ID: 1178135872

View in Genome Browser
Species Human (GRCh38)
Location 21:29626550-29626572
Sequence CTTGGTGACACCTTGATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178135867_1178135872 17 Left 1178135867 21:29626510-29626532 CCATCTCAAGTCAGGGAGAGAGG 0: 1
1: 0
2: 5
3: 33
4: 274
Right 1178135872 21:29626550-29626572 CTTGGTGACACCTTGATGCTGGG 0: 1
1: 0
2: 3
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178135872 Original CRISPR CTTGGTGACACCTTGATGCT GGG Intronic
900621424 1:3589247-3589269 CTTGCTGACACCTTGATCTGAGG + Intronic
903090805 1:20914524-20914546 CCTGATGACACCTTGATTTTTGG + Intronic
907626903 1:56039505-56039527 CCTGCTGACACCTTGATCTTGGG - Intergenic
907650777 1:56292790-56292812 CATGGTCACACCTAGATGCAGGG - Intergenic
908267952 1:62397017-62397039 CGTGGGGACTCCCTGATGCTGGG - Intergenic
908287462 1:62622954-62622976 CATGGTGAGACCTTGTTTCTGGG - Intronic
908536960 1:65087218-65087240 CCTGCTGACACTTTGATGTTGGG + Intergenic
909281730 1:73763908-73763930 CTTGCTGACACTGTGAAGCTTGG + Intergenic
909599735 1:77448832-77448854 CATGGTGGCACCTGGAAGCTCGG - Intronic
910418981 1:87035166-87035188 CTAGCTGACACCTTGATTTTAGG + Intronic
910459945 1:87437987-87438009 CTTGGTGCCACCTTGAAACCAGG - Intergenic
911771322 1:101745788-101745810 CTGGGTGACACCTTGATAAGAGG + Intergenic
912052257 1:105544145-105544167 CCTGCTGACACCTTGATCTTGGG - Intergenic
912415852 1:109508016-109508038 CTTGGTCATCCCTTGCTGCTTGG + Exonic
914317165 1:146524252-146524274 CTTGGTGCCACCTTGAAACCAGG - Intergenic
914497190 1:148209108-148209130 CTTGGTGCCACCTTGAAACCAGG + Intergenic
918390449 1:184054274-184054296 CTTGATGACCACTTGATGATTGG + Intronic
921267333 1:213433063-213433085 CCTGCTGACACCTTGATCTTAGG - Intergenic
923209251 1:231788303-231788325 CCTGCTGACACCTTGATTCTTGG - Intronic
924049438 1:240065515-240065537 CTTGTTGACCCCTTGATTTTAGG + Intronic
1064559667 10:16583788-16583810 CTTCCTGACACCTTGATTTTTGG - Intergenic
1067552721 10:47246739-47246761 CTTGGTGACAGCTGCATGCCAGG + Intergenic
1067700655 10:48569016-48569038 CTTTGGGACATGTTGATGCTGGG + Intronic
1068516115 10:58027524-58027546 CTTGCTGACACCTTAATTTTAGG - Intergenic
1068610325 10:59052821-59052843 CCTAGTGCCACCTTGATGCCTGG + Intergenic
1068886486 10:62103306-62103328 CCTGTTGACTCCTTGATCCTTGG + Intergenic
1069121908 10:64577535-64577557 CATGGTGACACCCAGAAGCTTGG - Intergenic
1070888471 10:79924756-79924778 CTTGGTGTAACATTCATGCTTGG - Intergenic
1073571315 10:104583142-104583164 CTTGGTGCCACCTGGGTGATGGG + Intergenic
1073944910 10:108739470-108739492 CTTGATGACAGCATGATGTTGGG + Intergenic
1077051759 11:569717-569739 CTTGCTGACCCCTTGACCCTTGG + Intergenic
