTGGAAAATCAGG + Intronic
1178299477 21:31440029-31440051 TTTCCCTCGTTTGGTAAAACAGG + Intronic
1179336841 21:40464571-40464593 TTTTCCTCACTTGCAACATCAGG + Intronic
1180241952 21:46514718-46514740 TTTTCCTCAGATGGAAAAACAGG - Intronic
1181298031 22:21857827-21857849 TTTTCCTCATCTGTAAAAACCGG + Intronic
1181354632 22:22290681-22290703 TTTCCTACATTTGGAAAATGGGG + Intergenic
1181471147 22:23140869-23140891 GTTTCCTCATTTGTAAAATGTGG - Intronic
1181526877 22:23494769-23494791 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1181911573 22:26242406-26242428 GCTTCCTTATTTGGAAAATCGGG + Intronic
1182572597 22:31249934-31249956 GTTGCCTCATCTGTAAAATGGGG - Intronic
1182580528 22:31306977-31306999 TTTCCCCCATTTTAAAAATCAGG + Intergenic
1182779669 22:32857827-32857849 TTATCCTCATCTGGAAAATGGGG + Intronic
1182807662 22:33088835-33088857 TTTTTCTCATCTGGAAAATGGGG + Intergenic
1182896912 22:33866575-33866597 ATTTCCTCATTTGTAAAATGGGG + Intronic
1184218791 22:43085722-43085744 TTTTCCTCATCTGTAAAATGCGG - Intronic
1184584477 22:45438334-45438356 TTTGCCTTTTTTGAAAAGTCAGG - Intergenic
1184802985 22:46773838-46773860 GTTTCCTCATTTGTAAAATAGGG - Intronic
1184813651 22:46854262-46854284 CTTTCCTCATTTGTAAAATGGGG + Intronic
949537559 3:5007521-5007543 GTTGCCCCATTTGTAAAATGGGG + Intergenic
949635691 3:5979316-5979338 GTTGCCTCATTTGGAAAATGGGG - Intergenic
949669118 3:6377816-6377838 GTTTCCTCATTTGGCAAATGGGG + Intergenic
949801854 3:7912839-7912861 GTTTCCTCATTAGCAAAATCGGG + Intergenic
949851577 3:8426028-8426050 TTTGCTTCATCTGCAAAATGTGG - Intergenic
950010620 3:9720923-9720945 TATTCCTCATTTGTAAAATGAGG + Intronic
950147888 3:10664784-10664806 TTTGCCTGATTTGGGAAAGAAGG + Intronic
950264040 3:11561677-11561699 TTTTCCCCATCTGGAAAATAAGG - Intronic
950317539 3:12017354-12017376 GTTTCCTCATTTGTAAAATTAGG - Intronic
951127314 3:18998752-18998774 TTTTCCTCATCTGTAAAATGGGG + Intergenic
951800401 3:26589480-26589502 GTTTCCTCATTTGTAAAATGAGG - Intergenic
951985466 3:28615066-28615088 TTTTCCTCATCTGTAAAATGGGG - Intergenic
952353496 3:32563233-32563255 TTTGCTTTATTTGTAAAATCAGG - Intronic
952499228 3:33944262-33944284 TTTGCCTAATTTAGTAAATTAGG + Intergenic
952665380 3:35897836-35897858 TTTTTCTCATTTGTAAAATGGGG - Intergenic
953139374 3:40213249-40213271 TTGGCCTCATTTGTAAAATGGGG + Intronic
954426536 3:50446343-50446365 GTTGCCTCATCTGTAAAATAAGG - Intronic
954857120 3:53653795-53653817 TTCATCACATTTGGAAAATCTGG - Intronic
955014674 3:55058865-55058887 ATTGCCTCATCTGTAAAATCAGG + Intronic
955056837 3:55462414-55462436 TTTGCTTCATCTGTAAAATGAGG + Intergenic
955107017 3:55908178-55908200 TTTGCTTCTTTTGATAAATCAGG - Intronic
955169947 3:56553493-56553515 TTTGGCTCATTTTTAAAATTGGG + Intergenic
955356105 3:58234439-58234461 TGTTCCTCATTTGTAAAATAGGG + Intergenic
955804671 3:62721816-62721838 GTTTCCTCATTTGCAAAATGCGG - Intronic
955983528 3:64550402-64550424 TTAGCCTCTCTTGAAAAATCAGG + Intronic
956144883 3:66182612-66182634 GTTGCCTCATCTGTAAAATAGGG - Intronic
956149121 3:66222625-66222647 CTTCCCTCATTTGGAAAATTAGG - Intronic
956169310 3:66420116-66420138 CTTGGCTCATTTTAAAAATCAGG - Intronic
956431850 3:69194643-69194665 TTTTCCTCATCTGTAAAATGGGG - Intronic
956525494 3:70155178-70155200 TTTTCCTCATTTGTAAAGTATGG + Intergenic
956884299 3:73543397-73543419 TTTGCCTCATTTGTAGAAGAGGG - Intronic
956914292 3:73854741-73854763 TTTTCCTCATTTGTAAAATGTGG - Intergenic
956948293 3:74249921-74249943 TTATCCTCATTTGGAAGATTAGG + Intergenic
957136538 3:76295803-76295825 ATTACCTCATTTAAAAAATCAGG + Intronic
957211528 3:77265190-77265212 GATGCCTCAATTGGAAAATGGGG - Intronic
957530877 3:81439449-81439471 TTTTCTTTATTTGGAAAATAAGG - Intergenic
957538363 3:81535062-81535084 TTTTCCTCATCTGAAAAATGAGG - Intronic
958555500 3:95670659-95670681 TTATCCTCATTTGGCAAATGAGG + Intergenic
958907704 3:99960302-99960324 TTTTCCTCATCTGTAAAATGGGG - Intronic
959384334 3:105683245-105683267 TTTTCCCCCTTTGGAACATCAGG - Intronic
