ID: 1178127590

View in Genome Browser
Species Human (GRCh38)
Location 21:29532186-29532208
Sequence CATTGCCAAGGTGCTTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178127590_1178127593 6 Left 1178127590 21:29532186-29532208 CCTACTTAAGCACCTTGGCAATG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1178127593 21:29532215-29532237 TATGCTTAAATATTGTATCGAGG 0: 1
1: 0
2: 0
3: 4
4: 81
1178127590_1178127594 18 Left 1178127590 21:29532186-29532208 CCTACTTAAGCACCTTGGCAATG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1178127594 21:29532227-29532249 TTGTATCGAGGAAACACTGATGG 0: 1
1: 0
2: 1
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178127590 Original CRISPR CATTGCCAAGGTGCTTAAGT AGG (reversed) Intronic
901846932 1:11989249-11989271 CAGTGACAAAGTGCTTAAGTGGG - Exonic
906850418 1:49243325-49243347 CATTGCCAAGATTCCTAAATTGG + Intronic
910069741 1:83197726-83197748 TATTCCCTAGGTGCTTAAGAAGG + Intergenic
910270774 1:85391685-85391707 CATTACCAAAGTGTTTCAGTTGG + Intronic
912454796 1:109790135-109790157 CCTGGCCAAGGTGCAGAAGTTGG + Intergenic
912699096 1:111862953-111862975 CAGTGCCAAGGTGCCTAGATGGG - Intronic
913220229 1:116654268-116654290 AATTGCCAAGGTGCCAAAGCAGG - Intronic
918214927 1:182385377-182385399 CATGGCCTTGGTGCTGAAGTTGG + Exonic
921051470 1:211514886-211514908 CTCTGCCCAGGTGGTTAAGTTGG + Intergenic
1065394814 10:25223314-25223336 CATTGCCCAGGTACTGGAGTTGG + Intronic
1065511426 10:26482198-26482220 CAGTGCAAAGTTGGTTAAGTTGG + Intronic
1068426095 10:56866270-56866292 CTTTGCCAAGTTGCCTTAGTTGG - Intergenic
1068853128 10:61767722-61767744 CATTGCCCAGTTGCTTGATTAGG + Intergenic
1071789092 10:88935659-88935681 CATTGCCAGGGTTCTTAAGTGGG - Intronic
1072615400 10:97046281-97046303 CCTTGCCAAGGTGATTCAGTGGG - Intronic
1073679296 10:105684910-105684932 CATTGGCTTGGTGATTAAGTGGG - Intergenic
1074885618 10:117690676-117690698 CATAGCCAAGGGGTTTATGTGGG + Intergenic
1078431421 11:11291348-11291370 CATGCCCAAGGTGCTCATGTTGG - Intronic
1078607565 11:12790300-12790322 CTTTGCCACTCTGCTTAAGTGGG + Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1085061522 11:73451718-73451740 CATAGCCAAGGTGTGTAAGTAGG + Intronic
1088092887 11:106064139-106064161 CATTGCAAAGGTGTTTAATCTGG + Intronic
1088540422 11:110908151-110908173 TCTTGCTAAGGTCCTTAAGTAGG - Intergenic
1089344020 11:117778560-117778582 CATTGCCAAAGTGCTTTCCTTGG - Intronic
1089960527 11:122613783-122613805 CATGGCCTTGGTGCTGAAGTTGG + Intergenic
1093218686 12:16392949-16392971 CATTTCTAAGGTGTTTTAGTGGG - Intronic
1099079740 12:78162074-78162096 TATTGCCAAGGTTTTTAAATTGG + Intronic
1100075766 12:90780990-90781012 AATTACCAAGGAGCTTAGGTTGG - Intergenic
1102200714 12:111055848-111055870 CATTAGCAAGGTGCCTAATTAGG - Intronic
1102610240 12:114105593-114105615 CATGGCCTTGGTGCTGAAGTTGG - Intergenic
