ID: 1178140112

View in Genome Browser
Species Human (GRCh38)
Location 21:29673078-29673100
Sequence CTTTATTCCCAGAGGGCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178140109_1178140112 -2 Left 1178140109 21:29673057-29673079 CCTTGAGTAAAGGCTTGGCATCT 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1178140112 21:29673078-29673100 CTTTATTCCCAGAGGGCAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 181
1178140105_1178140112 16 Left 1178140105 21:29673039-29673061 CCTTGCCTTTCTTCATCTCCTTG 0: 1
1: 0
2: 5
3: 93
4: 790
Right 1178140112 21:29673078-29673100 CTTTATTCCCAGAGGGCAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 181
1178140106_1178140112 11 Left 1178140106 21:29673044-29673066 CCTTTCTTCATCTCCTTGAGTAA 0: 1
1: 0
2: 3
3: 25
4: 310
Right 1178140112 21:29673078-29673100 CTTTATTCCCAGAGGGCAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178140112 Original CRISPR CTTTATTCCCAGAGGGCAGC TGG Exonic
900640224 1:3684943-3684965 CCTTGTCCCCAGAGAGCAGCCGG - Intronic
900680195 1:3912255-3912277 GTTCATGCCCAGAGGGCGGCCGG - Intergenic
900948638 1:5845167-5845189 CCGTGTTCCCAGCGGGCAGCCGG + Intergenic
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
901537220 1:9890437-9890459 TTTTCTTCCCAGAGAACAGCTGG + Intronic
902179222 1:14675210-14675232 CTTCACACCAAGAGGGCAGCAGG + Intronic
903744814 1:25579743-25579765 CTTTTTTCCCAGATGGCCACAGG + Intergenic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
905915531 1:41681897-41681919 CACCATTCCCAGAGGGGAGCTGG - Intronic
907731160 1:57067346-57067368 CTTTATTTACAGAGGTCAGAGGG + Intronic
916447840 1:164890309-164890331 ATTTACTCCCAGAAGTCAGCAGG + Intronic
916519839 1:165553717-165553739 CTGCAGTCCCAGAGGGCAGAGGG - Intronic
917207262 1:172590233-172590255 CTTGATTCCCAGAGGGCTCATGG + Intronic
917510332 1:175664187-175664209 GTTTTTGCCCAGAGGCCAGCTGG - Intronic
920533597 1:206722964-206722986 CTTCACTCCCAGGAGGCAGCTGG - Intronic
921921606 1:220676263-220676285 CTTTATTCAAAGAGAGCTGCAGG - Intergenic
922539598 1:226408652-226408674 CTCTCTCCCCTGAGGGCAGCTGG + Intergenic
922902625 1:229148414-229148436 CTTTGTGCCCAGGGAGCAGCTGG - Intergenic
923083487 1:230682963-230682985 CTTTTTTCCCTGATGACAGCTGG - Intronic
1063081303 10:2770277-2770299 TTTTATTCCCATAGGGGAACAGG - Intergenic
1070810333 10:79294413-79294435 CTCACTTCCCAGAGGGCAGGAGG - Intronic
1074351064 10:112737553-112737575 CTGCATTCCCAGGGGGCGGCAGG + Intronic
1074363200 10:112838983-112839005 CTTTCTTCCCTGAGGGCTGCTGG + Intergenic
1074396883 10:113105346-113105368 ATTTCTTCCCAGAGAGGAGCAGG - Intronic
1074401195 10:113142326-113142348 CTTTTTTCCCAAAGGGGAGAGGG + Intronic
1075638617 10:124048477-124048499 CTCTTATCCCTGAGGGCAGCTGG + Intronic
1081577961 11:44331281-44331303 CTTTATTTCCAGTTGGCATCAGG - Intergenic
1082783559 11:57304205-57304227 CTTTAATCCCAGTGGGAACCTGG - Intronic
1083201030 11:61121203-61121225 CCTTCTTCCCAAAGTGCAGCGGG + Intronic
1084302732 11:68261985-68262007 CCATATACCCAGAGGGCCGCTGG - Exonic
1085409487 11:76282810-76282832 CATAATTCCCAGGGAGCAGCTGG + Intergenic