959944121 3:112109789-112109811 TTTTTCTCATTTGTAAAATAAGG - Intronic
960467294 3:118013085-118013107 ATTGCCTCATTTTGTAAATGAGG + Intergenic
961136328 3:124514586-124514608 TTTTCCTCATCTGCAAAATGAGG - Intronic
961800454 3:129444434-129444456 GTTTCCTCATTGGTAAAATCGGG + Intronic
962130492 3:132668609-132668631 GTTGCCTCATTTTAAAAATAAGG + Intronic
962215507 3:133517452-133517474 GTTTCCTCATTTGTAAAATGGGG + Intergenic
962218646 3:133544355-133544377 GTTTCCTCATTTGTAAAATGAGG + Intergenic
963097765 3:141563666-141563688 TTTTCCTCATTTGTCAAATAAGG - Intronic
963342594 3:144055033-144055055 TTTGCCTAATTGGGAAAATAAGG + Intergenic
963486374 3:145939202-145939224 TTTGCTTCATATAGAAAATTTGG + Intergenic
964122904 3:153205268-153205290 GTTTCTTCATTTGGAAAATAAGG + Intergenic
964555658 3:157935180-157935202 TCTGACTCTTTTGGAAAAGCAGG - Intergenic
964649228 3:158992217-158992239 GTTTCCTCATTTGGCAAATGAGG + Intronic
964775776 3:160275058-160275080 ATTTCCTCATTTGTAAAATGGGG + Intronic
964877793 3:161388441-161388463 GTTTCTTCATTTGTAAAATCAGG + Intergenic
965213959 3:165835345-165835367 TGTCCCTTATTTTGAAAATCTGG - Intronic
965589922 3:170352651-170352673 TTTTCCTCATCTGTAAAATGGGG + Intergenic
965856523 3:173095145-173095167 GTTTCCTCATTTGCAAAATGAGG + Intronic
965856524 3:173095149-173095171 TTAGCCTCATTTTGCAAATGAGG - Intronic
966811355 3:183847749-183847771 ATTCCCTCATTTGTAAAATGAGG + Intronic
966841299 3:184090398-184090420 ATATCCACATTTGGAAAATCTGG - Intergenic
967305233 3:188052668-188052690 TTTTCCTCATCTGGAAGATGGGG + Intergenic
967604636 3:191431002-191431024 TAAGACTCATTTGGAAAATCAGG - Intergenic
967797602 3:193614472-193614494 TTTTCCTCATCTGTAAAATGAGG + Intronic
968432985 4:569711-569733 TCTGCCTCATTTGAAAAGGCTGG + Intergenic
969067735 4:4501520-4501542 GTTTCCTCATCTGGAAAATGAGG + Intronic
969265473 4:6061629-6061651 GTTTCCTCATTCGGAAGATCGGG + Intronic
969637199 4:8376273-8376295 TTTTCCTAATTTAAAAAATCTGG - Intronic
969962835 4:10962959-10962981 GTTTCCTCATTTGTAAAATGTGG + Intergenic
970027394 4:11637966-11637988 CTTTCCTCATTTTGAAAATGGGG + Intergenic
970498209 4:16649646-16649668 GTTCCCTCATTTGTAAAATGGGG + Intronic
971044009 4:22784525-22784547 ATTTCTTCATTTGTAAAATCGGG + Intergenic
971861590 4:32112820-32112842 GTTTCCTCATTTCCAAAATCTGG - Intergenic
973166783 4:47087784-47087806 TTTTCCTTATCTGGAAAATGAGG + Intronic
973760594 4:54111279-54111301 CTTGCCTCATTTGTAAAATAAGG + Intronic
973819673 4:54651929-54651951 GTTTCCTCATTTGCAAAATGGGG + Intergenic
973870672 4:55162749-55162771 ATTTCCTCATCTGGAAAATTGGG - Intergenic
974341993 4:60626001-60626023 TTTCCCACATTTGAAAAAACTGG - Intergenic
974760963 4:66272745-66272767 GTTGTTTCATTTGAAAAATCAGG + Intergenic
975337220 4:73192925-73192947 TTTCCTTCCTTTTGAAAATCAGG + Intronic
975603746 4:76130919-76130941 ATTTCCTCATTTGTAAAATAGGG - Intronic
975701746 4:77074566-77074588 TTTTCCTCATCTGTAAAATGAGG + Intronic
975764538 4:77653835-77653857 TTTTCCTCATCTGGACAATTAGG - Intergenic
976174789 4:82340215-82340237 TTTTCCTCATCTGTAAAATGGGG + Intergenic
976204131 4:82608622-82608644 GTTTCCTCATTTGTAAAATGGGG - Intergenic
976218695 4:82738875-82738897 TTTGCCTCATCTGTAAAATGGGG - Intronic
976537471 4:86235176-86235198 ATTCCTTCATTTGGAAAATGAGG - Intronic
976734008 4:88292320-88292342 TGTGCCTCATCTGTAAAATGGGG - Intergenic
976896871 4:90123446-90123468 ATTACATCATTTGGTAAATCCGG + Intergenic
976946525 4:90776739-90776761 GTTTCCTCATTTGTAAAATGGGG - Intronic
977172054 4:93775246-93775268 TTTCCCTGATTTGTAAAATGAGG - Intergenic
977554656 4:98476661-98476683 TTTTCCTTATTTGTAAAATAGGG - Intronic
977665537 4:99643264-99643286 TTTTCCTCATCTGTAAAATGGGG - Intronic
977778798 4:100955846-100955868 TTTTCCTCATTTATAAAATTAGG - Intergenic
977858834 4:101930674-101930696 GTTTCCTCATTTGTAAAACCTGG - Intronic
977888735 4:102282048-102282070 GTTCCCTCATTTGTAAAATGGGG - Intronic
978074284 4:104509766-104509788 TTTTCCTTATCTGGAAAATGGGG - Intergenic
978496659 4:109366711-109366733 TTTCCCTCATTTGGTGAATGAGG + Intergenic