1102834690 12:116044222-116044244 CATTTGAAAAGTGCTTAAGTTGG - Intronic
1103685318 12:122727769-122727791 AGTTGGCAAGGTTCTTAAGTGGG + Exonic
1104199890 12:126578453-126578475 CTTTGCAAAGGTGCTTGGGTTGG + Intergenic
1108010375 13:46001315-46001337 AATTACCAAGGTTCTTAGGTGGG - Intronic
1117059918 14:51951651-51951673 GATTGCCCAGGTGCTGAATTAGG - Intronic
1120067284 14:80057863-80057885 CATTGCCAAGCACCTTGAGTTGG + Intergenic
1120729419 14:87985843-87985865 CATTGGCTAGTTGCTTAAATGGG - Intronic
1126065082 15:44820364-44820386 CATTGCCAAGGTGGTTGGCTGGG - Intergenic
1126094748 15:45080219-45080241 CATTGCCAAGGTGGTTGGCTGGG + Intergenic
1145785381 17:27590587-27590609 CATTGTCAATATGCTGAAGTTGG - Intronic
1145984228 17:29033824-29033846 CATTGCCAAGCTTCTGAACTTGG - Intronic
1151094577 17:71481645-71481667 CATTGCCAAGTTAATAAAGTAGG - Intergenic
1153772441 18:8426412-8426434 CACTTCCAAGGAGCGTAAGTTGG + Intergenic
1155079818 18:22397709-22397731 CATTCCTAAGTTGCTTATGTGGG - Intergenic
930553027 2:52859847-52859869 CATTGTCAAAGTGGTTAAGGAGG - Intergenic
931745433 2:65287895-65287917 CATTGCCAAGGCGCTCACTTTGG - Intergenic
931909096 2:66875426-66875448 CACTGCCAAGGTCTTTAAATTGG + Intergenic
932622496 2:73273183-73273205 CATTGCCAAGATGTTGAATTGGG + Intronic
933695395 2:85213676-85213698 CAGTGCCAAGGAGCTAAGGTGGG + Intronic
943640358 2:190351230-190351252 CATGGCCCAGGTGCCTAAGATGG + Intronic
948145444 2:235704794-235704816 CATTGCCAAGGAGGTCAAGGGGG + Intronic
1170911489 20:20574924-20574946 CACTGGCATGGTGCTTGAGTAGG + Intronic
1174826115 20:53770360-53770382 CATTCCCAGGGTGATTAAGGTGG - Intergenic
1175480813 20:59309413-59309435 CATTGCCCAGGACCTGAAGTGGG + Intronic
1178127590 21:29532186-29532208 CATTGCCAAGGTGCTTAAGTAGG - Intronic
1180609653 22:17086806-17086828 CTGAGCCAAGGTCCTTAAGTGGG + Intronic
1183223631 22:36533718-36533740 CATAGAGTAGGTGCTTAAGTAGG + Intergenic
951156829 3:19364770-19364792 CTTTGCTTAAGTGCTTAAGTAGG - Intronic
951329397 3:21347827-21347849 AATTGCGAAGGTGCTTACTTGGG - Intergenic
953371866 3:42395563-42395585 CATTGTCATGTTGCTAAAGTGGG - Intergenic
958450343 3:94265357-94265379 CAATGCCAAGGGGATGAAGTAGG - Intergenic
960320648 3:116231529-116231551 CTATGTCAAGGTGCTTCAGTGGG + Intronic
966052724 3:175640884-175640906 CATTGCAAAGGCTCTTAAGTAGG + Intronic
967662184 3:192126365-192126387 CATTGCAACGTTGCTTATGTTGG - Intergenic
969621567 4:8281360-8281382 CATTGCCAAGGTGGCTGGGTGGG + Intronic
971060013 4:22957226-22957248 GATTGCCAAGGGGTTTAAATGGG - Intergenic
972221075 4:36955319-36955341 CATGGCCTAGGTTCTTAACTGGG - Intergenic
977739569 4:100461834-100461856 CATTGCCCAGATGTTTAAGAGGG + Intronic
978275463 4:106944021-106944043 CATAGCGATGGTGCTTAACTAGG - Intronic
978749815 4:112233483-112233505 CAAGGTCAAGCTGCTTAAGTAGG + Intronic
980531902 4:134067678-134067700 CATTACTAAGGTGGTTAAGAGGG - Intergenic
