ID: 1178137645

View in Genome Browser
Species Human (GRCh38)
Location 21:29645984-29646006
Sequence TCTTCTCTTTGGAATGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1104
Summary {0: 1, 1: 2, 2: 6, 3: 44, 4: 1051}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178137645_1178137652 22 Left 1178137645 21:29645984-29646006 CCTTGCACATTCCAAAGAGAAGA 0: 1
1: 2
2: 6
3: 44
4: 1051
Right 1178137652 21:29646029-29646051 AGAGATAACTTTTAACTCCTTGG 0: 1
1: 0
2: 2
3: 26
4: 338
1178137645_1178137648 -7 Left 1178137645 21:29645984-29646006 CCTTGCACATTCCAAAGAGAAGA 0: 1
1: 2
2: 6
3: 44
4: 1051
Right 1178137648 21:29646000-29646022 GAGAAGATTGGCCCCTTGACTGG 0: 1
1: 0
2: 1
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178137645 Original CRISPR TCTTCTCTTTGGAATGTGCA AGG (reversed) Intronic
901358580 1:8675142-8675164 TAGTCACTTTAGAATGTGCAAGG - Intronic
905011680 1:34751380-34751402 TCCTTTCTTTCGAATGTGGAAGG - Intronic
905931778 1:41792979-41793001 TCTGCTCTTTCCAATGTGAATGG + Intronic
906193570 1:43914726-43914748 CCTCCTCTTTGGTGTGTGCAGGG + Intronic
906570204 1:46831322-46831344 TCTAATTTGTGGAATGTGCAGGG + Intergenic
908105562 1:60838245-60838267 TCTTCACCTTGGAAGTTGCAAGG - Intergenic
908422187 1:63969800-63969822 TCATCTGTCTGGAATGTGAAAGG - Intronic
909206880 1:72769801-72769823 GCCTTTCTTTGGAATGTGTAAGG - Intergenic
910109025 1:83662019-83662041 TCTTCACTTTGGAATATGCATGG + Intergenic
910179946 1:84471728-84471750 TTATATCTTTGGAATGTGTATGG - Intergenic
910436495 1:87211014-87211036 TCTTCTCTTTGAATTGTTCTAGG + Intergenic
910861320 1:91744891-91744913 TCTTCCTTTTGAGATGTGCAAGG - Intronic
911586019 1:99691948-99691970 TCTTGTCTTTTGAATCTCCAGGG - Intronic
912367387 1:109145700-109145722 TCATCTCTTTCAAATCTGCAAGG - Intronic
912994286 1:114517660-114517682 ACCTTTCTTTGGAATGTGCAAGG + Intergenic
914392521 1:147235301-147235323 TCTTCACTTGGGAATGAGCCTGG - Intronic
915955235 1:160215308-160215330 TCTTCTGTCTGCAGTGTGCACGG + Exonic
916524820 1:165599582-165599604 CCTTCTCTTTTGAAGGTGCCTGG + Intergenic
917015463 1:170526601-170526623 TCTTTTCTTGGGCAAGTGCAGGG + Intergenic
917447673 1:175120446-175120468 TCCTCTCTGTAGAATGTCCAGGG + Intronic
919052576 1:192529542-192529564 TCTTAACTTTGGAATGCCCAAGG - Intergenic
919678169 1:200408083-200408105 TCTTTTCTTTGAAAACTGCATGG + Exonic
919980164 1:202637928-202637950 TATTCTCTTGGGAATGAGCTAGG - Intronic
920308182 1:205032212-205032234 AGTTCTCTTTGGAAGCTGCATGG - Intergenic
920990871 1:210938053-210938075 TCATGTCATTGGAATGTCCATGG + Intronic
921250655 1:213294669-213294691 TCTTCTCTTTGGGTTGGGCATGG - Intergenic
921555262 1:216591180-216591202 TCTTCTCTTTGGAAGTTGATGGG - Intronic
1063242555 10:4186305-4186327 TCTAATCTTTGGATTGTTCAAGG + Intergenic
1064893854 10:20211139-20211161 TCTTTTTTTTGGAACATGCAGGG + Intronic
1065695291 10:28374198-28374220 TGTTCTCATTGGAATGTTCATGG - Intergenic
1065922154 10:30402266-30402288 TCCTTTTTTTGGAATGTGCAGGG + Intergenic
1067372506 10:45698763-45698785 TCTGTTCTTCGTAATGTGCACGG - Intergenic
1067387273 10:45827361-45827383 TCTTTTCTTCATAATGTGCACGG + Exonic
1067418856 10:46129890-46129912 TCTGTTCTTCGTAATGTGCACGG - Intergenic
1067447004 10:46357246-46357268 TCTGTTCTTCGTAATGTGCACGG - Intergenic
1067454953 10:46412768-46412790 ACTTCTCTTTGGAAAGTGAGGGG - Intergenic
1067504209 10:46836479-46836501 TCTTTTCTTCATAATGTGCACGG - Intergenic
1067590379 10:47503514-47503536 TCTTTTCTTCATAATGTGCACGG + Exonic
1067632251 10:47971866-47971888 ACTTCTCTTTGGAAAGTGAGGGG + Intergenic
1067637501 10:48011616-48011638 TCTTTTCTTCATAATGTGCACGG + Intergenic
1067875992 10:50008718-50008740 TCTTTTCTTCATAATGTGCACGG - Exonic
1068319645 10:55394765-55394787 TCTTGTCTTTGGATTGTGTTTGG + Intronic
1068527800 10:58150470-58150492 CATTCTCTTTGGAAAGAGCATGG - Intergenic
1069254993 10:66321960-66321982 TCTTCATTTGGGAATGTGCATGG + Intronic
1070134097 10:73676045-73676067 TCTGTTCTTCGTAATGTGCACGG + Exonic
1070953272 10:80447695-80447717 TCTTCTGTCTGGAATGTGGGTGG + Intergenic
1071125424 10:82329174-82329196 TTTTCTCTTTGGCTTGTGCCAGG + Intronic
1071607614 10:87008362-87008384 TCTTTTCTTCGTAATGTGCACGG - Intergenic
1075154874 10:119966881-119966903 TCTTCTCTCTCCAATGTCCATGG - Intergenic
1075348273 10:121700800-121700822 GATTCTATCTGGAATGTGCAGGG - Intergenic
1075939008 10:126372292-126372314 TCTTCTCTTTTGATGGTACAGGG - Intronic
1076569559 10:131423742-131423764 GGCTCTCTTTGGAATGTGCCGGG + Intergenic
1077185383 11:1233405-1233427 TTTTCTCTTCAGAATGTGCTGGG - Intronic
1077748828 11:4940418-4940440 TCTTCTGTTTGGATTCTGAAAGG - Intronic
1078428184 11:11268095-11268117 TCTTCTCCTTGGCTTGTGCTTGG - Intergenic
1078860359 11:15240879-15240901 TATTCCCTTTGGAATAGGCAGGG - Intronic
1079015944 11:16868771-16868793 TCTTCTCCTTGGAAGCTGGATGG + Intronic
1080110951 11:28567123-28567145 TCTGCACTTTGGAAATTGCATGG + Intergenic
1080135178 11:28845608-28845630 GCTTCTATTTCTAATGTGCAGGG + Intergenic
1080502482 11:32883965-32883987 ACTTTTCTTTGCAATGTACAGGG + Intergenic
1083298474 11:61727896-61727918 TCCTCTCCTTGGAATTCGCATGG - Intronic
1083567101 11:63728476-63728498 ACCTTTCTTTGGCATGTGCAGGG + Intronic
1083690665 11:64406619-64406641 TCCTCTCTTTGGAATGTGCAGGG - Intergenic
1084936465 11:72589712-72589734 TCTTCTCGTTGGAGTCTGCAGGG - Intronic
1087048154 11:93861729-93861751 TTTTTTCATTGGAAAGTGCAAGG + Intergenic
1088992116 11:114962681-114962703 TCCTCTCTTAGGAATCTGCAGGG + Intergenic
1089056609 11:115590742-115590764 TTTTCTCTTAGGAAGGTGAATGG + Intergenic
1090026086 11:123168697-123168719 TCATCTCTGTGGAATTTACAAGG + Intronic
1090736672 11:129617122-129617144 TCTTCTCTGTGGAGTGTGAAGGG - Intergenic
1091058914 11:132443768-132443790 TCTTGTCCTTGATATGTGCAGGG + Intronic
1091330303 11:134726581-134726603 TCTTCTCTTTTGAATGACCCAGG - Intergenic
1092287155 12:7135306-7135328 CCTTCTCTCTGGCATATGCAGGG + Exonic
1092580196 12:9833245-9833267 TCTTCTCTATGGAATGTTTCAGG - Intronic
1095676833 12:44929529-44929551 TATTCTGTTTGTAATGTGTAAGG - Intergenic
1095886060 12:47189838-47189860 TCTTCTGTTTGGAAGTTTCAAGG - Intronic
1096429230 12:51529709-51529731 TCCTTTCTTTGGAATGTGCAAGG - Intergenic
1096888780 12:54744833-54744855 TCCTTTGTTTGGAATGTGCAGGG + Intergenic
1096928704 12:55179020-55179042 TCTTCTCCCTGGAAGTTGCAAGG + Intergenic
1097318507 12:58199699-58199721 GCTTCTCTTTTGAATGGGGAGGG - Intergenic
1098751682 12:74300354-74300376 TTTTCTCTTTGGATAGTCCATGG + Intergenic
1101858429 12:108463217-108463239 TCCTCACTGTGAAATGTGCATGG - Intergenic
1103967440 12:124648871-124648893 TCTTTTCTTTGGAATGTGCAGGG - Intergenic
1104148716 12:126060895-126060917 TCTTATCTATGAAATTTGCATGG + Intergenic
1104257419 12:127151955-127151977 TGTTCTCTTGGGAATGAGAAAGG + Intergenic
1104723266 12:131058377-131058399 TGATCTGTTTGGAATGTGCTGGG + Intronic
1105582122 13:21708049-21708071 CCTTCTCATTGGAATGTCAATGG + Intergenic
1106103071 13:26710799-26710821 TCTCCACTTGGGAAGGTGCAAGG - Intergenic
1106868673 13:33995425-33995447 TCTTCTCATTGTGATGGGCATGG + Intergenic
1107718336 13:43222354-43222376 TCATCTCCTGGGAATGGGCAGGG - Intronic
1107885346 13:44870493-44870515 TCTTCTCTTTGGGGGCTGCAAGG + Intergenic
1108473613 13:50791226-50791248 TCTTCTCTGAGCAATGTGCAGGG + Intronic
1111649893 13:91076247-91076269 CCTTCTCTGTGAAATGTGGAAGG + Intergenic
1111893629 13:94114270-94114292 TCTTGTCTTTGGAAACTCCAAGG + Intronic
1112356709 13:98679529-98679551 TCTCCTCTGTGGAATGGGAATGG + Intergenic
1112632881 13:101181145-101181167 TCTTCTCCTTGGCATCTGCGTGG - Intronic
1113072258 13:106433446-106433468 TCTTCTCTTTGCAGTGTCCTGGG + Intergenic
1113360196 13:109623381-109623403 TCTTCTCATTGAAATGTTAATGG + Intergenic
1115302865 14:31903842-31903864 TCTTCTCTTCGATATCTGCAAGG + Intergenic
1115586445 14:34818730-34818752 GCTTCTCTTTGGCATATACACGG - Intronic
1115706265 14:36002128-36002150 GCCTTTCTTTGGAATGTTCAGGG - Intergenic
1116728768 14:48595838-48595860 TTCTTTCTTTGGAGTGTGCAGGG + Intergenic
1116740524 14:48748657-48748679 ACTCCTATTTGGAATGTGCAGGG - Intergenic
1118140350 14:63073776-63073798 CCTTTTCTTTGTAATGTGTAGGG - Intronic
1118693644 14:68363525-68363547 CCTCCTCATTGGAGTGTGCAGGG + Intronic
1118693650 14:68363549-68363571 CCTCCTCATTGGAGTGTGCAGGG + Intronic
1120027051 14:79598367-79598389 TCTTCTGTCAGGAATGTTCAGGG - Intronic
1120452535 14:84686991-84687013 GGTTCTCTTTGGAATGGACATGG - Intergenic
1120645939 14:87074086-87074108 TCTTATCTATGGAACGTGAAAGG - Intergenic
1120780520 14:88481946-88481968 TCTTCTCTCTGGAATGTTGTTGG - Intronic
1121040949 14:90746934-90746956 TCCTTCCTTTGGAATGTACAGGG - Intronic
1121073562 14:91047455-91047477 TCTTCTCTAATGAATCTGCAGGG - Intronic
1121427790 14:93865076-93865098 TCCTGTCATTGGAATATGCAAGG + Intergenic
1122724672 14:103742350-103742372 TATTCTCTTGGGAATGTGGGTGG - Intronic
1122759555 14:104012327-104012349 GCCTTTCTCTGGAATGTGCATGG + Intronic
1124662119 15:31558301-31558323 TCTCTTCTTTGGAATGTTTAAGG - Intronic
1126283967 15:46989575-46989597 TCATGTCTTTAGAATCTGCAGGG - Intergenic
1126850520 15:52794377-52794399 TCTTCTCTTTGGGATATGGAAGG - Intergenic
1128935057 15:71738923-71738945 GCCTGTCTTTGGCATGTGCAGGG + Intronic
1129562469 15:76586315-76586337 TCCTCTATTTGGAAGGTACATGG + Intronic
1129834526 15:78693710-78693732 TCCTCTTTTTGGAATGTGCAGGG - Intronic
1130071586 15:80650955-80650977 TCCTTTCTTTGGAACATGCAGGG + Intergenic
1130110906 15:80964219-80964241 TATTCTCTTTGTAGTGTGAATGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130678873 15:85979101-85979123 TCATTTGTCTGGAATGTGCAAGG + Intergenic
1131867580 15:96728433-96728455 TCTTCTCTTTGGAATAAGTTAGG + Intergenic
1132008221 15:98250043-98250065 TCTTTTATTTGGAAAGTGGAAGG - Intergenic
1132617670 16:850157-850179 TGTTCTCGTTGGAAGGTGCCTGG + Intergenic
1133495343 16:6312445-6312467 TTTTCTCCTAGGAATTTGCAAGG - Intronic
1135607969 16:23839127-23839149 AAGTCACTTTGGAATGTGCAAGG + Intronic
1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG + Intronic
1136489830 16:30599836-30599858 AGCTTTCTTTGGAATGTGCAGGG + Intergenic
1137004707 16:35263940-35263962 TCATCTCTTAGAAACGTGCATGG + Intergenic
1137979031 16:53054637-53054659 GCTTCTCTTTTAAATGTGCTGGG - Intergenic
1138650231 16:58456281-58456303 CCCCTTCTTTGGAATGTGCAGGG - Intergenic
1139286548 16:65820132-65820154 ACTTTTCTTTGGAATGCTCAAGG + Intergenic
1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG + Intronic
1140656645 16:77147992-77148014 TCTACTGTCTGGAATGTGGATGG - Intergenic
1140850559 16:78931325-78931347 TCTTCTCTTTGGAGACTGAAAGG + Intronic
1146410079 17:32575703-32575725 TCTTCTCTTTGGAGTTTGCCTGG + Intronic
1147219495 17:38920094-38920116 TCTGCCCTTTGCAGTGTGCAGGG + Exonic
1147423819 17:40335829-40335851 TCTTCTCTTTGGTAGAGGCAGGG - Intronic
1149299363 17:55290009-55290031 ATTTCGCTTTGGAATGTGAAAGG + Intronic
1149670681 17:58406217-58406239 TCTTCTTAATGGAATGTTCAGGG + Intronic
1150655898 17:67039212-67039234 TTCTTTCTTTGGAATGTGTAGGG + Intergenic
1154424109 18:14258953-14258975 TCTTCCCTTTGGATTGAGAAAGG + Intergenic
1156280851 18:35636554-35636576 ATTTCTCTTTGGAATGTGAATGG + Intronic
1156706105 18:39884339-39884361 TCTTCTCTATGGGAGGTGAAAGG - Intergenic
1157342243 18:46789799-46789821 TCCTTTATTTGGCATGTGCAGGG - Intergenic