978532078 4:109725456-109725478 TTTGCTTTATTTGTAAAAACTGG - Intronic
978602312 4:110441712-110441734 GTTACCTCATTTCTAAAATCAGG - Intronic
978628585 4:110716364-110716386 GTTGCCTCATGTGCAAAATGGGG + Intergenic
978720392 4:111900864-111900886 TTTGGCACATTTAAAAAATCAGG - Intergenic
979034382 4:115694897-115694919 TTTTTCACATTTGGAAAGTCTGG + Intergenic
979234374 4:118383454-118383476 GTTTCCTCATTTGTAAAATGAGG - Intergenic
979289876 4:118967620-118967642 TTTGCCTCACTTGGGGAAACGGG + Intronic
979320291 4:119315476-119315498 TTTTTCTCATTTGAAAAATGGGG - Intergenic
979763635 4:124437696-124437718 TCTTCCTCATTTGGAGAATTAGG - Intergenic
980211413 4:129792981-129793003 GTTTCCTCATTTGTAAAATAGGG - Intergenic
980225018 4:129971679-129971701 ATTTCCTCAATTGGACAATCTGG - Intergenic
980841686 4:138268939-138268961 GTTCCCTCATTTGTAAAATAGGG - Intergenic
981057239 4:140375389-140375411 GTTTCCTCATTTGTAAAATGTGG - Intronic
982064882 4:151645419-151645441 TTTTCCTCATTTGGATCAGCAGG + Intronic
983233603 4:165154364-165154386 TTTGCCTGGTTTGGATAATTGGG + Intronic
983237195 4:165192979-165193001 TTTTCCTCATCTGGAAAATGGGG + Intronic
983524189 4:168743862-168743884 TGTGCTTGTTTTGGAAAATCTGG - Intronic
984249298 4:177312182-177312204 TATGCCTCATCTGTAGAATCAGG - Intronic
984689159 4:182706296-182706318 GTTGCCTCATTTGTGAAATAAGG + Intronic
985776154 5:1843515-1843537 TATGCCTCAATTAGAAAAGCAGG + Intergenic
986417319 5:7542186-7542208 TTTGGACCATTTGGAACATCAGG - Intronic
986564950 5:9103209-9103231 ATTTTCTCATTTGGAAAATCAGG + Intronic
986603460 5:9497670-9497692 TTTTCCTCATCTGTAAAATGAGG - Intronic
986906231 5:12496399-12496421 TTTTGCTCATTTTTAAAATCAGG - Intergenic
987031766 5:13982949-13982971 TATGCCCCTTTTGGGAAATCAGG - Intergenic
987210116 5:15672964-15672986 TTTCACTCATCTGGAAAATCTGG - Intronic
987215239 5:15729850-15729872 TTTTTCTCATTTGTAAAATGGGG - Intronic
987322493 5:16783675-16783697 TTTGCCTCATTTGCCAAAAGAGG - Intronic
987877689 5:23700362-23700384 TTTGCTTGATTTGGAAAATAAGG - Intergenic
988421376 5:31009996-31010018 TTTTCCTTATTTGAAAAATGGGG - Intergenic
988728352 5:33945736-33945758 TTTGCCTCATGAGGAAACTGAGG + Intronic
989005558 5:36807895-36807917 TTTTCCTCATCTATAAAATCAGG + Intergenic
989030167 5:37110704-37110726 CTTTCCTCATTTGCAAAATGGGG - Intronic
989726531 5:44593834-44593856 TTTGCCTCACTTGGCAAATGAGG - Intergenic
989748468 5:44860862-44860884 GTTGCCTCATTTGTAAAACTGGG - Intergenic
989796573 5:45481883-45481905 TTTTCCTCATTTATAAAATGGGG + Intronic
991410252 5:66338656-66338678 TTTGCCTTATTTGGAAGAGGAGG + Intergenic
991532049 5:67626313-67626335 TTTGGCTCATTTTTAAAATCAGG + Intergenic
991992994 5:72359915-72359937 GTTTCCTCATTTGGTAAATGGGG + Intronic
992429117 5:76690434-76690456 GTTGCCACATTTGTACAATCAGG + Intronic
993088197 5:83391133-83391155 TTTTCCTCATTTGTAAAATGTGG + Intergenic
993447763 5:88035483-88035505 TTTAGCTCATTTAAAAAATCAGG - Intergenic
993520391 5:88892323-88892345 GTTTCCTCATTTGTAAAATGTGG + Intronic
993933353 5:93970857-93970879 TTGGGCTCATTTGTGAAATCAGG - Intronic
994255110 5:97583706-97583728 GTTGCCTTCCTTGGAAAATCAGG + Intergenic
994474866 5:100253995-100254017 TTTATTTCATTTGGAAAATAAGG + Intergenic
995261631 5:110110839-110110861 CTTTCCTCATTTGTAAAATATGG + Intergenic
995390727 5:111638011-111638033 ATTTCCTTATTTGCAAAATCAGG - Intergenic
995531932 5:113100237-113100259 TCTTCCTCATTTGAAAAATATGG - Intronic
995949582 5:117694292-117694314 TTTGTCTCATTTGGAAAATATGG - Intergenic
996525180 5:124472108-124472130 TTTTCCTCATCTGTAAAATGGGG + Intergenic
996633978 5:125668533-125668555 TTTTCCTCATTTGTAAAACGGGG + Intergenic
996734012 5:126742233-126742255 TTTGAGTCCTTTGTAAAATCTGG + Intergenic
996758535 5:126962332-126962354 ATTTCTTCATTTGGAAAATGAGG + Intronic
997386829 5:133480263-133480285 GTTTCCTCATCTGCAAAATCGGG + Intronic
997465287 5:134084005-134084027 TTTTCCTCATCTGTAAAATAGGG + Intergenic
998135472 5:139671970-139671992 GTTGCCTCATCTGTAAAATGAGG + Intronic
