ID: 1178128981

View in Genome Browser
Species Human (GRCh38)
Location 21:29548030-29548052
Sequence ACCCTCCAGTTGAAAAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178128981 Original CRISPR ACCCTCCAGTTGAAAAACTG GGG Intronic
900040853 1:463260-463282 ACCATCCCGTTGAAAACGTGGGG + Intergenic
900062284 1:698236-698258 ACCATCCCGTTGAAAACGTGGGG + Intergenic
902876650 1:19344519-19344541 ACCCTCCAGTGGCCACACTGGGG - Intronic
903001991 1:20273067-20273089 ACTTTACAGGTGAAAAACTGAGG - Intergenic
904452478 1:30622869-30622891 ATTGTCCAGATGAAAAACTGAGG + Intergenic
905041747 1:34966096-34966118 AACCTCCAGTTAAAAAATGGAGG - Intergenic
906833730 1:49060834-49060856 AGCCCCCAGTGGAAAGACTGAGG + Intronic
907269040 1:53279888-53279910 CCCCTCGAATTGAAAAAGTGAGG + Intronic
910980390 1:92954838-92954860 TCCATCAAGATGAAAAACTGGGG + Intronic
911467649 1:98275337-98275359 ACCAGCCAGTTGAAACACTCAGG - Intergenic
912978764 1:114352200-114352222 ACCCTGCTGTTGTAAACCTGGGG + Intergenic
913123473 1:115763523-115763545 CCCCATCAGTTGATAAACTGAGG - Intronic
916491893 1:165309362-165309384 AGCCCCCAGTGGCAAAACTGAGG + Intronic
919019922 1:192092389-192092411 ACCACCCAGGTGAAAAAGTGAGG + Intergenic
923124836 1:231026031-231026053 ACTCACCAGCTGAGAAACTGTGG + Intronic
1063691528 10:8292270-8292292 ACATTACAGATGAAAAACTGAGG + Intergenic
1065685124 10:28276603-28276625 ACACTACAGATGAAAAACTAGGG + Intronic
1065880133 10:30030681-30030703 ACCCGCCAGATGAGAAGCTGGGG - Intronic
1066214383 10:33272393-33272415 ACCGTCCCTTTGCAAAACTGTGG + Intronic
1068572266 10:58643142-58643164 AACCTTCAGCTTAAAAACTGGGG + Intronic
1070533294 10:77356440-77356462 ACTCTACAGTTGGAAAAGTGTGG + Intronic
1070654170 10:78259748-78259770 CCCATCCAGTAGAAAATCTGGGG - Intergenic
1070819439 10:79346468-79346490 ACCCTCCAGATGGGAAACTGAGG + Intergenic
1072550741 10:96475475-96475497 ACCCTGGAGTTGACAAACTTGGG + Intronic
1074953405 10:118363556-118363578 ACTTTACAGATGAAAAACTGAGG - Intergenic
1076967126 11:99489-99511 ACCATCCTGTTGAAAACGTGGGG + Intergenic
1077944194 11:6877225-6877247 AGCCTCCAGTTCAAACACAGAGG - Exonic
1079282002 11:19096020-19096042 ACTCTCCAGTGGAAAAAGTTTGG + Intergenic
1080061162 11:27958442-27958464 ACCCTCCAGTCTATAAAGTGAGG - Intergenic
1081490682 11:43566107-43566129 ACATTCAAGTTGAAAAACTGAGG - Intronic
1081586424 11:44387398-44387420 AACCTTCAGTAGAACAACTGTGG - Intergenic
1082927084 11:58560693-58560715 CACCTCCAAATGAAAAACTGGGG + Intronic
1083451265 11:62747021-62747043 ACCATTCAGTAGATAAACTGAGG + Intergenic
1084527278 11:69704930-69704952 ACCCTCCAGCCGAGAAGCTGGGG - Intergenic
1085103171 11:73818931-73818953 AGCCTCCATTTGAAACCCTGGGG + Intronic
1086905185 11:92410554-92410576 ACCCCCTAATGGAAAAACTGGGG - Intronic
1088443222 11:109895324-109895346 ACCCTCGAGGTGAAAAGCAGGGG + Intergenic
1088895004 11:114071690-114071712 ACCCTCCAATGGACAAACTGAGG - Intronic
1089074076 11:115723392-115723414 TCCTTCCATTTTAAAAACTGAGG + Intergenic
1089655922 11:119946954-119946976 ATTCTACAGATGAAAAACTGAGG + Intergenic
1091772773 12:3163984-3164006 ACCCTCCAGATCAGGAACTGGGG - Intronic