1157575134 18:48738553-48738575 TCTTCTCCTGGGTATTTGCATGG + Intronic
1157754859 18:50208572-50208594 TCCTTTCTTTGGAATGTGCAGGG + Intergenic
1157780337 18:50432790-50432812 ACTTTTCCTTGGAATGTGCAGGG - Intergenic
1157817110 18:50737385-50737407 GCCTTTCTTTGAAATGTGCAGGG + Intergenic
1158080444 18:53583728-53583750 ACTTCTCTTTCGAATATGGAAGG + Intergenic
1159709597 18:71739875-71739897 TCTACTCTTTGGAATAGACAAGG - Intronic
1160546825 18:79663323-79663345 TTTTCTTTTTGGACTCTGCATGG - Intergenic
1160624068 18:80190909-80190931 AATTCTCTGTGAAATGTGCAGGG + Intronic
1162820105 19:13217795-13217817 TCCTTTCATCGGAATGTGCAGGG - Intronic
1163675064 19:18651575-18651597 TGTTGTCTTTGGAAGGTGCTGGG + Intronic
1163825670 19:19523287-19523309 TCTTCTCTTAAGAATGGCCAAGG + Intronic
1165039018 19:33055691-33055713 TCTTCTCTCTGCAAGGAGCAGGG - Intronic
1165549253 19:36569820-36569842 TTTCTTCTTTGGAATGTGCAGGG - Intronic
1165685000 19:37812377-37812399 TCAGTTCTTAGGAATGTGCAAGG + Intronic
1165739619 19:38197592-38197614 CCATCTCCTTGGAATGTCCAGGG + Intronic
1167242895 19:48355703-48355725 TCCTTTCTTTGGAATGTGCGGGG - Intronic
1167828507 19:51997594-51997616 TTCTTTCTTTGGAATGTGTAGGG - Intronic
1167853400 19:52219172-52219194 TCCTATCCTCGGAATGTGCAGGG + Intronic
925140622 2:1547454-1547476 ACTTCCCTTTGGAATGGGCCTGG + Intergenic
925432510 2:3807424-3807446 TCTTCTCTTGGGAGTTTTCAAGG + Intronic
925787811 2:7449907-7449929 TCTACTTCTTGGAATTTGCAAGG + Intergenic
927286249 2:21360101-21360123 TCCTCTCTTTGGAATGGAGAGGG + Intergenic
929810489 2:45185349-45185371 TCTTCTCTGGTGAATGTGCCAGG - Intergenic
930625562 2:53693507-53693529 TTTTCTCTTTGGAATGTCTGTGG - Intronic
931185533 2:59947491-59947513 GCTTCTCTCTCAAATGTGCAAGG - Intergenic
931805071 2:65796422-65796444 TTATCTCATTGGAATATGCATGG + Intergenic
932128512 2:69167011-69167033 TGTTCACTGGGGAATGTGCAGGG + Intronic
932369467 2:71175405-71175427 TCCTTTTTTTGGGATGTGCAGGG - Intergenic
933514106 2:83279007-83279029 TCTTCATTTTGGAACTTGCATGG + Intergenic
933819769 2:86100060-86100082 ACACCTCTTTGGAATCTGCAGGG + Exonic
935690383 2:105726282-105726304 TCTGCTCTGTGGAAATTGCAAGG - Intergenic
936549228 2:113420985-113421007 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
937070916 2:119062343-119062365 TCATCACATTGGAATGTGTATGG + Intergenic
937322919 2:120971660-120971682 CCTTCTCTTTGGAAAATGCAGGG - Intronic
939811577 2:146839462-146839484 TCCTTTCTTTGGAATGGGCAAGG - Intergenic
940359471 2:152782035-152782057 GCCTTTCTTTGGAATGTGCAGGG - Intergenic
941042734 2:160641605-160641627 TATTTTCTTTTGAGTGTGCAAGG - Intergenic
943535005 2:189137821-189137843 TCTTCTCTTTAAAATTTGCCAGG - Intronic
944335846 2:198533333-198533355 TCATCTATTTGGCATGTGCTTGG + Intronic
944584761 2:201163781-201163803 TCTTCTCTTTGATATTTGCATGG + Intronic
944654769 2:201866618-201866640 TCTTGTCTTTGGAAGGAGAAGGG + Intronic
944948204 2:204715628-204715650 TCCTCTGTTTGAAATTTGCAAGG + Intronic
945318925 2:208399298-208399320 GCCTTTCTTGGGAATGTGCAGGG - Intronic
946000460 2:216477843-216477865 TCTTCCCTTTGCAATGTGTGTGG + Intronic
946659143 2:221980690-221980712 TTTTCTTTTTGGAATGTTCGAGG - Intergenic
947239254 2:227976754-227976776 ACCTCTCTGGGGAATGTGCAGGG - Intergenic
947247571 2:228066563-228066585 TGTTCTCTCTGGAAGGTGAAGGG - Intronic
947758018 2:232582646-232582668 TGCTCTCTTTGGAATTTTCACGG - Intronic
948710491 2:239822096-239822118 TCTTCTCTGTGCAAGGGGCACGG - Intergenic
1169024482 20:2357405-2357427 TCTCCTCTGTGGAATGTGTGTGG + Intergenic
1169683575 20:8244780-8244802 TCTTCTCTGTGGAATTGGAAAGG - Intronic
1172377562 20:34457373-34457395 TCTTCTCTTTGGGAAGGGCAGGG - Exonic
1175266230 20:57705055-57705077 TCTTCTCTTTGGGTTGGGAATGG - Intronic
1176207661 20:63898486-63898508 TCTTCTCTATGTCTTGTGCAGGG - Intronic
1176665375 21:9682030-9682052 ACTTCTCTTTGGCAATTGCAAGG - Intergenic
1176693474 21:9946116-9946138 TCTTCTCTTTTGGATGTTCCAGG + Intergenic
1176871370 21:14085235-14085257 TCTTTTCTTTGCAAAGGGCAAGG - Intergenic
1178059204 21:28833898-28833920 GCCTTTCTTGGGAATGTGCAAGG - Intergenic
1178137645 21:29645984-29646006 TCTTCTCTTTGGAATGTGCAAGG - Intronic
1178233156 21:30810771-30810793 TCTTCCCATCAGAATGTGCATGG + Intergenic
1178688785 21:34733356-34733378 TTTTCTCTTTGGCATCTCCAAGG - Intergenic
1179526672 21:41982134-41982156 TCTCCTGTTTGGTATATGCACGG - Intergenic
1179672926 21:42962458-42962480 TCTTCTCTTTTAACTGTGTAGGG - Intergenic
1180944774 22:19686224-19686246 TCTTCTCTTTGGATCCTGGAAGG - Intergenic
1182450652 22:30418635-30418657 GCTCCTCTTGGGAATGGGCAAGG - Intronic
1183596532 22:38815913-38815935 TCCTTTCTTTGGAATGCACAGGG - Intergenic
1183661801 22:39225629-39225651 TCTTCTCTGTGGTCTGTGGATGG - Intronic
1184492085 22:44815543-44815565 CCTTCTCTTTGGAACGTGTGGGG + Intronic
949774586 3:7618322-7618344 TTTTACCTTTGGAATTTGCATGG + Intronic
950899026 3:16479812-16479834 TCTGCTGTTTGGTAGGTGCAGGG - Intronic
951244165 3:20320994-20321016 TCTTCTCCCTGGAATGTGATAGG - Intergenic
951688906 3:25374777-25374799 TCTTCTTTTCAGAATGTACAAGG + Intronic
951984605 3:28604528-28604550 TCTTGACTTTGAAATGTTCACGG + Intergenic
952577714 3:34794867-34794889 TCTTTGCTTTGGAATATGTAGGG - Intergenic
952604303 3:35125789-35125811 TCTTCTCTTTGGCATTTGAGAGG + Intergenic
953559281 3:43972075-43972097 TCTGCCCTTTGCAGTGTGCAGGG - Intergenic
953600516 3:44359290-44359312 ACCTTTCTTTGGAATGTGCAAGG - Intronic
955393828 3:58540621-58540643 TCCTTTCTTTGGACTATGCAGGG + Intergenic
958208977 3:90443533-90443555 TCTTTTTTTTAGAATATGCAAGG - Intergenic
958273668 3:91543949-91543971 ACTTGTCTGTGGAATTTGCAAGG - Intergenic
958273988 3:91549389-91549411 ACTTGTCTGTGGAATTTGCAAGG - Intergenic
958274371 3:91555713-91555735 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958274547 3:91558600-91558622 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958274732 3:91561495-91561517 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958274892 3:91564049-91564071 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958275070 3:91566945-91566967 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958275247 3:91569837-91569859 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958275405 3:91572390-91572412 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958275580 3:91575280-91575302 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958275755 3:91578169-91578191 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958275935 3:91581058-91581080 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958276112 3:91583951-91583973 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958276287 3:91586843-91586865 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958276466 3:91589734-91589756 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958276594 3:91591777-91591799 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958276772 3:91594668-91594690 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958276964 3:91597899-91597921 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958277316 3:91603683-91603705 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958277493 3:91606575-91606597 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958277665 3:91609465-91609487 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958278020 3:91615248-91615270 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958278178 3:91617802-91617824 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958278353 3:91620693-91620715 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958278527 3:91623586-91623608 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958278697 3:91626477-91626499 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958279051 3:91632257-91632279 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958279393 3:91638039-91638061 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958279500 3:91639736-91639758 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958279836 3:91645181-91645203 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958280013 3:91648073-91648095 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958280189 3:91650963-91650985 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958280366 3:91653860-91653882 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958280544 3:91656754-91656776 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958280714 3:91659650-91659672 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958280872 3:91662203-91662225 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958281047 3:91665097-91665119 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958281224 3:91667988-91668010 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958281399 3:91670881-91670903 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958281574 3:91673773-91673795 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958281747 3:91676664-91676686 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958281931 3:91679556-91679578 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958282105 3:91682444-91682466 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958282282 3:91685335-91685357 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958282457 3:91688226-91688248 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958282633 3:91691118-91691140 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958282805 3:91694009-91694031 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958282914 3:91695884-91695906 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958283071 3:91698437-91698459 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958283224 3:91700989-91701011 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958283353 3:91703205-91703227 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958283532 3:91706095-91706117 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958283706 3:91708987-91709009 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958284241 3:91717663-91717685 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958284438 3:91720553-91720575 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958284615 3:91723448-91723470 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958284790 3:91726339-91726361 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958284966 3:91729230-91729252 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958285142 3:91732124-91732146 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958285488 3:91737908-91737930 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958285664 3:91740802-91740824 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958285852 3:91743691-91743713 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958286009 3:91746244-91746266 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958286186 3:91749135-91749157 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958286361 3:91752027-91752049 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958286532 3:91754918-91754940 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958286709 