988464148 5:31472128-31472150 GATTGCCAATATGCTTCAGTGGG - Exonic
993258905 5:85632408-85632430 CATTGCCACATTGTTTAAGTCGG + Intergenic
997430331 5:133834139-133834161 CTTTGCCAAGGTTCATAAGGAGG + Intergenic
997879868 5:137579952-137579974 CAGTGAGAAGGTGCTTATGTAGG + Intronic
999074303 5:148780338-148780360 CATGGCCAGACTGCTTAAGTGGG + Intergenic
999470484 5:151850435-151850457 CATGGCCTTGGTGCTGAAGTTGG - Intronic
999474236 5:151883780-151883802 CTTGGCCAAGGTATTTAAGTTGG - Intronic
1000947568 5:167440369-167440391 CATTTCCAATGGGCTGAAGTTGG - Intronic
1002367377 5:178723888-178723910 CATTTGCGAGGTGCTTAAGCAGG - Intronic
1002386072 5:178868282-178868304 CATTTGCGAGGTGCTTAAGCAGG + Intronic
1002900099 6:1404156-1404178 CATGGCCAAGGGGCTTGGGTTGG - Intergenic
1005678190 6:28178325-28178347 CATTGCAAAGGTGCTGACATTGG + Intergenic
1006362610 6:33595197-33595219 GAACGCCAAGCTGCTTAAGTTGG - Intergenic
1006397731 6:33797983-33798005 CAGTGCCAAGGTCCTGAAGCAGG - Intronic
1010442624 6:75915043-75915065 CTTTGCCATGGTACTTAGGTAGG + Exonic
1010824208 6:80453138-80453160 CATTTCCAACGTGGTTAAGCGGG + Intergenic
1011173191 6:84529289-84529311 CATTGAAAAGGTGCTTATGTGGG - Intergenic
1012917686 6:105188320-105188342 CATTGGCCTGGTGGTTAAGTGGG + Intergenic
1015832439 6:137385040-137385062 CATTGCCATGGTGCTATAGCAGG + Intergenic
1018224070 6:161610808-161610830 CAGAGCCAAGGTGCTTGTGTTGG + Intronic
1024339653 7:48244142-48244164 CATTGCCAATTGGCTCAAGTTGG + Intronic
1024382671 7:48716885-48716907 CAAGGCCAGGGTGGTTAAGTAGG + Intergenic
1024870243 7:53956394-53956416 CATTTCCAAGTTGATCAAGTAGG + Intergenic
1027607248 7:80315523-80315545 TGTTGCCAAGGGGCTTAAGGTGG - Intergenic
1031581595 7:123481666-123481688 TAGTTCCAAGTTGCTTAAGTTGG - Intronic
1032676062 7:134130668-134130690 CATTGCAAAGGTGCTAAACTGGG - Intronic
1038386648 8:27154582-27154604 GGTTGCCAAGGTGCTCAAGAAGG - Intergenic
1038679015 8:29649518-29649540 CAATGCCAATTTGCTTAATTTGG - Intergenic
1040833257 8:51702606-51702628 CATTGACAAGGTACTTAAGCGGG + Intronic
1045722382 8:105128904-105128926 CATTGTCAAGGGGCTCACGTGGG - Intronic
1050724562 9:8633214-8633236 CATTGTGATGGTGCTTAAATGGG - Intronic
1051648875 9:19300192-19300214 CATTAGCAAGGTGCTAAAGTTGG - Exonic
1053046018 9:34917935-34917957 CATGGCCTTGGTGCTAAAGTTGG - Intergenic
1056108704 9:83373093-83373115 TATTGCCAAGTTGTTTATGTTGG - Intronic
1187006432 X:15237554-15237576 CATGACCACGGTGCTCAAGTGGG + Intronic
1190448306 X:50553114-50553136 CATTGCCACCCTTCTTAAGTGGG - Intergenic
1191042452 X:56098331-56098353 CATTGGCTAGGTGTCTAAGTTGG - Intergenic
1191749174 X:64522731-64522753 CATTGTGAAGGTGCTGAACTGGG - Intergenic
1194356797 X:92895727-92895749 GATGGCCAAGGTGCTTCACTGGG + Intergenic
1195005009 X:100677217-100677239 AATTGCAAAGGTTCTGAAGTGGG + Intronic
1196846920 X:119903845-119903867 CATGGACAAATTGCTTAAGTAGG - Intronic