1079237433 11:18700368-18700390 CTTGATGCCACCTTCAGGCTGGG + Intronic
1080032125 11:27672933-27672955 CTTGGTGACTTCTTGGTGTTTGG - Intronic
1080083036 11:28244173-28244195 CTTGGTTTCATCTTGATGTTAGG + Intronic
1080228416 11:29987118-29987140 CCTGCTGACACCTTGATTTTAGG + Intergenic
1081024086 11:37986991-37987013 CTTGGTGACACATTTGTGTTTGG + Intergenic
1081110830 11:39131130-39131152 CTGGGTGTCAACTTGATCCTGGG + Intergenic
1083119719 11:60499386-60499408 CTTGCTGTCACCTTGATGAGGGG - Intronic
1083139786 11:60712456-60712478 ATTGGTGACAGCCAGATGCTTGG - Intronic
1084085784 11:66854507-66854529 CTGGGTGACAACATGAGGCTGGG + Intronic
1084169572 11:67394253-67394275 CTTGGGGACTCCTCGATCCTGGG - Intronic
1085334120 11:75678297-75678319 CATGGTGGCACCTGGAAGCTTGG + Intergenic
1086797774 11:91129954-91129976 CTTGGTTGAACCATGATGCTAGG + Intergenic
1088569176 11:111204542-111204564 CATGCTGACACCTTGATCTTAGG + Intergenic
1092712698 12:11354360-11354382 CTTCGTGCAACCTTGATTCTGGG - Intronic
1095302705 12:40604501-40604523 CTTAGTAACATCTTGATGTTAGG - Intergenic
1095826191 12:46531982-46532004 CATGGTGGCACCTGGAAGCTTGG - Intergenic
1100652956 12:96610809-96610831 CTTGCTGCCACCTTGCAGCTCGG - Intronic
1101428507 12:104607230-104607252 CTTGGTGACATTTGGAAGCTGGG + Intronic
1101696913 12:107135343-107135365 CTTGGGGACAGCTTGATGACTGG + Intergenic
1102231791 12:111267651-111267673 CCTGTTGACACCTTGATCTTGGG - Intronic
1102724732 12:115051173-115051195 CTTGGTGACAGCTTGGTTCCAGG + Intergenic
1103011693 12:117463002-117463024 CCTGCTGACACCTTGATCTTGGG + Exonic
1103786662 12:123437686-123437708 GTTGGAGACACCTTGCTACTTGG + Intergenic
1103871544 12:124095894-124095916 CTTGCGGACATCTTGATGTTGGG + Intronic
1108559270 13:51627142-51627164 CATGGTGGCACCTGGAAGCTTGG + Intronic
1109751590 13:66699675-66699697 CTTGCAGACACCTTGATTTTTGG + Intronic
1116861238 14:49997348-49997370 CCAGGTGACACCTTGTTTCTGGG + Intronic
1117777798 14:59200184-59200206 CTTTGTGAGACACTGATGCTGGG + Intronic
1121778766 14:96608362-96608384 CTTGCTGACTCCTTGATCTTGGG - Intergenic
1123685473 15:22794154-22794176 GTTGATGACACCTGGTTGCTAGG - Intronic
1124642745 15:31406657-31406679 CCTGCTGACACCTTGATTTTAGG - Intronic
1125155360 15:36579447-36579469 CTTGTTGACCCTTTGATCCTAGG + Intergenic
1125590536 15:40852079-40852101 CCTGCTGACACCTTGATGTGGGG - Intronic
1127278257 15:57466612-57466634 CTTGGTAACACCATTGTGCTTGG + Intronic
1128348883 15:66876071-66876093 CTGAGTGCCAGCTTGATGCTGGG - Intergenic
1131443327 15:92475299-92475321 CTTGGTGAGAGCTTGTTTCTTGG + Intronic
1132039322 15:98511832-98511854 CTTGGTGATGCCTTGCTGCCGGG + Intronic