3:91757810-91757832 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958286881 3:91760703-91760725 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958287056 3:91763595-91763617 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958287240 3:91766484-91766506 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958287418 3:91769375-91769397 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958287597 3:91772270-91772292 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958287771 3:91775162-91775184 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958287947 3:91778054-91778076 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958288300 3:91783839-91783861 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958288470 3:91786730-91786752 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958288644 3:91789620-91789642 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958288823 3:91792512-91792534 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958288997 3:91795403-91795425 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958289173 3:91798295-91798317 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958289368 3:91801524-91801546 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958289544 3:91804417-91804439 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958289718 3:91807303-91807325 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958289896 3:91810195-91810217 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958290073 3:91813087-91813109 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958290249 3:91815979-91816001 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958290600 3:91821762-91821784 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958290769 3:91824653-91824675 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958290947 3:91827546-91827568 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958291106 3:91830100-91830122 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958291282 3:91832991-91833013 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958291457 3:91835882-91835904 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958291616 3:91838436-91838458 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958291793 3:91841328-91841350 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958291975 3:91844221-91844243 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958292154 3:91847114-91847136 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958292310 3:91849665-91849687 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958292504 3:91852898-91852920 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958292684 3:91855791-91855813 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958292856 3:91858683-91858705 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958293035 3:91861578-91861600 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958293209 3:91864468-91864490 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958293385 3:91867357-91867379 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958293647 3:91871442-91871464 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958293842 3:91874331-91874353 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958294081 3:91878231-91878253 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958294254 3:91881122-91881144 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958294410 3:91883675-91883697 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958294588 3:91886568-91886590 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958294766 3:91889459-91889481 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958295014 3:91892771-91892793 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958295190 3:91895666-91895688 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958295359 3:91898557-91898579 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958295663 3:91903659-91903681 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958295845 3:91906550-91906572 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958296068 3:91910303-91910325 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958296239 3:91913195-91913217 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958296417 3:91916089-91916111 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958296594 3:91918980-91919002 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958296703 3:91920854-91920876 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958296876 3:91923746-91923768 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958297050 3:91926637-91926659 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958297226 3:91929530-91929552 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958297398 3:91932422-91932444 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958297585 3:91935314-91935336 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958297765 3:91938204-91938226 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958297944 3:91941093-91941115 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958298121 3:91943986-91944008 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958298296 3:91946878-91946900 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958298465 3:91949772-91949794 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958298636 3:91952662-91952684 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958298810 3:91955553-91955575 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958298992 3:91958444-91958466 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958299186 3:91961334-91961356 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958299364 3:91964227-91964249 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958299715 3:91970010-91970032 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958299891 3:91972902-91972924 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958300068 3:91975794-91975816 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958300244 3:91978685-91978707 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958300417 3:91981580-91981602 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958300589 3:91984471-91984493 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958300761 3:91987363-91987385 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958300949 3:91990253-91990275 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958301147 3:91993483-91993505 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958301319 3:91996375-91996397 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958301491 3:91999268-91999290 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958301664 3:92002159-92002181 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958301853 3:92005050-92005072 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958301982 3:92007264-92007286 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958302158 3:92010155-92010177 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958302332 3:92013046-92013068 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958302506 3:92015937-92015959 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958302684 3:92018831-92018853 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958302858 3:92021723-92021745 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958303036 3:92024617-92024639 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958303209 3:92027508-92027530 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958303379 3:92030401-92030423 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958303556 3:92033296-92033318 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958303667 3:92035171-92035193 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958303844 3:92038063-92038085 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958304018 3:92040954-92040976 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958304190 3:92043845-92043867 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958304526 3:92049288-92049310 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958304703 3:92052180-92052202 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958304876 3:92055072-92055094 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958305050 3:92057962-92057984 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958305230 3:92060855-92060877 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958305411 3:92063750-92063772 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958305566 3:92066303-92066325 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958305748 3:92069196-92069218 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958305927 3:92072089-92072111 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958306103 3:92074981-92075003 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958306233 3:92077197-92077219 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958306409 3:92080091-92080113 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958306584 3:92082986-92083008 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958306758 3:92085879-92085901 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958306936 3:92088771-92088793 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958307119 3:92091660-92091682 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958307229 3:92093534-92093556 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958307404 3:92096425-92096447 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958307577 3:92099316-92099338 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958307754 3:92102209-92102231 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958307910 3:92104762-92104784 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958308086 3:92107653-92107675 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958308259 3:92110540-92110562 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958308431 3:92113431-92113453 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958308606 3:92116325-92116347 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958308777 3:92119216-92119238 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958308881 3:92120915-92120937 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958309060 3:92123807-92123829 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958309237 3:92126699-92126721 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958309412 3:92129593-92129615 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958309584 3:92132483-92132505 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958309740 3:92135036-92135058 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958309916 3:92137929-92137951 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958310086 3:92140818-92140840 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958310266 