1093293033 12:17352528-17352550 ACTCTCCAGTTGAAATACCCCGG - Intergenic
1097902540 12:64887697-64887719 ACCCTCCGGTTCAGAAACTCAGG - Intergenic
1098995837 12:77118871-77118893 ACCTCCCATTTGAAAAACTGTGG + Intergenic
1104870354 12:131990917-131990939 ACCCCCAAGTTGATAAACTCTGG + Intronic
1109601848 13:64641796-64641818 ACCTTTCAGTTTAAAAATTGTGG + Intergenic
1111926481 13:94468799-94468821 ACACTGCAGTTGGCAAACTGCGG + Exonic
1112884070 13:104147380-104147402 GCCCTCCAGCTGTAAACCTGTGG + Intergenic
1113490950 13:110691374-110691396 ACCATAAAGTTGAAAAACTGTGG - Intronic
1114547720 14:23514518-23514540 ACTCTCCACTTGAACAAGTGAGG + Intergenic
1118115279 14:62769082-62769104 AGCTTGGAGTTGAAAAACTGAGG + Intronic
1118977804 14:70692583-70692605 AGGCTCCATTTGAAAAAATGAGG + Intergenic
1122005834 14:98702904-98702926 TTCCTCCAGTTGTAAGACTGTGG - Intergenic
1126966037 15:54055514-54055536 CCCCTCCAGCTGATCAACTGAGG + Intronic
1126970427 15:54105033-54105055 TCCCTCAGGTAGAAAAACTGGGG - Intronic
1128243857 15:66119633-66119655 TCCCCCCACTTGAAGAACTGAGG + Intronic
1128313336 15:66645170-66645192 ACCCTTCTGTGGCAAAACTGAGG - Intronic
1128961031 15:72004708-72004730 AAGCTCCAGTTGATAAATTGTGG - Intronic
1129257263 15:74340761-74340783 AGCCTCCAGATGAAATACAGAGG + Intronic
1132441048 15:101864346-101864368 ACCATCCCGTTGAAAACGTGGGG - Intergenic
1134301166 16:12992707-12992729 ACCCTACAGTTACAAAAGTGAGG - Intronic
1135221389 16:20617074-20617096 ACAGTCCATTTGAAAAAATGTGG + Intronic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1138855767 16:60689472-60689494 ATCCTCCACTTTAAAAGCTGTGG + Intergenic
1139080510 16:63513507-63513529 ACCTTCCAGTTGGAAAGATGTGG - Intergenic
1144709007 17:17388270-17388292 ACCCTTCAGGTGAACACCTGCGG - Intergenic
1150673029 17:67218589-67218611 ACTCACCAGTTGCAAAAATGAGG + Exonic
1152741936 17:82022273-82022295 ACCTGCCAGTGGAGAAACTGAGG - Intronic
1160643929 19:169112-169134 ACCATCCTGTTGAAAACGTGGGG + Intergenic
1164971891 19:32539765-32539787 ACCTTCCAGCTGAAGAACCGGGG - Intergenic
1167505973 19:49871248-49871270 GCCCTCCAGTGGAGAAACTGAGG - Intronic
1167774723 19:51547372-51547394 ACCCTCCACCTGAAGAACTGTGG + Intergenic
926212299 2:10880143-10880165 ACCCTCTAGTGGTAACACTGGGG + Intergenic
927365101 2:22285804-22285826 AACGTTCAGTTGAAAAACTCTGG - Intergenic
928337816 2:30413196-30413218 ACCTCCCAGATGAAAAACTAAGG - Intergenic
929838700 2:45432982-45433004 TCCTTCCAGATGAAACACTGTGG + Intronic
934902853 2:98174598-98174620 ACACTTAAGATGAAAAACTGGGG + Intronic
936262757 2:110976146-110976168 ACCCTCAAGCTGAAAAAACGTGG + Intronic
937167478 2:119834772-119834794 ACTCTAAAGATGAAAAACTGAGG - Intronic
940545599 2:155079437-155079459 ACTCTCCAGTTGTAAAAATATGG + Intergenic
944289903 2:197993462-197993484 ACACTCCAGTGGAGGAACTGAGG + Intronic
947742662 2:232491734-232491756 ACCCACCAGATGACAAAGTGGGG + Intergenic
1171234827 20:23516249-23516271 ACAATCCAGTAGAAAATCTGGGG - Intergenic
1174830917 20:53811509-53811531 ACCCTGCAGTGGAAAGACTGTGG - Intergenic
1175645937 20:60671682-60671704 ACCCTTTAGTGGAGAAACTGGGG + Intergenic
1177410608 21:20725759-20725781 ACACTCCACTTGACAAAGTGTGG - Intergenic