1136736139 16:32469411-32469433 CTTGCTGGCACCGTGATCCTGGG - Intergenic
1138332044 16:56223125-56223147 CCTGCTGACACCTTGATTTTAGG - Intronic
1138479537 16:57293038-57293060 CATTGTCACACATTGATGCTGGG + Intergenic
1140697623 16:77550660-77550682 CCTGCTGACACCTTGATTTTAGG - Intergenic
1140743874 16:77964312-77964334 CCTGCTGACACCTTGATTTTTGG - Intronic
1141628998 16:85276757-85276779 CTGGGTGACATCCTGCTGCTGGG - Intergenic
1142424165 16:89992113-89992135 CGTGGTCACAGCTTGATGCTGGG - Intergenic
1203016933 16_KI270728v1_random:360163-360185 CTTGCTGGCACCGTGATCCTGGG + Intergenic
1203035268 16_KI270728v1_random:633321-633343 CTTGCTGGCACCGTGATCCTGGG + Intergenic
1144468525 17:15516437-15516459 CCTGCTGACACCTTGATCTTGGG - Intronic
1146959890 17:36965217-36965239 CCTGCTGACACCTTGATTTTAGG - Intronic
1149495610 17:57115549-57115571 GTTAGTGACTCCTTGATCCTGGG + Intronic
1150226667 17:63528213-63528235 CATGGTGACACGTGGACGCTGGG - Intronic
1151106771 17:71624400-71624422 CCTGCTGACACCTTGATTTTAGG + Intergenic
1151334222 17:73430567-73430589 CTTGATGACACTCTGATCCTGGG + Exonic
1152038786 17:77890085-77890107 CTCGCTGACACCTTGATCCTGGG + Intergenic
1152530559 17:80916291-80916313 CGTGGTGGCACCTGGAAGCTTGG - Intronic
1156256288 18:35399869-35399891 CATGGTCACACCTTGCTGCATGG - Intergenic
1160514875 18:79472660-79472682 CTTGGAGACACCCTGGGGCTGGG + Intronic
1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG + Intronic
1161674561 19:5637572-5637594 CTTGAGGATCCCTTGATGCTGGG + Intronic
1161707577 19:5829326-5829348 CACGGTGTCACCTTGATGCTTGG + Intergenic
1162122915 19:8482973-8482995 CTAGGAGAGTCCTTGATGCTGGG - Intronic
1163403389 19:17107994-17108016 CTTGGTGACATCTTGTGCCTGGG + Intronic
1165738877 19:38193983-38194005 CTAGGTGACCCTCTGATGCTTGG - Intronic
1168646464 19:58062127-58062149 TTTGCTGACACCTTGATCTTAGG - Intronic
925776305 2:7339353-7339375 CCTAGTGACACCTTGATTTTCGG - Intergenic
929553777 2:42911114-42911136 CTTGGTGACATTTTTTTGCTAGG - Intergenic
931500181 2:62856343-62856365 CGTGGTGGCACCTGGAAGCTTGG - Intronic
931832769 2:66069860-66069882 CTTTGTTACACCTCCATGCTGGG + Intergenic
935160171 2:100523266-100523288 CCTGCTGACACCTTGATCTTGGG - Intergenic
936902157 2:117493623-117493645 CTGGGAGACAACTTGATTCTGGG - Intergenic
937055393 2:118930801-118930823 CTTGCTGGCACCTTGATCTTGGG - Intergenic
940154982 2:150646041-150646063 CTTTGTGAGCCCATGATGCTAGG - Intergenic
940274122 2:151921522-151921544 CCTGCTGACACCTTGATTTTAGG - Intronic
940513375 2:154647921-154647943 CCTGGTGACACCATGAAGCAGGG + Intergenic
943683653 2:190793857-190793879 CCTGCTGACACCTTGATCTTGGG - Intergenic