3:92143712-92143734 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958310455 3:92146944-92146966 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958310629 3:92149837-92149859 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958310806 3:92152733-92152755 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958311174 3:92158515-92158537 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958311349 3:92161406-92161428 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958311522 3:92164297-92164319 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958311696 3:92167188-92167210 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958311869 3:92170082-92170104 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958312056 3:92172976-92172998 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958312237 3:92175869-92175891 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958312414 3:92178762-92178784 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958312588 3:92181652-92181674 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958312763 3:92184543-92184565 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958312870 3:92186241-92186263 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958313047 3:92189132-92189154 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958313222 3:92192025-92192047 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958313381 3:92194579-92194601 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958313574 3:92197810-92197832 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958313759 3:92200703-92200725 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958313955 3:92203937-92203959 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958314128 3:92206830-92206852 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958314315 3:92209720-92209742 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958314494 3:92212613-92212635 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958314651 3:92215166-92215188 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958314828 3:92218060-92218082 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958315002 3:92220950-92220972 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958315175 3:92223844-92223866 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958315351 3:92226738-92226760 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958315510 3:92229291-92229313 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958315704 3:92232184-92232206 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958315890 3:92235075-92235097 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958316067 3:92237970-92237992 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958316239 3:92240864-92240886 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958316414 3:92243756-92243778 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958316590 3:92246650-92246672 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958316943 3:92252437-92252459 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958317117 3:92255332-92255354 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958317224 3:92257029-92257051 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958317386 3:92259582-92259604 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958317561 3:92262474-92262496 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958317734 3:92265365-92265387 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958317912 3:92268258-92268280 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958318088 3:92271149-92271171 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958318264 3:92274041-92274063 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958318440 3:92276935-92276957 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958318547 3:92278810-92278832 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958318725 3:92281699-92281721 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958318882 3:92284253-92284275 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958319058 3:92287147-92287169 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958319252 3:92290381-92290403 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958319427 3:92293273-92293295 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958319603 3:92296166-92296188 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958319775 3:92299057-92299079 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958320044 3:92303477-92303499 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958320219 3:92306369-92306391 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958320378 3:92308924-92308946 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958320554 3:92311819-92311841 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958320725 3:92314712-92314734 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958320902 3:92317603-92317625 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958321075 3:92320496-92320518 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958321254 3:92323387-92323409 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958321370 3:92325266-92325288 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958321494 3:92327481-92327503 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958321670 3:92330376-92330398 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958321830 3:92332930-92332952 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958322003 3:92335819-92335841 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958322175 3:92338713-92338735 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958322352 3:92341606-92341628 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958322528 3:92344498-92344520 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958322702 3:92347394-92347416 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958322877 3:92350287-92350309 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958323055 3:92353177-92353199 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958323226 3:92356068-92356090 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958323404 3:92358960-92358982 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958323578 3:92361853-92361875 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958323755 3:92364746-92364768 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958323850 3:92366282-92366304 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958323980 3:92368498-92368520 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958324143 3:92371052-92371074 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958324314 3:92373943-92373965 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958324491 3:92376834-92376856 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958324672 3:92379728-92379750 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958324852 3:92382617-92382639 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958325028 3:92385508-92385530 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958325201 3:92388401-92388423 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958325377 3:92391293-92391315 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958325539 3:92393846-92393868 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958325712 3:92396738-92396760 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958325890 3:92399631-92399653 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958326068 3:92402524-92402546 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958326243 3:92405420-92405442 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958326416 3:92408311-92408333 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958326595 3:92411204-92411226 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958326767 3:92414094-92414116 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958326935 3:92416985-92417007 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958327117 3:92419877-92419899 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958327299 3:92422771-92422793 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958327476 3:92425663-92425685 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958327653 3:92428555-92428577 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958327828 3:92431446-92431468 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958328005 3:92434338-92434360 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958328178 3:92437234-92437256 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958328350 3:92440124-92440146 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958328528 3:92443017-92443039 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958328703 3:92445908-92445930 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958328877 3:92448800-92448822 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958329055 3:92451692-92451714 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958329230 3:92454583-92454605 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958329407 3:92457474-92457496 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958329583 3:92460364-92460386 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958329742 3:92462919-92462941 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958329917 3:92465811-92465833 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958330093 3:92468703-92468725 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958330265 3:92471593-92471615 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958330442 3:92474485-92474507 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958330600 3:92477039-92477061 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958330775 3:92479931-92479953 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958330954 3:92482824-92482846 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958331130 3:92485716-92485738 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958331316 3:92488607-92488629 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958331500 3:92491497-92491519 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958331683 3:92494387-92494409 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958331864 3:92497278-92497300 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958332037 3:92500168-92500190 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958332210 3:92503059-92503081 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958332390 3:92505953-92505975 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958332741 3:92511736-92511758 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958332914 3:92514629-92514651 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958333090 3:92517521-92517543 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958333269 