998180098 5:139931093-139931115 GTTTCCTCATATGGAAAATGAGG + Intronic
998560886 5:143170677-143170699 TATGCCTCATGTGCAAAATGTGG - Intronic
998611528 5:143694388-143694410 TTTTCTTCAATTGGAAGATCTGG + Intergenic
998831868 5:146168195-146168217 TCTTCTTCATCTGGAAAATCAGG + Exonic
998968735 5:147568552-147568574 TTTAGTTTATTTGGAAAATCAGG + Intergenic
999263679 5:150253062-150253084 TTTTCCTCATCTATAAAATCAGG + Intronic
999453877 5:151698761-151698783 TTTTGCTCATTTGTAAAATGAGG + Intergenic
999498340 5:152122475-152122497 TTTGCCTCATCTGAAAAATGGGG - Intergenic
999528871 5:152439472-152439494 TTTCCCTCATTTGTGAAATAGGG - Intergenic
999711118 5:154319503-154319525 TTTTCCTCATCTGGAAAATGGGG + Intronic
999742753 5:154568976-154568998 GTTTCCTCATTTGTAAAATGAGG + Intergenic
999822414 5:155241114-155241136 TTTCTCTCATCTGGAAAATGAGG + Intergenic
999823842 5:155255435-155255457 ATTCCCTCATTTGTAAAATGAGG - Intergenic
999877513 5:155824279-155824301 GTTGCCTCATTTGTAAAATGGGG + Intergenic
1000021097 5:157320163-157320185 TTTTCCTCATTTGTAAAATGGGG + Intronic
1000054657 5:157594555-157594577 TTTGCCTCATTTCCAAATTTTGG + Intergenic
1000241257 5:159410471-159410493 TTTGCATAATTTGGAATCTCAGG + Intergenic
1000385264 5:160669356-160669378 GTTCCCTCATCTGGAAAATGGGG - Intronic
1000445477 5:161313754-161313776 GTTCCCTCATTTGTAAAATGGGG - Intronic
1000692287 5:164338557-164338579 TTTTCTTCATCTGGAAAATAAGG + Intergenic
1000899803 5:166899000-166899022 GTTTTCTCATTTGTAAAATCTGG + Intergenic
1000990598 5:167908015-167908037 GTTTCCTCATTTGTAAAATGAGG + Intronic
1001098909 5:168797773-168797795 TTTTCCTCATCTGCAAAATGGGG - Intronic
1001132035 5:169072354-169072376 TTTGCCTCATTTGACAGATGAGG - Intronic
1001196790 5:169680214-169680236 TTTTCTTCATTTGTAAAATGGGG + Intronic
1001589739 5:172857187-172857209 GTTTCCTCATTTGTAAAATGGGG + Intronic
1001679581 5:173546320-173546342 TTCGCCTCATTAGAAAGATCCGG + Intergenic
1001872779 5:175171188-175171210 GTTTCCACATTTGGAAAATAAGG - Intergenic
1001948475 5:175799298-175799320 TCTTCCTCATTTGTAAAATGTGG - Intronic
1003774718 6:9347437-9347459 TTTTTCTCATTTGTAAAATGAGG + Intergenic
1004083221 6:12416830-12416852 TTTGCCTTATTTGGAATACTCGG - Intergenic
1004673396 6:17818681-17818703 GTTTCCTCATTTTTAAAATCGGG - Intronic
1004724960 6:18302456-18302478 GTTTCCTCATTTGTAAAATATGG - Intergenic
1004742313 6:18473904-18473926 GTTGCCTCATCTAGAAAATTAGG + Intergenic
1005278300 6:24243427-24243449 TGTGCCTCATGTGGAAGATGAGG + Intronic
1005476059 6:26209145-26209167 TTTTCCACATTTGTAAAATAGGG - Intergenic
1005483972 6:26281832-26281854 TTTTCCACATTTGTAAAATAGGG + Intergenic
1006430048 6:33989853-33989875 TTTGCTTCATCTGTAAAATGGGG + Intergenic
1006785499 6:36664027-36664049 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1006837814 6:37009640-37009662 GTTTCCTCATTTGTAAAATGGGG + Intronic
1007185451 6:39967386-39967408 TTTGCCTATTTTTAAAAATCTGG - Intergenic
1007281281 6:40714153-40714175 GTTTCCTCATCTGGAAAATGGGG - Intergenic
1007405565 6:41634261-41634283 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1007449088 6:41929764-41929786 GTTTCCTCATTTGTAAAATAGGG - Intronic
1007486693 6:42185368-42185390 ATTTCCTCATCTGGAAAATGGGG - Intronic
1007871258 6:45041592-45041614 TTTTTCTGATTTGGAAAATTTGG - Intronic
1007910564 6:45509582-45509604 GTTTCCTCATCTGGAAAATGAGG - Intronic
1008054895 6:46936152-46936174 TTTTCCTCATCTGTAAAATGGGG - Intronic
1008421669 6:51307966-51307988 ATTTCCTCATTTGTAAAATGGGG + Intergenic
1008556125 6:52674475-52674497 CTTTCCTCATCTGGAAAATGAGG + Intronic
1008593085 6:53013303-53013325 TTTTCCTCATCTGTAAAATAAGG - Intronic
1008674674 6:53806915-53806937 TTTGCCTCATTTTGAAAAGCTGG - Intronic
1008714309 6:54270083-54270105 TTTTCCTTAATTGGAAACTCTGG + Intergenic
1008912756 6:56753465-56753487 TTTGCATCATCTGTAAAATAGGG + Intronic
1010002340 6:70959672-70959694 GTTTCCTCATCTGGAAAATGGGG + Intergenic
1010112907 6:72262973-72262995 TTTTCCTCATCTCTAAAATCAGG - Intronic
1010137886 6:72576439-72576461 TTTTGCTCATTTTAAAAATCAGG - Intergenic