946095933 2:217274152-217274174 CCTGCTGATACCTTGATCCTGGG - Intergenic
947356678 2:229303315-229303337 TTTGCTGACACCTTGATCTTGGG - Intergenic
948431449 2:237921750-237921772 CTGGGTGACACTTTTATGGTTGG - Intergenic
1169408501 20:5346961-5346983 CTTGCTGGCACCTTGATCTTGGG - Intergenic
1172174444 20:32963596-32963618 CCTGTTGACACCTTGATTTTGGG - Intergenic
1174120895 20:48264668-48264690 CTAGCTGACACCTTGATTTTGGG - Intergenic
1174372250 20:50099282-50099304 CCTGCTGACACCTTGATCTTGGG + Intronic
1174498702 20:50968288-50968310 CTTGATGACAGCTTGATTTTAGG - Intergenic
1175176600 20:57116091-57116113 CTTGGAGACACCTGGAGCCTGGG - Intergenic
1177262689 21:18750621-18750643 CTTGGAGACACCCAGAAGCTTGG - Intergenic
1178044231 21:28676210-28676232 CTTGTTGACACCTTGATATCAGG - Intergenic
1178135872 21:29626550-29626572 CTTGGTGACACCTTGATGCTGGG + Intronic
1178704104 21:34858679-34858701 TTTGGAGACATCTGGATGCTGGG + Intronic
1183445557 22:37851610-37851632 CTTTGTGAGTCCTTGAGGCTAGG + Intronic
1184370710 22:44080320-44080342 CCTGCTGCCACCTTGATGTTGGG - Intronic
1185108183 22:48885852-48885874 CTTGGTGGCACCTTGGAACTGGG + Intergenic
951217023 3:20034826-20034848 CTTGCTGTCACCTTGATCTTGGG + Intergenic
954141106 3:48606003-48606025 CTTGGGGACACAGTCATGCTTGG + Intronic
954151101 3:48657515-48657537 CTTTTTGACACCTTGATGCTGGG - Intronic
954602390 3:51879595-51879617 CTTGCTGACACATTGATTTTGGG - Intergenic
955303887 3:57810099-57810121 CATGGTGGCACCTGGAAGCTTGG - Intronic
955532937 3:59893243-59893265 CCAGTTGACACCTTGAAGCTGGG - Intronic
955609907 3:60745866-60745888 CGTGGTGGTACCTTGCTGCTGGG - Intronic
956694134 3:71904309-71904331 CTTGCTGACACCTTGATGCGAGG + Intergenic
957250236 3:77763468-77763490 CCTGCTGACAACTTGATGTTAGG - Intergenic
957986780 3:87582287-87582309 CTTGGGGACCCCTTTATACTTGG - Intergenic
960514573 3:118589547-118589569 CTTGGTGATATCTTGATTTTAGG + Intergenic
961690136 3:128663410-128663432 CTGAGTGACACCTGGACGCTAGG - Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
964012786 3:151911004-151911026 CTTGCTGCCACCATGATGTTGGG - Intergenic
964465401 3:156986107-156986129 CCTGGTGACACCTTGATTTTAGG + Intronic
965224899 3:165975461-165975483 TTTGGTGACCCCTTTATGCTTGG + Intergenic
966840245 3:184082110-184082132 CACGGTGACACCTGGAAGCTTGG - Intergenic
967364264 3:188667889-188667911 CTTGATGAAGCCTTGATGGTTGG + Intronic
968957073 4:3724991-3725013 GTTGGCGCCTCCTTGATGCTTGG - Intergenic
969079336 4:4606424-4606446 TCTGCTGACACCTTGATTCTGGG - Intergenic
969577259 4:8043659-8043681 CCTGCTGACTCCTTGATCCTGGG + Intronic
971502748 4:27334175-27334197 CTTGGTCATACCATGATGTTTGG + Intergenic
974644121 4:64671028-64671050 CGTGGTGACACCTGGAAGCTTGG + Intergenic