3:92520413-92520435 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958333449 3:92523306-92523328 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958333622 3:92526191-92526213 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958333799 3:92529084-92529106 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958333977 3:92531980-92532002 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958334153 3:92534868-92534890 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958334264 3:92536746-92536768 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958334438 3:92539640-92539662 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958334617 3:92542531-92542553 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958334796 3:92545423-92545445 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958334964 3:92548318-92548340 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958335140 3:92551210-92551232 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958335311 3:92554101-92554123 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958335490 3:92556998-92557020 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958335665 3:92559887-92559909 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958335776 3:92561763-92561785 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958335889 3:92563637-92563659 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958336067 3:92566528-92566550 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958336245 3:92569422-92569444 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958336419 3:92572311-92572333 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958336594 3:92575204-92575226 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958336766 3:92578095-92578117 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958336942 3:92580986-92581008 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958337115 3:92583879-92583901 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958337474 3:92589662-92589684 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958337652 3:92592555-92592577 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958337822 3:92595448-92595470 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958337997 3:92598343-92598365 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958338168 3:92601235-92601257 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958338341 3:92604125-92604147 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958338496 3:92606682-92606704 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958338672 3:92609578-92609600 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958338852 3:92612472-92612494 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958339035 3:92615361-92615383 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958339182 3:92617915-92617937 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958339357 3:92620808-92620830 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958339534 3:92623702-92623724 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958339707 3:92626594-92626616 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958339882 3:92629487-92629509 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958340063 3:92632381-92632403 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958340245 3:92635272-92635294 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958340422 3:92638164-92638186 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958340597 3:92641055-92641077 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958340771 3:92643947-92643969 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958340886 3:92645821-92645843 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958341065 3:92648711-92648733 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958341240 3:92651600-92651622 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958341399 3:92654153-92654175 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958341556 3:92656710-92656732 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958341731 3:92659600-92659622 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958341905 3:92662491-92662513 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958342067 3:92665044-92665066 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958342248 3:92667939-92667961 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958342429 3:92670831-92670853 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958342604 3:92673723-92673745 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958342961 3:92679508-92679530 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958343140 3:92682399-92682421 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958343311 3:92685289-92685311 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958343489 3:92688181-92688203 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958343663 3:92691074-92691096 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958343836 3:92693968-92693990 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958344016 3:92696860-92696882 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958344194 3:92699753-92699775 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958344367 3:92702649-92702671 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958344526 3:92705203-92705225 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958344706 3:92708093-92708115 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958344880 3:92710984-92711006 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958345039 3:92713538-92713560 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958345218 3:92716430-92716452 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958345398 3:92719321-92719343 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958345556 3:92721874-92721896 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958345731 3:92724765-92724787 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958345902 3:92727656-92727678 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958346100 3:92730547-92730569 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958346275 3:92733439-92733461 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958346546 3:92737688-92737710 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958346719 3:92740578-92740600 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958346895 3:92743473-92743495 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958347070 3:92746364-92746386 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958347245 3:92749256-92749278 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958347420 3:92752149-92752171 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958347594 3:92755043-92755065 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958347767 3:92757934-92757956 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958347928 3:92760489-92760511 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958348104 3:92763381-92763403 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958348406 3:92768486-92768508 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958348582 3:92771378-92771400 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958348761 3:92774271-92774293 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958348934 3:92777163-92777185 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958349177 3:92781068-92781090 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958349351 3:92783959-92783981 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958349522 3:92786848-92786870 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958349699 3:92789738-92789760 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958349876 3:92792630-92792652 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958350057 3:92795527-92795549 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958350237 3:92798418-92798440 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958350349 3:92800298-92800320 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958350525 3:92803189-92803211 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958350683 3:92805742-92805764 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958350857 3:92808630-92808652 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958351105 3:92812538-92812560 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958351282 3:92815429-92815451 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958351450 3:92818321-92818343 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958351631 3:92821214-92821236 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958351803 3:92824106-92824128 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958351974 3:92826998-92827020 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958352284 3:92832099-92832121 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958352464 3:92834992-92835014 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958352645 3:92837883-92837905 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958352817 3:92840777-92840799 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958352990 3:92843666-92843688 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958353161 3:92846559-92846581 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958353337 3:92849450-92849472 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958353514 3:92852346-92852368 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958353691 3:92855235-92855257 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958353869 3:92858127-92858149 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958354042 3:92861018-92861040 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958354220 3:92863911-92863933 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958354387 3:92866803-92866825 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958354559 3:92869694-92869716 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958354736 3:92872585-92872607 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958354908 3:92875477-92875499 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958355087 3:92878369-92878391 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958355262 3:92881260-92881282 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958355436 3:92884152-92884174 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958355609 3:92887043-92887065 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958355784 3:92889936-92889958 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958356087 3:92895037-92895059 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958356258 3:92897925-92897947 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958356435 3:92900815-92900837 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958356614 