1010979988 6:82361349-82361371 TTTGCCAGATTTGTTAAATCTGG + Intergenic
1011580485 6:88858635-88858657 GTTTCCTCATCTGGAAAATGGGG - Intronic
1011686939 6:89830870-89830892 TTTTCCTCATCTGTAAAATGGGG + Intronic
1011829047 6:91348084-91348106 TTTGCTTCATTTGTAAAGTGTGG + Intergenic
1013691500 6:112650357-112650379 ATTTCCTCAATTGGCAAATCAGG + Intergenic
1013980685 6:116124662-116124684 GTTTCCTCATTTGTAAAATAAGG - Intronic
1014015459 6:116525141-116525163 GTTCCCTCATTTGTAAAATGAGG + Intronic
1014222112 6:118808132-118808154 TTTCTCTCATTTGTAAAATAGGG + Intergenic
1014248109 6:119088961-119088983 TTTTCTTCATTTGTAAAATGAGG + Intronic
1014271580 6:119342492-119342514 GTTTCCTCATTTGTAAAATGAGG - Intronic
1014633102 6:123811587-123811609 GTTTCCTCATTTGAAAAATAGGG + Intronic
1014851966 6:126351682-126351704 TTTTCCTTTTTGGGAAAATCAGG + Intergenic
1014910474 6:127086827-127086849 CTTGCCTCTTTTGTAAAAACTGG + Intergenic
1015190259 6:130464471-130464493 GTTTCCTCATTTGGGAAATAGGG + Intergenic
1015491621 6:133833090-133833112 TTTTCCTCATTTGTAAAATGAGG - Intergenic
1016067109 6:139695541-139695563 TTTTCCTCATCTGTAAAATAAGG - Intergenic
1016401432 6:143685568-143685590 TTTTCCTCATTTATAAAATGGGG - Intronic
1016531961 6:145068399-145068421 TTTTCCTCATCTGGAAAACTAGG - Intergenic
1016601467 6:145866346-145866368 GCTTCCTCATTTGGAAAATGGGG + Intronic
1016642619 6:146366722-146366744 TTTTCCCCATTTTTAAAATCAGG + Intronic
1016772954 6:147872508-147872530 GTTTCCTCATTTGTAAAATGAGG - Intergenic
1017018628 6:150121857-150121879 TTTTCCTCATTTTAAAAATCAGG + Intergenic
1017674959 6:156803851-156803873 TTTTCCTCATCTGCAAAATAGGG + Intronic
1018001186 6:159580018-159580040 GTTTCCTCATCTGGAAAATGGGG - Intergenic
1018204108 6:161420800-161420822 CTTTCTTCATTTGTAAAATCAGG - Intronic
1018995240 6:168705382-168705404 GTTTCCTCATTTGCAAAATATGG - Intergenic
1019709374 7:2511328-2511350 TTGGCCTCATTTTGCAAATGAGG - Intergenic
1020258303 7:6515102-6515124 GTTTCCTCATTTGTAAAATGGGG + Intronic
1020766149 7:12323838-12323860 ATTCCCTCATTTGTAAAATGGGG - Intergenic
1021023176 7:15629921-15629943 TTTGCCTCACTTAGAACAGCTGG - Intronic
1021695050 7:23268311-23268333 GTTGCCTCATCTGCAAAATGGGG - Intronic
1021764070 7:23929305-23929327 GTTTCCTCATTTGCAAAATGTGG - Intergenic
1022206543 7:28169828-28169850 TATGCCATATATGGAAAATCAGG + Intronic
1022496128 7:30854240-30854262 CTTTCCTCATTTGTAAAATGTGG + Intronic
1022511400 7:30937049-30937071 TTTGCCTCATCTGGAATGCCTGG + Intergenic
1022660635 7:32363294-32363316 GTTTCCTCATTTGGAAAATGGGG - Intergenic
1023614234 7:42002850-42002872 TTTCCATCATCTGGAAAATGAGG + Intronic
1024385049 7:48741443-48741465 TTTGCTTTATTTGGAATAGCTGG + Intergenic
1025108828 7:56195621-56195643 TTGCCTTCACTTGGAAAATCAGG + Intergenic
1025736898 7:64157680-64157702 TTTGACTCATTTGGTAAGACAGG - Intronic
1026019989 7:66698855-66698877 TTTTCCTCATCTGGAAAATGGGG + Intronic
1026524726 7:71144063-71144085 ATTGCTGCATTTGGAAAATCTGG + Intronic
1026574304 7:71559503-71559525 TGAGCCTCAGTTGGAAAATGGGG + Intronic
1026880369 7:73903713-73903735 TTTTCCTCATCTGGAAAATGGGG - Intergenic
1027407382 7:77875970-77875992 GTTGCCTCAGTTATAAAATCAGG - Intronic
1027754723 7:82198215-82198237 GTTTCCTCATTTGTAAAATATGG - Intronic
1027818744 7:83015031-83015053 GTTTCCTCATTTGAAAAATGGGG - Intronic
1028124382 7:87095098-87095120 CTTTCCTCATTTGTAAAATAGGG - Intergenic
1028128370 7:87141527-87141549 TTGGCCTCTTTTGGAAAGACTGG - Intergenic
1028144104 7:87302970-87302992 TTTTCCTCATCTGCAAAATAAGG + Intergenic
1028164630 7:87523819-87523841 TTTTCCTCATTTGCAAAATGAGG + Intronic
1028239098 7:88397735-88397757 TTTTCCTCATCTGTAAAATGGGG + Intergenic
1028301141 7:89202661-89202683 ATTTCCTCATCTGGAAAATGAGG - Intronic
1028905009 7:96143769-96143791 CTTACCTAAATTGGAAAATCAGG - Intronic
1028913426 7:96232798-96232820 TTTTCCTCATCTCTAAAATCGGG - Intronic
1030575337 7:111279176-111279198 TTTACCCAATTTTGAAAATCTGG - Intronic