974930765 4:68358624-68358646 CTTGGTGGCATCTTGATACAGGG + Intergenic
975541611 4:75518140-75518162 CTAGATGACACCTTGGTGGTAGG - Intronic
978095355 4:104769539-104769561 CAGGATGACACCTTGAAGCTTGG + Intergenic
979462958 4:121004074-121004096 CATGGTGACACCAAGACGCTTGG - Intergenic
981543684 4:145872436-145872458 CCTGCTGACACCTTGATATTAGG + Intronic
982294676 4:153814905-153814927 GTTGGTGAGACTATGATGCTAGG + Intergenic
983863654 4:172737814-172737836 CTAGGTGACACCTTAAGCCTAGG + Intronic
984380873 4:178990928-178990950 CTTAGTGACATCATGATGCTTGG - Intergenic
984981877 4:185289935-185289957 CTTGCTGACACCTTGCTCTTGGG - Intronic
985021352 4:185694426-185694448 CATGCTGACACCTTCATGTTCGG - Intronic
985187032 4:187328561-187328583 CCTTGTGACTCCTTGCTGCTGGG + Intergenic
985519012 5:362262-362284 TTTGGTGGCACCTTGATCATGGG + Intronic
985565808 5:616616-616638 CTGGGTGCCACCTTGTTGCCGGG + Intronic
986623416 5:9700689-9700711 CCTGCTGACACCTTGATCTTGGG - Intronic
986676930 5:10193916-10193938 CCTGCTGACACCTTGATCTTGGG + Intergenic
987948529 5:24647086-24647108 CTTGGTCACACATTGTTGCTAGG + Intergenic
988798964 5:34678625-34678647 CCTGTTGACACCTTGATCTTGGG + Intronic
988837733 5:35049390-35049412 CCAGGTGACCCCTTGATGTTGGG - Intronic
989332427 5:40275532-40275554 TTTGCTGACAGCTTGATGGTGGG - Intergenic
990611287 5:57459324-57459346 CTTGTGGACACCTTGATTTTTGG + Intergenic
992165580 5:74047636-74047658 CCTGCTGACACCTTGATTTTCGG - Intergenic
993472712 5:88325402-88325424 CTTGGTGACAGATTGAGGCCTGG - Intergenic
999897447 5:156050690-156050712 CCTGCTGACACCTTGATTTTAGG - Intronic
1004373880 6:15075449-15075471 CCTGCTGACACCTTGATCTTAGG - Intergenic
1004421780 6:15476974-15476996 CTTGGTGAAGGCTTGTTGCTAGG + Intronic
1005018102 6:21392766-21392788 TTTGGTGACACTCTGAGGCTGGG + Intergenic
1005204991 6:23392509-23392531 CTTGCTGACACCTTGCTTTTAGG + Intergenic
1007693648 6:43718319-43718341 CCTGGTGACATCTTGATAGTTGG + Intergenic
1009243279 6:61204408-61204430 CTTGGTGGCACCCTGAAGCTTGG + Intergenic
1011476599 6:87754919-87754941 CATGTTGACACCTTGATTTTAGG - Intergenic
1014147630 6:118016304-118016326 TTTGGTGTCATTTTGATGCTTGG + Intronic
1014255543 6:119157353-119157375 TTTGGTGAAAGCTGGATGCTGGG - Intergenic
1017461418 6:154654639-154654661 CTTGATGACAAAATGATGCTGGG + Intergenic
1018089151 6:160330437-160330459 CCTGTTGACACCTTGATCTTGGG + Intergenic
1018392100 6:163348446-163348468 CCTGCTGACACCTTGATTTTAGG + Intergenic
1021483276 7:21141856-21141878 CCTGCTGACACCTTGATTTTAGG + Intergenic
1021767469 7:23964264-23964286 CTTGCTGACCCCTTGATCTTGGG - Intergenic
1022581213 7:31556888-31556910 CTTGGTGACACCTTGATTTTGGG - Intronic