3:92903707-92903729 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958356969 3:92909490-92909512 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958357139 3:92912384-92912406 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958357317 3:92915278-92915300 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958357497 3:92918172-92918194 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958357672 3:92921065-92921087 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958357830 3:92923622-92923644 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958358008 3:92926515-92926537 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958358184 3:92929411-92929433 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958358532 3:92935195-92935217 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958358708 3:92938086-92938108 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958358884 3:92940978-92941000 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958359057 3:92943871-92943893 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958359231 3:92946763-92946785 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958359408 3:92949655-92949677 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958359563 3:92952207-92952229 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958359755 3:92955438-92955460 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958359931 3:92958329-92958351 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958360104 3:92961220-92961242 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958360281 3:92964114-92964136 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958360458 3:92967005-92967027 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958360640 3:92969895-92969917 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958360891 3:92973799-92973821 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958361157 3:92978220-92978242 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958361332 3:92981111-92981133 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958361549 3:92984675-92984697 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958361722 3:92987567-92987589 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958362076 3:92993350-92993372 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958362248 3:92996243-92996265 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958362428 3:92999136-92999158 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958362608 3:93002029-93002051 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958362785 3:93004922-93004944 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958362959 3:93007813-93007835 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958363118 3:93010366-93010388 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958363302 3:93013257-93013279 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958363478 3:93016149-93016171 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958363650 3:93019040-93019062 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958363807 3:93021591-93021613 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958363985 3:93024483-93024505 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958364344 3:93030262-93030284 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958364524 3:93033154-93033176 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958364696 3:93036045-93036067 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958364878 3:93038936-93038958 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958365060 3:93041829-93041851 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958365250 3:93044720-93044742 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958365428 3:93047615-93047637 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958365604 3:93050509-93050531 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958365783 3:93053401-93053423 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958365965 3:93056294-93056316 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958366136 3:93059185-93059207 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958366313 3:93062075-93062097 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958366485 3:93064969-93064991 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958366644 3:93067520-93067542 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958366824 3:93070414-93070436 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958367004 3:93073305-93073327 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958367178 3:93076196-93076218 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958367357 3:93079090-93079112 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958367532 3:93081983-93082005 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958367714 3:93084877-93084899 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958367887 3:93087768-93087790 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958368065 3:93090660-93090682 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958368177 3:93092534-93092556 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958368352 3:93095426-93095448 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958368526 3:93098317-93098339 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958368700 3:93101209-93101231 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958368882 3:93104097-93104119 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958369056 3:93106989-93107011 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958369231 3:93109882-93109904 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958369406 3:93112773-93112795 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958369568 3:93115326-93115348 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958369694 3:93117540-93117562 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958369866 3:93120431-93120453 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958370046 3:93123323-93123345 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958370227 3:93126216-93126238 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958370383 3:93128770-93128792 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958370540 3:93131323-93131345 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958370715 3:93134213-93134235 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958370888 3:93137105-93137127 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958371066 3:93139996-93140018 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958371243 3:93142886-93142908 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958371414 3:93145777-93145799 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958371589 3:93148669-93148691 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958371764 3:93151562-93151584 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958371937 3:93154456-93154478 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958372115 3:93157347-93157369 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958372297 3:93160240-93160262 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958372481 3:93163130-93163152 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958372659 3:93166021-93166043 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958372837 3:93168913-93168935 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958373011 3:93171804-93171826 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958373184 3:93174691-93174713 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958373359 3:93177583-93177605 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958373535 3:93180476-93180498 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958373708 3:93183367-93183389 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958373888 3:93186263-93186285 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958374063 3:93189150-93189172 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958374235 3:93192044-93192066 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958374398 3:93194598-93194620 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958374576 3:93197491-93197513 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958374746 3:93200382-93200404 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958374927 3:93203271-93203293 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958375101 3:93206164-93206186 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958375231 3:93208380-93208402 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958375405 3:93211274-93211296 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958375580 3:93214166-93214188 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958375750 3:93217057-93217079 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958375922 3:93219947-93219969 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958376096 3:93222839-93222861 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958376282 3:93225730-93225752 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958376637 3:93231514-93231536 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958376827 3:93234405-93234427 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958376990 3:93236962-93236984 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958377167 3:93239854-93239876 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958377339 3:93242746-93242768 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958377517 3:93245641-93245663 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958377678 3:93248199-93248221 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958377862 3:93251089-93251111 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958378036 3:93253980-93254002 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958378212 3:93256870-93256892 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958378375 3:93259423-93259445 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958378552 3:93262314-93262336 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958378731 3:93265202-93265224 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958378909 3:93268097-93268119 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958379087 3:93270985-93271007 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958379268 3:93273878-93273900 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958379443 3:93276771-93276793 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958379620 3:93279663-93279685 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958379775 3:93282222-93282244 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958379952 3:93285113-93285135 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958380127 3:93288006-93288028 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958380311 