1030680862 7:112432586-112432608 ATTTCCTCATTTGTAAAATGGGG - Intronic
1030888008 7:114962730-114962752 TTTGTCTAATTTCGTAAATCTGG - Intronic
1031588974 7:123566829-123566851 ATTGCCTCGTTTGAAAAATAAGG - Intergenic
1032126938 7:129202221-129202243 GTTGCCTCATCTGTAAAATGGGG - Intronic
1032175604 7:129622331-129622353 TTTTCCCCATTTGAAAAATGAGG + Intronic
1032595334 7:133234006-133234028 GTTTCTTCATTTGTAAAATCGGG - Intergenic
1032984785 7:137325859-137325881 TTGGCCTCCTTTGGAAGATATGG + Intronic
1033156871 7:138964419-138964441 TTTTCCTCATCTGTAAAATGGGG + Intronic
1033221494 7:139529294-139529316 TTTTCCTCATCTTGAAAATGAGG - Intronic
1033802258 7:144915049-144915071 ATTCCCTCATTTGTAAAATAAGG + Intergenic
1033868531 7:145721326-145721348 TTTGCCTTTTTTGGTAAGTCTGG - Intergenic
1034217071 7:149415987-149416009 TTTTTCTCATTTGTAAAATTGGG - Intergenic
1035342980 7:158176390-158176412 CTTTCCTCATTTGCAAAATGTGG - Intronic
1035366268 7:158350857-158350879 TTTTTCCCTTTTGGAAAATCAGG - Intronic
1035974582 8:4293554-4293576 TGTGCCTAATTTGGAAGATAAGG - Intronic
1036201621 8:6775318-6775340 TTGGCCTCAGCTGTAAAATCAGG - Intergenic
1036701061 8:11014320-11014342 TGTGCCTGCTTTTGAAAATCTGG - Intronic
1037265494 8:17055096-17055118 TTTGCCAAATTTGGAAAACAAGG + Intronic
1037555314 8:20016637-20016659 GTTTCCTCATTTGTAAAATTAGG + Intergenic
1038352337 8:26788648-26788670 TTTTCCTCATTTGTAAAATGGGG - Intronic
1038426614 8:27468092-27468114 GTTTCCTCATTTGCAAAATGAGG - Intronic
1039164961 8:34668031-34668053 TTTTCCTCATCTGCAAAATAGGG - Intergenic
1039344049 8:36684428-36684450 GTTTCCTCATTTCTAAAATCAGG + Intergenic
1040584785 8:48728570-48728592 GTTTCCTCATCTGGAAAATGAGG + Intronic
1041325191 8:56655799-56655821 GTTGTCTCATTTGTAAAATTGGG - Intergenic
1041394924 8:57380467-57380489 ATTGGCTAATTTGGAAAATAGGG - Intergenic
1041748763 8:61236770-61236792 ATTTCCTCATTTGTAAAATGAGG - Intronic
1041754229 8:61295791-61295813 GTTTCCTCATTTGAAAAATGAGG + Intronic
1042281034 8:67056254-67056276 TTTGTCTCATCTGTAAAATAAGG + Intronic
1042450676 8:68941780-68941802 TTTTTCTCATTTGTAAAATTAGG + Intergenic
1042826167 8:72981948-72981970 TTTCCCTCATTTGGAATATGTGG + Intergenic
1043411147 8:79996974-79996996 TTTTCTTCATTTGGGAAATGTGG + Intronic
1044204869 8:89481716-89481738 TATGCAACATTTGGAAATTCAGG + Intergenic
1044388809 8:91624084-91624106 GTTTCCTCATTTGTAAAATGAGG - Intergenic
1044607918 8:94063147-94063169 TTAGTCTCATTTGTAAAATGAGG + Intergenic
1044729016 8:95215374-95215396 ATTTCCTCATCTGGAAAATGGGG + Intergenic
1044761205 8:95519705-95519727 GTTTCCTCATTTGTAAAATGCGG + Intergenic
1044817133 8:96124848-96124870 TTTTCCACATCTGGAAAATGGGG + Intergenic
1044818839 8:96141761-96141783 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1045008199 8:97934272-97934294 GTTGCCTCATCTGTAAAATGGGG + Intronic
1045258473 8:100550489-100550511 TTTGGCTCATTTTTAAAATCAGG + Intronic
1045468750 8:102492339-102492361 GTTTCCTCATTTGTAAAATAGGG - Intergenic
1045750832 8:105482062-105482084 TTTGCCATAATTGGTAAATCAGG - Intronic
1045772775 8:105763631-105763653 GTTTCCTCATCTGGAAAATGGGG - Intronic
1046132184 8:109979381-109979403 TTTTCCTCATCTGTAAAATGGGG + Intergenic
1046249314 8:111609715-111609737 TTTACCTCCTTTGGGGAATCAGG - Intergenic
1046465736 8:114600689-114600711 TTTGCCTATTTTTTAAAATCGGG - Intergenic
1046523393 8:115354360-115354382 ATTGGCTCACTAGGAAAATCTGG + Intergenic
1046726413 8:117679270-117679292 TATGCCTCATTTATAAAATAAGG + Intergenic
1046798423 8:118397758-118397780 TTTTCCTCATTTTTAAAATGGGG - Intronic
1046830226 8:118737635-118737657 TTTCACTCATTTGTAAAATTCGG + Intergenic
1047228479 8:122976188-122976210 GTTTCCTCATTTGCAAAATGGGG - Intergenic
1047232821 8:123011803-123011825 GTTTCCTCATCTGGAAAATGGGG + Intergenic
1047408678 8:124606467-124606489 TTGGCCTCATCTGTAAAATGAGG - Intronic
1047530055 8:125666176-125666198 TTTTCCTCATTTGTAAAATAGGG + Intergenic
1048027789 8:130602442-130602464 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1048437326 8:134430713-134430735 TTTTCCTTATTTGTAAAATGAGG + Intergenic