1023303331 7:38797096-38797118 TTTGGTGCCACCTTGTGGCTTGG - Intronic
1023699939 7:42882913-42882935 CATGGTGGCACCTGGAAGCTTGG + Intergenic
1027687297 7:81294208-81294230 CATGGTGGCACCTGGAAGCTTGG + Intergenic
1028101902 7:86831050-86831072 CTTGCTGACACCTTGATTTCAGG + Intronic
1030839863 7:114335954-114335976 TTTGGTGAAATCCTGATGCTTGG - Intronic
1031334258 7:120507445-120507467 CTTGGTGACACCTAACTGCAAGG - Intronic
1033660227 7:143397582-143397604 CTTGGTGCAGCCTTGCTGCTTGG - Exonic
1033720555 7:144054907-144054929 CCTGGTGACACCTTGTTAGTTGG + Intergenic
1034640006 7:152594996-152595018 GGTGGTGACACCTGGCTGCTGGG + Intergenic
1036009055 8:4700435-4700457 CTTTGTGACACCTCATTGCTTGG + Intronic
1038496502 8:28007098-28007120 CGTGTTGGCACCTGGATGCTTGG - Intergenic
1039355110 8:36806651-36806673 CCTGGTAGCACCTTTATGCTGGG + Intronic
1040424606 8:47273059-47273081 CTTGGTGTCTACTGGATGCTTGG - Intronic
1041417671 8:57630191-57630213 CTTGCTGACACCTTCATGTTAGG + Intergenic
1044598075 8:93977738-93977760 CCTGCTGACACCTTGATTTTAGG + Intergenic
1048335980 8:133502549-133502571 CCTGATGACACCTTGATCTTGGG + Intronic
1048393915 8:133994788-133994810 CCTGTTGACACCTTGATCTTGGG + Intergenic
1055722405 9:79190479-79190501 CTTGGCCACACCTGGATGCTAGG + Intergenic
1059085854 9:111302434-111302456 CCTGCTGACACTTTGATCCTGGG - Intergenic
1060581527 9:124751533-124751555 CTCGGTGACACTTTGATTCCAGG - Intronic
1061241589 9:129377377-129377399 CTTGATGACAGCTCGATGTTGGG + Intergenic
1062432044 9:136530562-136530584 TTTGGTGACACCTAGTTCCTGGG - Intronic
1203361279 Un_KI270442v1:220687-220709 CTCGGTGCCGCCTTGGTGCTTGG - Intergenic
1186057917 X:5671161-5671183 CTTGTCGACACCTTGATCTTGGG + Intergenic
1186146730 X:6632077-6632099 CCTGGGGACACCTTGATCTTGGG - Intergenic
1187967093 X:24622707-24622729 CTTGGTGTCACCTTGAAGACTGG - Intronic
1188859766 X:35243405-35243427 CATGGTGGCACCTGGAAGCTTGG + Intergenic
1191626348 X:63275206-63275228 GTGGGTGACATCCTGATGCTTGG - Intergenic
1193846072 X:86472412-86472434 CCTGTTGACACCTTGAAGTTAGG + Intronic
1194860652 X:98994595-98994617 CCTGCTGACACCTTGATGTTAGG + Intergenic
1197883075 X:131189715-131189737 CATGCTGACATCTTGATCCTGGG + Intergenic
1198320791 X:135517051-135517073 CTTGGTGACAGCTTGGGGATTGG + Intergenic
1199180065 X:144843547-144843569 CCTGCTGACACCTTGATCTTGGG + Intergenic
1199614889 X:149648438-149648460 CATGGTGGCACCTAGAAGCTTGG - Intergenic
1199681593 X:150228381-150228403 CCTGTTGACACCTTGATTTTAGG - Intergenic
1199867500 X:151866015-151866037 CCTGATGACACCTTGATTTTAGG - Intergenic
1200492521 Y:3844937-3844959 TCTGCTGACACCTTGATGTTAGG + Intergenic