1177922217 21:27166222-27166244 ATCCTTCAATTGAAAAACTCTGG - Intergenic
1178128981 21:29548030-29548052 ACCCTCCAGTTGAAAAACTGGGG + Intronic
1181857418 22:25792087-25792109 ATCCCACAGGTGAAAAACTGAGG - Intronic
1181927786 22:26374468-26374490 ACACTCCACTTGGAAAACAGAGG + Intronic
1182305494 22:29365092-29365114 AGCCTCCATTTGCAAAACGGAGG - Intronic
1184542634 22:45139098-45139120 AAACTCCAGTAGAAAAATTGGGG + Intergenic
1185080433 22:48706692-48706714 GCCATCCAGTTGAAAAACGTAGG - Intronic
950611612 3:14130682-14130704 ACCGTACAGTTGGAAAACTGAGG - Intronic
952066739 3:29579368-29579390 GTCCTCCAGTTGATACACTGAGG + Intronic
953288253 3:41634344-41634366 ACCTTCCAGATGAAGAACTAGGG - Intronic
958000578 3:87743778-87743800 ACCAGCCACTTGAAAAACTATGG + Intergenic
958148073 3:89653253-89653275 ACCCTACAATTGACAAACTGGGG + Intergenic
959382938 3:105663990-105664012 AACCTCCATTTAAAGAACTGAGG + Intronic
965683904 3:171281341-171281363 AACTTCTAGTTGAAAAATTGTGG - Intronic
967042876 3:185709865-185709887 AACCTCCAGTCGAAAAATTTGGG - Intronic
968544171 4:1188401-1188423 ACACTCCAGTTAAAAAGCAGCGG + Intronic
969283187 4:6185299-6185321 ACTCTCCAGTTTAAGAACTAGGG - Intronic
969607120 4:8207847-8207869 ATCCTCCAGTTGAAAAGCCAGGG - Intronic
970490530 4:16569058-16569080 AACCTTCAGTAGAAAAACAGAGG - Intronic
970797033 4:19925000-19925022 ATGGTCCAGTTGAAACACTGTGG - Intergenic
971149339 4:24014619-24014641 TCCTTGCAGTTGTAAAACTGAGG + Intergenic
972798228 4:42444441-42444463 ACCCCACAATTGAAAACCTGTGG + Intronic
974331234 4:60481593-60481615 ACCTTCCATTTGAAAAAGTTTGG - Intergenic
979295328 4:119026627-119026649 ACCATCCAGTGGAATAAGTGAGG + Exonic
980962354 4:139488047-139488069 ACTTTGCAGGTGAAAAACTGAGG - Intergenic
981403300 4:144339321-144339343 CCCCTACAGTTGAATAACTGAGG + Intergenic
981718534 4:147776027-147776049 ATTCTCCATCTGAAAAACTGTGG - Intronic
982461183 4:155670768-155670790 ATCCTCCATTTTAAAAATTGAGG + Intronic
983008534 4:162516312-162516334 ACCCTTTAGTTCAAAATCTGGGG - Intergenic
985348216 4:189029872-189029894 ACCTGCCACTTGAAGAACTGTGG + Intergenic
986799138 5:11241614-11241636 ACCCTCCAGCAGAAAGTCTGGGG + Intronic
987144030 5:14973916-14973938 ACTCTACAGTCTAAAAACTGTGG - Intergenic
987632308 5:20490606-20490628 ACCCTCCTCTTGAACAAATGTGG - Intronic
987870829 5:23614595-23614617 ACCCTCCAATGGTAACACTGTGG - Intergenic
988267951 5:28975555-28975577 ACCTTCAAGTTGAAATGCTGTGG - Intergenic
995392024 5:111650390-111650412 ACCACCCAGTGGAAAAACAGAGG - Intergenic
995982687 5:118124306-118124328 ATCCTTCGGTTGAAATACTGTGG - Intergenic
996311670 5:122113107-122113129 ACCTTCCATCTGAAGAACTGGGG - Intergenic
999889337 5:155959835-155959857 TTCCTCAAGTTGAAAAAATGTGG - Intronic
1001371067 5:171202665-171202687 ACACTCCAGTTGAAACACCTTGG + Intronic
1002732991 5:181355667-181355689 ACCATCCTGTTGAAAACGTGGGG - Intergenic
1005949635 6:30622235-30622257 AGCCTTTAGGTGAAAAACTGGGG - Intronic
1006815908 6:36849705-36849727 TCCCTCCAGCTGAAAAAATATGG - Intergenic
1008234698 6:49029907-49029929 ACTCTAAATTTGAAAAACTGTGG + Intergenic
1008948263 6:57123755-57123777 TCCCTCCAGATGAAATACTTAGG - Intronic