3:93290900-93290922 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958380486 3:93293794-93293816 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958380600 3:93295669-93295691 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958380772 3:93298540-93298562 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958380943 3:93301431-93301453 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958381106 3:93303984-93304006 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958381285 3:93306877-93306899 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958381463 3:93309771-93309793 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958381635 3:93312662-93312684 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958381815 3:93315557-93315579 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958381998 3:93318448-93318470 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958382111 3:93320325-93320347 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958382289 3:93323215-93323237 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958382481 3:93326446-93326468 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958382663 3:93329337-93329359 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958382832 3:93332228-93332250 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958383006 3:93335116-93335138 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958383186 3:93338008-93338030 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958383373 3:93341076-93341098 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958383553 3:93343971-93343993 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958383728 3:93346862-93346884 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958383905 3:93349754-93349776 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958384078 3:93352645-93352667 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958384258 3:93355537-93355559 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958384429 3:93358426-93358448 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958384608 3:93361319-93361341 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958384782 3:93364209-93364231 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958384968 3:93367103-93367125 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958385140 3:93369988-93370010 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958385315 3:93372880-93372902 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958385493 3:93375771-93375793 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958385670 3:93378663-93378685 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958385846 3:93381553-93381575 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958386020 3:93384445-93384467 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958386193 3:93387336-93387358 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958386365 3:93390223-93390245 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958386545 3:93393116-93393138 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958386720 3:93396006-93396028 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958386877 3:93398559-93398581 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958387051 3:93401449-93401471 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958387210 3:93404002-93404024 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958387384 3:93406895-93406917 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958387562 3:93409787-93409809 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958387736 3:93412680-93412702 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958387918 3:93415569-93415591 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958388099 3:93418458-93418480 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958388278 3:93421351-93421373 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958388458 3:93424245-93424267 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958388568 3:93425946-93425968 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958388738 3:93428838-93428860 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958388910 3:93431731-93431753 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958389072 3:93434284-93434306 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958389253 3:93437177-93437199 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958389426 3:93440070-93440092 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958389582 3:93442622-93442644 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958389757 3:93445514-93445536 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958389934 3:93448406-93448428 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958390110 3:93451298-93451320 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958390457 3:93457072-93457094 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958390636 3:93459965-93459987 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958390812 3:93462856-93462878 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958390992 3:93465747-93465769 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958391168 3:93468638-93468660 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958391362 3:93471956-93471978 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958391538 3:93474848-93474870 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958391719 3:93477738-93477760 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958391896 3:93480629-93480651 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958392078 3:93483522-93483544 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958392256 3:93486413-93486435 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958392437 3:93489302-93489324 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958392611 3:93492194-93492216 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958392785 3:93495085-93495107 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958392961 3:93497976-93497998 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958393134 3:93500868-93500890 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958393314 3:93503760-93503782 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958393491 3:93506645-93506667 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958393665 3:93509534-93509556 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958393836 3:93512425-93512447 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958394013 3:93515317-93515339 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958394186 3:93518208-93518230 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958394368 3:93521098-93521120 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958394549 3:93523992-93524014 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958394721 3:93526883-93526905 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958394908 3:93529774-93529796 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958395084 3:93532665-93532687 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958395260 3:93535556-93535578 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958395433 3:93538451-93538473 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958395608 3:93541345-93541367 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958395789 3:93544239-93544261 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958395967 3:93547131-93547153 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958396145 3:93550023-93550045 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958396323 3:93552918-93552940 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958396500 3:93555810-93555832 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958396675 3:93558701-93558723 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958396857 3:93561591-93561613 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958397030 3:93564482-93564504 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958397203 3:93567371-93567393 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958397377 3:93570263-93570285 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958397546 3:93573153-93573175 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958397720 3:93576047-93576069 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958397894 3:93578940-93578962 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958398077 3:93581832-93581854 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958398601 3:93590504-93590526 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958398776 3:93593397-93593419 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958398952 3:93596289-93596311 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958399126 3:93599182-93599204 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958399300 3:93602073-93602095 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958399480 3:93604962-93604984 ACTTTTCTGTGGAATTTGCAAGG + Intergenic
958399666 3:93607850-93607872 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958399843 3:93610742-93610764 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958400018 3:93613638-93613660 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958400197 3:93616528-93616550 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958400369 3:93619416-93619438 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958400544 3:93622309-93622331 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958400721 3:93625201-93625223 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958400893 3:93628092-93628114 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958401066 3:93630985-93631007 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958401244 3:93633878-93633900 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958401423 3:93636769-93636791 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958401777 3:93642552-93642574 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958401949 3:93645445-93645467 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958402128 3:93648337-93648359 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958402500 3:93654122-93654144 ACTTGTCTGTGGAATTTGCAAGG + Intergenic
958402639 3:93706400-93706422 ACTTTTCTGTGGAATTTGCAAGG - Intergenic
958402822 3:93709288-93709310 ACTTTTCTGTGGAATTTGCAAGG - Intergenic
959123261 3:102258178-102258200 ACTTCTCTTTGGAATCAGTAGGG + Intronic
959341875 3:105142059-105142081 TTTTCTCTTGAGAATGTGCTGGG - Intergenic
960451989 3:117821304-117821326 TCATCTCTTTGCAATATCCAAGG + Intergenic
961070537 3:123919956-123919978 TCTTCTCTTTAAAATGTTCAGGG + Intronic
963074596 3:141334304-141334326 TCTTCTCATGGGAATGTGAGGGG + Intronic
964531973 3:157678560-157678582 TATTCTCTTTAGAAAGTGCCAGG + Intergenic
964797467 3:160515460-160515482 TTTTCTCTTTGGGATGTGTCAGG + Exonic