1048456930 8:134586903-134586925 TTTTCCTCATTGGTAAAATGGGG + Intronic
1050331630 9:4551743-4551765 CTTGCCTCATTTGCAACATCTGG + Intronic
1050418467 9:5438072-5438094 TCTGCCTCATCTCAAAAATCTGG - Intergenic
1050484612 9:6120715-6120737 TTTTACTCATTTGGCAAAGCAGG - Intergenic
1050641621 9:7674201-7674223 TTTTCCTCATTTGTAAAATGAGG - Intergenic
1051141472 9:13984102-13984124 ATTTCCTCATCTGGAAAATAGGG - Intergenic
1051152171 9:14094037-14094059 GTTTCCTCATCTGTAAAATCAGG - Intronic
1051185322 9:14454246-14454268 TTTTCCTCATTTGACAAGTCAGG - Intergenic
1051558041 9:18406869-18406891 TTTTCCTCATTTGTAAAACAGGG + Intergenic
1051570485 9:18551689-18551711 TGTGCCTCATTTTGCAAATGAGG - Intronic
1051681928 9:19616354-19616376 GTTTCCTCATCTGTAAAATCAGG - Intronic
1051869462 9:21720142-21720164 CTTGCCTCATTTGTGAAATGAGG + Intergenic
1052045335 9:23787536-23787558 ATTTCCTCATTTGAAAAATAGGG - Intronic
1053292312 9:36889268-36889290 ATTTCCTCATTTGTAAAATGGGG - Intronic
1053330594 9:37203189-37203211 ATTTCCTCATTTGTAAAATAGGG + Intronic
1053604846 9:39647133-39647155 GTTGTCTCACTTGCAAAATCAGG + Intergenic
1053692090 9:40591727-40591749 TTTCCTACATTTGGAAAATGGGG - Intergenic
1053862721 9:42403483-42403505 GTTGTCTCACTTGCAAAATCAGG + Intergenic
1054248695 9:62695282-62695304 GTTGTCTCACTTGCAAAATCAGG - Intergenic
1054272710 9:63045758-63045780 TTTCCTACATTTGGAAAATGGGG + Intergenic
1054303348 9:63392693-63392715 TTTCCTACATTTGGAAAATGGGG - Intergenic
1054402128 9:64719203-64719225 TTTCCTACATTTGGAAAATGGGG - Intergenic
1054435733 9:65203518-65203540 TTTCCTACATTTGGAAAATGGGG - Intergenic
1054494660 9:65818169-65818191 TTTCCTACATTTGGAAAATGGGG + Intergenic
1054562808 9:66729808-66729830 GTTGTCTCACTTGCAAAATCAGG - Intergenic
1054931328 9:70638370-70638392 GTTTCCTCATTTGGTAAATGGGG + Intronic
1055831513 9:80384714-80384736 ATTTCCTCATTTGAAAAATAAGG - Intergenic
1056286161 9:85089895-85089917 ATTTCCTCATGTGTAAAATCAGG + Intergenic
1056752127 9:89359715-89359737 TTTACCTCCTTTGGACAGTCTGG + Intergenic
1056875382 9:90324509-90324531 TTTGCCCAATTTTGAAAATTGGG + Intergenic
1057203049 9:93153612-93153634 TTTGGCTCATTTTAAAATTCAGG + Intergenic
1058009279 9:99958525-99958547 TTTTTCTCATTTGTAAAATAAGG - Intronic
1058100034 9:100908927-100908949 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1058939414 9:109799278-109799300 TTTGCCCCACTTGGAACACCTGG - Intronic
1059430602 9:114248028-114248050 GTTTCCTCATTTGCAAAATGAGG - Intronic
1059435353 9:114272737-114272759 GTTTCCTCGTTTGTAAAATCAGG - Intronic
1059715386 9:116908331-116908353 TTTTCCTCATCTGTAAAATGGGG + Intronic
1060570919 9:124639430-124639452 TTGGCCTCATTTGTAAAATCGGG - Intronic
1060695282 9:125704277-125704299 GTTTCCTCATCTGTAAAATCAGG + Intronic
1061069070 9:128297544-128297566 TTTACCTCATTTGGATAATGGGG - Intergenic
1061180799 9:129023958-129023980 GTTTCCTCATTTGGGAAATGGGG - Intronic
1061222090 9:129258232-129258254 TTTGCCTCATCTGATAAATGGGG - Intergenic
1061259784 9:129473713-129473735 GTTGCCTCATCTGTAAAATGGGG - Intergenic
1061490761 9:130942853-130942875 GTTGCCTCATCTAGAAAATGAGG - Intergenic
1061643894 9:131983179-131983201 TTTTCCTCATCTGTAAAATGGGG - Intronic
1061802901 9:133121699-133121721 GTTTCTTCATCTGGAAAATCTGG + Intronic
1186118082 X:6326234-6326256 TTTGGTCCATTTGAAAAATCGGG + Intergenic
1186427816 X:9478068-9478090 GTTTCCTCATCTGTAAAATCAGG + Intronic
1186685157 X:11917965-11917987 TTTGCCTCATTGTGACAATAGGG - Intergenic
1186696224 X:12035065-12035087 GTTGCTTCATTTGCACAATCAGG + Intergenic
1186723408 X:12330005-12330027 TTTTCCTTATTTGTAAAATGAGG + Intronic
1187717763 X:22120199-22120221 GTTTCCTCATCTGGAAAATGAGG - Intronic
1188735121 X:33703770-33703792 TTTTCTTCAGTGGGAAAATCTGG + Intergenic
1188760447 X:34022166-34022188 TTTGCCTCATTTTTAAAAAAAGG + Intergenic
1189300052 X:39945926-39945948 CTTTCCTCATTTGTAAAATGGGG + Intergenic
1189485671 X:41429598-41429620 TTTTCCTCTTTTGTAAAATGGGG + Intergenic