1009841001 6:69073875-69073897 CTCCTCCAGATGAAAGACTGGGG - Intronic
1010005884 6:70994439-70994461 ACATTACAGTTGAAAAATTGGGG + Intergenic
1010716026 6:79231634-79231656 GCCCTGAAGTTGCAAAACTGAGG + Intronic
1010778080 6:79909531-79909553 TCCCTCCATTTAAAAAACTCTGG + Intergenic
1012319969 6:97831007-97831029 ATCCTCCAGTTAAAGAGCTGGGG - Intergenic
1013786036 6:113782177-113782199 GCCCTCAAGCTGAACAACTGTGG + Intergenic
1014050746 6:116951391-116951413 TCCCTCAAGAGGAAAAACTGTGG - Intergenic
1016878654 6:148888529-148888551 ACCCTGCACATGAGAAACTGAGG - Intronic
1019237244 6:170627984-170628006 ACCATCCCGTTGAAAACGTGGGG - Intergenic
1022403664 7:30065782-30065804 ACTCTCCAGTGAATAAACTGAGG + Intronic
1024549970 7:50554567-50554589 ACCCAGCAGTTGCAAAACAGTGG - Intronic
1025242849 7:57292279-57292301 ACCCTTCCATTTAAAAACTGTGG - Intergenic
1026066139 7:67074735-67074757 ATTCTACAGTTGAGAAACTGAGG - Intronic
1030263629 7:107593111-107593133 AGACTCCAGTTAGAAAACTGGGG - Intronic
1030497943 7:110323319-110323341 TCTCTCCAATTGAAAAACTAAGG - Intergenic
1031102353 7:117497186-117497208 AACTTACAGTTGAGAAACTGAGG - Intronic
1032321320 7:130888683-130888705 ACACTGCAGGTGAAACACTGGGG + Intergenic
1035510524 8:178623-178645 ACCATCCTGTTGAAAACGTGGGG + Intergenic
1036392963 8:8340716-8340738 ACCCTCCTGTTGATACACAGGGG - Intronic
1036795267 8:11751439-11751461 TGCCTCCAGGAGAAAAACTGGGG + Intronic
1037900846 8:22688417-22688439 ACCCTTCAGCTGAAAAAATATGG + Exonic
1038624415 8:29177048-29177070 ACCCTCCAGTTGAGAACCACTGG - Intronic
1039764504 8:40613767-40613789 TCCCTCAAGTTCAGAAACTGTGG - Intronic
1044269841 8:90229043-90229065 ATCCTGCATTTGAATAACTGAGG + Intergenic
1044422796 8:92017407-92017429 AAACCCCACTTGAAAAACTGAGG - Intronic
1048282387 8:133114862-133114884 ACCCTCCAGTTGGAAACCACAGG - Intronic
1048431639 8:134376615-134376637 ACCCTCCAGTTCCAAAAATTTGG - Intergenic
1051354832 9:16232030-16232052 ACCCTCCAGAGGAAAGCCTGGGG - Intronic
1052759262 9:32573028-32573050 ACACTCCGGATGAGAAACTGCGG - Exonic
1054834688 9:69664730-69664752 ACGCTCTTGTTGGAAAACTGAGG + Intronic
1056022981 9:82460812-82460834 ACCCACCAGTTAAAAGACAGAGG - Intergenic
1062129697 9:134885762-134885784 ACCCTCCGCTGGAAAACCTGTGG - Exonic
1062757398 9:138307993-138308015 ACCATCCTGTTGAAAACGTGGGG - Intergenic
1186497646 X:10024632-10024654 ACCCTCCAGATGAAAAATGCTGG - Intronic
1187215994 X:17277015-17277037 ATCTTCCAGGTGAAAATCTGAGG + Intergenic
1188297607 X:28469133-28469155 ACCCTTCAGTTCAAAAATGGGGG + Intergenic
1189504887 X:41602902-41602924 CCCCTCCAGTTAGAAAACAGTGG + Intronic
1190060284 X:47206436-47206458 ACCCTGCAGGTGATAAGCTGTGG + Exonic
1191863606 X:65686088-65686110 AGCCACCAGTTGAATAATTGAGG + Intronic
1191879540 X:65831253-65831275 ACTCTCTAGTTGTAAAAGTGAGG + Intergenic
1197131751 X:123013877-123013899 ACACTCCAGTTGGATAACTGAGG + Intergenic
1197164088 X:123357212-123357234 ACCTTCCACTTGAAAAACTGAGG + Intronic
1197812452 X:130458576-130458598 AAACACCAGTAGAAAAACTGTGG + Intergenic
1198952491 X:142087397-142087419 ACCTTACAGATGAAAAACTGGGG + Intergenic
1199593631 X:149489997-149490019 ACCCTCCAGGTTAAAAATGGGGG + Intronic