966243883 3:177784507-177784529 TTTTCTTTTTGGCATGTGCATGG - Intergenic
967524970 3:190481877-190481899 TCTTCTCTGTGGAAAATGCCAGG - Intergenic
967845890 3:194042546-194042568 TCTTCTCTTTGGAGTGTTCAGGG - Intergenic
968276431 3:197443984-197444006 TGTCCTCTTTGGTCTGTGCAGGG - Intergenic
969533682 4:7742722-7742744 TTGTCTCTTTGTTATGTGCATGG - Exonic
969562481 4:7958431-7958453 GGTTCTCTTTGGAATTTGAATGG - Intergenic
970063679 4:12066333-12066355 TTTTCTCTCTAAAATGTGCAAGG - Intergenic
970545860 4:17129384-17129406 TCCTTTCTTTGGAACGTACAGGG + Intergenic
970640789 4:18063903-18063925 TTTTTTCTTTGTAATGTGCAGGG - Intergenic
971334823 4:25712666-25712688 TAATCTCTGTGGAATATGCATGG + Intergenic
971746881 4:30592636-30592658 TCTTTTCTTTTGTATTTGCATGG + Intergenic
974377723 4:61099576-61099598 TCTTCTCTTGGCAATTTGGATGG - Intergenic
975469570 4:74749550-74749572 TCCTTTCTTTGCAATGTGCTAGG - Intronic
975877233 4:78855599-78855621 TATTTTTGTTGGAATGTGCAGGG + Intronic
975903115 4:79176831-79176853 TCTTGTCCTTGGGACGTGCATGG - Intergenic
976281298 4:83329323-83329345 TTCTCTCTTTGGAATCTACAGGG - Intronic
976932273 4:90582282-90582304 GCTTTTCCTGGGAATGTGCAGGG + Intronic
978369511 4:108016370-108016392 TCTTCTCTTTGTCAGGGGCAGGG - Intronic
978449583 4:108817156-108817178 TCTTTTCTTTGGAATGGAAAGGG - Intronic
979830794 4:125298795-125298817 TCCTTTCTTTGGAATGTGCAAGG + Intergenic
980097582 4:128508353-128508375 TCTTTGCTTTGGAATGTGATTGG + Intergenic
980366094 4:131806357-131806379 TCTTCTCTTTTGGATGTTCCAGG + Intergenic
982062730 4:151621006-151621028 TGTTCTCTTAGGATAGTGCAGGG - Intronic
982469673 4:155773112-155773134 TATTCTCTTGGCAATGTACAGGG + Intronic
984250169 4:177322339-177322361 TCTTCTCATTGGAATGCACCTGG + Intronic
985410864 4:189682493-189682515 ACTTCTCTTTGGCAATTGCAAGG - Intergenic
986082238 5:4407274-4407296 TTTTCTCTTTGGAAAGAGAAAGG + Intergenic
986136796 5:4987541-4987563 TCATTTCTGGGGAATGTGCAGGG - Intergenic
987928072 5:24367056-24367078 TTTTCTTTTTGGTATGTACATGG + Intergenic
988503257 5:31800643-31800665 TCCTTTCTTTGGAATGCACATGG + Intronic
989151377 5:38303050-38303072 TCTTCTCTATGAAATGGGAATGG - Intronic
989454756 5:41630425-41630447 TCTTCCCTTTCAAATGTGAAAGG + Intergenic
991035511 5:62123896-62123918 CTTTCTCTTTGGAATTTCCAAGG - Intergenic
991321426 5:65377484-65377506 TCATCTCTCCGGATTGTGCAGGG - Intronic
991390616 5:66139811-66139833 TCTACTCTATGGAATCTGAAAGG - Intergenic
991614942 5:68486317-68486339 TCCTCTCTCTGGAATCTGAAGGG + Intergenic
992319823 5:75602465-75602487 ACCTCTCTTTGAAAAGTGCAGGG + Intergenic
993000311 5:82374259-82374281 GCTTGTCTTTGAAATGTGAATGG + Intronic
993610648 5:90050148-90050170 CCTTTTTTTTGGAATATGCAGGG - Intergenic
994924733 5:106100120-106100142 ACTTTTCTCTAGAATGTGCATGG - Intergenic
995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG + Intergenic
996096082 5:119400595-119400617 TCCTTTCTTTGGAATTTGCAGGG + Intergenic
996480680 5:123971964-123971986 TCTTATCTTTGGAATAGGCTTGG + Intergenic
998530965 5:142884166-142884188 TCTCCCCGTTGGAATGTGGAAGG + Intronic
999392543 5:151204703-151204725 TCTTTTCTTTGAAATGTCCATGG - Intronic
1000100327 5:158010133-158010155 TCTTCTCTCAGAAATCTGCAAGG + Intergenic
1001593781 5:172884775-172884797 TCTTCTCTATGGAAAGAGCTAGG + Intronic
1001663777 5:173415952-173415974 TCTTGTGTTGGGAACGTGCATGG + Intergenic
1002405779 5:179029232-179029254 TCTTCTCTTTGGAATCTTACAGG + Intronic
1003238418 6:4319437-4319459 TCTTCTCTTTCAAATGAGGAAGG - Intergenic
1003354126 6:5350083-5350105 TATTCCCTTTGGAATCAGCAAGG + Intronic
1003630692 6:7783798-7783820 TCTTCTTCATGGAATGAGCATGG + Intronic
1003850605 6:10218569-10218591 TCTGCTCTATGAAATGTGTAGGG + Intergenic
1003999471 6:11583330-11583352 TCTCCTCTTTGTAATATACAGGG + Exonic
1005276802 6:24228196-24228218 GCTTCTTTTTGGAATCTGGAAGG + Intronic
1006264860 6:32912459-32912481 TCATCTCATGGGAATATGCATGG + Intergenic
1007058029 6:38907677-38907699 TCATCTCTTTAAAATGTCCAGGG - Intronic
1007693172 6:43716014-43716036 TCTTCTCCTTGGCTAGTGCAGGG + Intergenic
1008176876 6:48278966-48278988 TCTTCCTTTTGGAAAATGCAAGG - Intergenic
1009321967 6:62302768-62302790 TCTTCTCTTTTGAATCAGGAAGG + Intergenic
1009410125 6:63356693-63356715 TCTTCTCCTAGGTATATGCATGG - Intergenic
1010145976 6:72669917-72669939 TTTTTTTTTTGGAATGTGGATGG + Intronic
1010766717 6:79783542-79783564 TATTTTCTTTTGAATGTGAAAGG + Intergenic
1011112123 6:83850287-83850309 TCTTCCCGCTGGAATGTACAAGG - Intergenic
1011242466 6:85287397-85287419 TTTTCTCTTTGGGATGTGTCAGG - Intergenic
1012821173 6:104086771-104086793 TCTACTCTTTAGCATTTGCATGG + Intergenic
1013240360 6:108239626-108239648 TCTTCTCTTTTGAATGTCTTCGG - Intronic
1014003099 6:116386806-116386828 ACTTCTCTTGGGAATGTGTATGG + Intronic
1015457215 6:133439940-133439962 ACCTTTCTTTTGAATGTGCAGGG + Intronic
1015636526 6:135280089-135280111 TCTTCTCTAGGAAATGGGCAAGG + Intergenic
1015815852 6:137209895-137209917 TCTGCTCTCTGGGGTGTGCAGGG + Intronic
1015911990 6:138178260-138178282 TCTTGGCTTTGGCATGTGGAAGG - Intronic
1016616131 6:146050601-146050623 TCTTCTCTTTGGAAATTTCCAGG + Intronic
1017468043 6:154713204-154713226 AACTTTCTTTGGAATGTGCAAGG - Intergenic
1018327760 6:162692290-162692312 TCTTTTCTTTAGAATGTGTGTGG - Intronic
1018581441 6:165311410-165311432 TTGTCTCTCTGGAACGTGCATGG + Intergenic
1019969418 7:4528167-4528189 TTCTTTCTTTGGAATGTGCAGGG - Intergenic
1021931913 7:25589529-25589551 TCTCCTCTTTGGGATTTGGATGG - Intergenic
1022118616 7:27285206-27285228 TCTTCTCTTTGATATTTTCATGG + Intergenic
1022147651 7:27561936-27561958 TCTTTTGATTGGAATTTGCATGG + Intronic
1022482142 7:30751369-30751391 TCTTCTCTTTGAAATGGGACTGG - Intronic
1022814533 7:33902152-33902174 TCTCCTCTTTGAAATTTCCATGG + Intergenic
1023553635 7:41396829-41396851 TATTATCTTTTTAATGTGCATGG + Intergenic
1028348441 7:89813486-89813508 TCAACTCTTTGGAATCTGCATGG + Intergenic
1029161104 7:98552658-98552680 ATTTCTTTTAGGAATGTGCATGG - Intergenic
1029793871 7:102873648-102873670 TCTGCTCTTTGGACCGTGGAAGG - Intronic
1030439398 7:109567951-109567973 TCTTCTCTTTATTATGTACATGG + Intergenic
1030473511 7:109998821-109998843 CCTTCTCTGTGGCATGTGCTGGG - Intergenic
1030607866 7:111657454-111657476 TCTTCTGTTTGCCATGTTCATGG + Intergenic
1031387187 7:121165728-121165750 TCTTCTTTTTGGCATGTGTTGGG + Intronic
1031616537 7:123888477-123888499 GATTCTCTTTGGAATTTGAATGG - Intergenic
1031959281 7:127974397-127974419 TCTTCTATTTGGTATTTCCAGGG - Intronic
1033063117 7:138127025-138127047 ACCTTTCTTTGGAAGGTGCAGGG - Intergenic
1036098135 8:5747706-5747728 TCTTCTCTATGGAAGATGGAAGG + Intergenic
1036444182 8:8807336-8807358 GATTCTCTTTGGAATCTGAATGG - Intronic
1036462347 8:8964565-8964587 GATTCTCTTTGGAATCTGAATGG + Intergenic
1038012538 8:23486457-23486479 TCTTCTCTAAGAAATGTGCAGGG - Intergenic
1038144880 8:24886179-24886201 ACTTCACTTTGGAATGGACAAGG + Intergenic
1038701480 8:29853386-29853408 TCTTCTCATTGGAATTTCAAAGG - Intergenic
1039956109 8:42208172-42208194 TCTCTTCTTTGTAAAGTGCAGGG + Intergenic
1040852766 8:51919053-51919075 CCTTCTCTTGGAAATGTGCAGGG + Intergenic
1041183980 8:55279285-55279307 GCTTCTCTTTGCAATGTCTAGGG + Intronic
1041315184 8:56553845-56553867 TGTTCTCTTAGGAAAGTGAAAGG + Intergenic
1042070967 8:64933076-64933098 GCTTTTCTATGGAAAGTGCATGG + Intergenic
1042480037 8:69292381-69292403 TTTTTTTTTTGGAATTTGCAGGG + Intergenic
1042504951 8:69549943-69549965 CCTTCTGTTTGGAAGGTGAAAGG + Intronic
1043753543 8:83971109-83971131 TTTACCCTTTGGAATGTGCGTGG - Intergenic
1045220232 8:100191843-100191865 GTTTCTCTTTGTAATGAGCATGG + Intronic
1045857490 8:106781092-106781114 TCTTAACATTGGAGTGTGCAGGG + Intergenic
1047173421 8:122517168-122517190 TCTTCTCTTTGGATTAAACAAGG - Intergenic
1048066794 8:130978164-130978186 GAATCTCTTTGGAATATGCAAGG - Intronic
1048084440 8:131161710-131161732 TCTTCTCCCTGGAATCTGCAAGG + Intergenic
1048852488 8:138658234-138658256 ACATTTCTTTGGAATGTGCAGGG - Intronic
1049512415 8:143035825-143035847 AGTTCTCTTTGGAATGTGAATGG - Intergenic
1049903712 9:195862-195884 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1051653477 9:19353986-19354008 TATCATCTTTGGACTGTGCAAGG + Intronic
1051730729 9:20140049-20140071 TATTCTCTTTTCAATGTGCTGGG - Intergenic
1053746718 9:41206166-41206188 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1054480566 9:65659191-65659213 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
1054681627 9:68225116-68225138 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
1056794547 9:89648727-89648749 CCTGCCCTTTGGAAGGTGCATGG + Intergenic
1057036346 9:91814391-91814413 TCTTCTCCCTGGAGTGTGCGTGG - Intronic
1058418595 9:104813991-104814013 ACTTCTCTTTGGACTCTGTAGGG + Intronic
1058543061 9:106031927-106031949 GCTTCTCTTATGAATGAGCAAGG + Intergenic
1059034519 9:110739640-110739662 ACCTTTCTTTGGAATGTGTAGGG + Intronic
1059477720 9:114561270-114561292 GTTTGTCTTTGGAAGGTGCAGGG + Intergenic
1060168769 9:121443286-121443308 TCTTATCTTTACATTGTGCATGG - Intergenic
1061673019 9:132199779-132199801 ATCTTTCTTTGGAATGTGCAGGG + Intronic
1061936021 9:133858060-133858082 TCTTGTCTTCGGCATGTGGAGGG - Intronic
1062039329 9:134396872-134396894 ACATCCCTTTGGAATCTGCAGGG - Intronic
1062052486 9:134454799-134454821 ACCTTTCTTTGGAATGTGCAGGG - Intergenic
1202782848 9_KI270718v1_random:16945-16967 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1203660724 Un_KI270753v1:39730-39752 ACTTCTCTTTGGCAATTGCAAGG + Intergenic
1203671898 Un_KI270755v1:22943-22965 ACTTCTCTTTGGCAATTGCAAGG + Intergenic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1185723565 X:2401481-2401503 TATCCTCTTTGGAAGGTGCACGG - Intronic
1185784381 X:2877465-2877487 TCTTCTCTCTGGCATTTGCCTGG + Intronic
1186357623 X:8803604-8803626 ACCTTTCTTTGGAAAGTGCAGGG + Intergenic
1186856163 X:13628208-13628230 ACCTTTCTTTGGAATGTGTATGG + Intronic
1187405191 X:18997341-18997363 TCTTCTCATTAGAATATGAATGG - Intronic
1190242291 X:48666806-48666828 TCCTCTCTTTGGACAGTACAGGG - Intergenic
1190500346 X:51070047-51070069 TCTTCTCTTTGCTGTTTGCATGG - Intergenic
1191342289 X:59483912-59483934 CTCTTTCTTTGGAATGTGCAAGG + Intergenic
1191344734 X:59516771-59516793 CTCTTTCTTTGGAATGTGCAAGG + Intergenic
1191394009 X:60175372-60175394 CTCTTTCTTTGGAATGTGCAAGG + Intergenic
1191401273 X:60272894-60272916 TTCTTTCTTTGGAATCTGCAAGG + Intergenic
1191510715 X:61737746-61737768 CCCTTTCTTTGGAATCTGCAAGG + Intergenic
1191512382 X:61760206-61760228 CCCTTTCTTTGGAATCTGCAAGG + Intergenic
1191518487 X:61841989-61842011 CTCTTTCTTTGGAATGTGCAAGG + Intergenic
1191728314 X:64305479-64305501 TTTTCTCTTTGGGATGTGTCAGG + Intronic
1196494674 X:116310626-116310648 TCTTCTCTCTATAAGGTGCAAGG - Intergenic
1197203901 X:123773249-123773271 TCTTCTCTTTGAAATTAGCATGG - Intergenic
1198998109 X:142599793-142599815 TCTCCTCTATGGAATTGGCAGGG + Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199852438 X:151735286-151735308 TGTTCTCTTTGGTAGGTACATGG + Intergenic
1201998741 Y:20126004-20126026 TCTTCCTTTTGGAAGGTTCATGG + Intergenic
1202005865 Y:20270819-20270841 TCTTCTTTCTGGAAGGTTCATGG + Intergenic
1202006808 Y:20283537-20283559 TCTTCTTTCTGGAAGGTTCATGG + Intergenic
1203337756 Y_KI270740v1_random:23897-23919 TCTTCTCTCTGGCAGGTTCATGG + Intergenic