1189798180 X:44666005-44666027 TTTTCCCCATTTGGCAAATTTGG + Intergenic
1189810265 X:44774828-44774850 ATTTCCTCATCTGGAAAATGAGG - Intergenic
1189834828 X:45008876-45008898 ATTTCCTCATTCGGAAAATTGGG + Intronic
1190119026 X:47645355-47645377 ATTGCCTCATGTGGAAAATGGGG - Intronic
1190443244 X:50496724-50496746 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1190755723 X:53400154-53400176 TTTTCCTCATTTGTAAAATTAGG - Intronic
1190844604 X:54180746-54180768 GTTTCCTCATTTGGAAAACAGGG + Intronic
1191771556 X:64765795-64765817 GTTCCCTCATTTGTAAAATAGGG + Intergenic
1192043471 X:67647026-67647048 ATTTTCTCATCTGGAAAATCAGG + Intronic
1192044389 X:67656635-67656657 GTTTCCACATTTGTAAAATCAGG - Intronic
1192238049 X:69308544-69308566 TTTTCCTCATCTGCAAAATGGGG - Intergenic
1192364476 X:70459753-70459775 CTTTCCTCATTTGTAAAATGGGG - Intronic
1192592576 X:72372774-72372796 GTTTCCTCATCTGGAAAATGAGG + Intronic
1193102687 X:77633819-77633841 CTTGCCTGGTTTGGAAATTCTGG - Intronic
1193428895 X:81375745-81375767 ACTGCCTCATCTGTAAAATCAGG + Intergenic
1193811926 X:86062054-86062076 GATTCCTCATTTGGTAAATCTGG + Intergenic
1193931490 X:87558281-87558303 TTTCTCTCATTTGTAAAATGAGG + Intronic
1194289576 X:92053962-92053984 ATTTCCTCATTTGAAAAATGGGG - Intronic
1194514344 X:94832377-94832399 TTTTACTCATCTGGAAAATGGGG - Intergenic
1194915604 X:99704229-99704251 TTTGCCTCATTTTAAAGATGAGG - Intergenic
1194965536 X:100284671-100284693 TTTTCCTCATCTGTAAAATTAGG + Intergenic
1195129048 X:101837087-101837109 GTTTCCTCATTTGCAAAATGGGG - Intronic
1195177210 X:102322756-102322778 GTTTCCTCATTTGCAAAATGGGG + Intronic
1195181654 X:102364337-102364359 GTTTCCTCATTTGCAAAATGGGG - Intronic
1195203023 X:102567549-102567571 GTTTCCTCATTTGCAAAATGGGG + Intergenic
1195550718 X:106166767-106166789 TTTTACTCATTTTTAAAATCAGG - Intergenic
1195738312 X:108035960-108035982 TTTTCCTCATCTGTAAAATGAGG + Intergenic
1195829341 X:109038644-109038666 TTTGCCTCAGGTAAAAAATCTGG - Intergenic
1195904661 X:109831744-109831766 TTTTCCTCATATGCAAAATAGGG - Intergenic
1195950335 X:110265028-110265050 TAAGTCTAATTTGGAAAATCCGG + Intronic
1196394543 X:115245083-115245105 GTTTCCTCATTTGAAAAATAGGG + Intergenic
1196997296 X:121397954-121397976 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1197205211 X:123783991-123784013 TTTGCCCCTTTTTGAAAATTGGG - Intergenic
1197717612 X:129720635-129720657 GTTCCCTCATCTGGAAAATGGGG - Intergenic
1197961053 X:132006563-132006585 ATTTCCTCATTTGGAAGATGGGG - Intergenic
1197978073 X:132186520-132186542 TTTTCCTCATCTGGAGAATGAGG + Intergenic
1198019435 X:132643827-132643849 TTTGCCTTAGTTGGAAAGTCAGG - Intronic
1198122393 X:133607144-133607166 ATTTCCTCATTTGTAAAATGAGG - Intronic
1198674723 X:139119838-139119860 CTTGCCTCATCTGTAAAATGGGG - Intronic
1198914141 X:141648368-141648390 GTTTCCTCATTTGAAAAATTGGG + Intronic
1198945036 X:142002058-142002080 ATTTCCTCATTTGCAAAATGAGG - Intergenic
1199112656 X:143953835-143953857 TTTTCTTCATTTGCAAAATGAGG + Intergenic
1199548735 X:149035069-149035091 GTTTCCTCATTTGCAAAATGAGG + Intergenic
1199715061 X:150501978-150502000 TTGGCCTCATTTGTAAAATAAGG + Intronic
1199835232 X:151583237-151583259 TTTTCCTCATGTGTAAAATGGGG + Intronic
1200337394 X:155364614-155364636 GTTTCCTCATCTGTAAAATCGGG - Intergenic
1200349076 X:155476613-155476635 GTTTCCTCATCTGTAAAATCGGG + Intergenic
1200607091 Y:5278542-5278564 ATTTCCTCATTTGAAAAATGGGG - Intronic
1201190712 Y:11440257-11440279 TTTCCTACATTTGGAAAATGGGG - Intergenic
1201795005 Y:17886458-17886480 TTTTGCTCATTTAAAAAATCTGG + Intergenic
1201806550 Y:18019523-18019545 TTTTGCTCATTTAAAAAATCTGG - Intergenic
1201969615 Y:19776894-19776916 TTTTCTTCATTTGGTTAATCTGG - Intergenic
1202356381 Y:24054218-24054240 TTTTGCTCATTTAAAAAATCTGG + Intergenic
1202380006 Y:24268484-24268506 TTTTCCTCATCTGAAAAATTGGG + Intergenic
1202490776 Y:25401638-25401660 TTTTCCTCATCTGAAAAATTGGG - Intergenic
1202514397 Y:25615891-25615913 TTTTGCTCATTTAAAAAATCTGG - Intergenic