1085865225 11:80282832-80282854 CCTTATCAACAGAGGGCAGCAGG - Intergenic
1088912662 11:114203793-114203815 TTCTATTCACAGAAGGCAGCAGG + Intronic
1089486134 11:118847512-118847534 CTTTATTGTCAGAAGTCAGCCGG - Intergenic
1090080743 11:123610841-123610863 CTTTATTCCCAGCACCCAGCTGG + Intronic
1090110272 11:123900042-123900064 GTTTCTTCCCAGTGGGCAGGAGG + Intergenic
1091234147 11:134008521-134008543 CTTGATTCCCAAAGCGCTGCGGG - Intergenic
1092547790 12:9466812-9466834 CTTTATTCCCAGACCCCAGAAGG - Intergenic
1097036304 12:56126733-56126755 CCATATTCCCAGAGGTAAGCAGG - Exonic
1097491239 12:60272333-60272355 CTTTACTCTCAGAGGGCACCTGG + Intergenic
1098624419 12:72644943-72644965 CTTTATTCCCAGGGAGAAGCAGG - Intronic
1099398704 12:82175100-82175122 CTTCATTCCCAAAAGGCAGTTGG - Intergenic
1101810734 12:108105573-108105595 CTGTATTCCCAGAATGAAGCAGG - Intergenic
1102358462 12:112261257-112261279 TTTTCTTCCCACAGGGCAGCTGG + Intronic
1102683002 12:114703167-114703189 CCTTATTCCCAGAGTGCATTTGG + Intergenic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1102942473 12:116955754-116955776 CTTAACTTCCAGAGGGCAACTGG - Intronic
1104383050 12:128324736-128324758 CTATATTCCCAGAGCCCAGGAGG + Intronic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1106451737 13:29888541-29888563 CTGTCTTCCCAGAGAGCATCAGG - Intergenic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107677996 13:42816889-42816911 CTTTGTTACAAGATGGCAGCCGG + Intergenic
1110479568 13:75958731-75958753 CTTTATCCCCAGAGTGCTACAGG + Intergenic
1111201909 13:84949071-84949093 CTTTCTTTGCAGAGAGCAGCAGG + Intergenic
1112308139 13:98293792-98293814 CTTTCTTCCCAGTGGGCAGGAGG - Intronic
1113533196 13:111044729-111044751 CTTTATTCCCGGAGCACAGAGGG - Intergenic
1115887255 14:37986222-37986244 CCTTTTCCCCAGAGGGCAGAGGG + Intronic
1118456375 14:65948668-65948690 CTCTATCCGCAGAGGGCAGAGGG + Intergenic
1119539781 14:75430262-75430284 CTTTCTTTCCAGAGTGGAGCTGG - Intronic
1124604077 15:31157880-31157902 TGTTTTTCCCACAGGGCAGCTGG + Intronic
1127064095 15:55219111-55219133 CTTTATTCACAGAGGATAGTTGG - Intronic
1132072731 15:98793750-98793772 ATTTATACCCAGAGGTCTGCAGG + Intronic
1133015250 16:2936747-2936769 CTTTGTCCCCAGAGGGCCCCGGG + Intronic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1135939412 16:26808360-26808382 CTTTCTTCCCAGACAGCAGCAGG - Intergenic
1138216799 16:55211623-55211645 CTTTCTTAACAGAGGGCAGCTGG - Intergenic
1143938523 17:10513131-10513153 CTTTTTTCCCAGGAGGCAGGAGG - Intronic
1143996179 17:11008341-11008363 CTTCATTTCCAGAAGGCTGCTGG + Intergenic
1144009567 17:11133780-11133802 TTATATTCACAGAGGGCAGTGGG - Intergenic
1145809198 17:27754699-27754721 CTCTCTTCCCAGAGGTCAACTGG - Intergenic
1145935091 17:28710688-28710710 CTTTAGTTCCAGAGGACAGGAGG + Intronic
1147241761 17:39095171-39095193 CTGTATTTTCAGAGGACAGCTGG - Intronic
1147607402 17:41782035-41782057 CTGGATTCCCTGAGGGCAGGCGG - Intronic
1147923701 17:43933924-43933946 CCAAATTCCCAGAGGGCAGCAGG - Intergenic
1148195709 17:45711081-45711103 CTTTCTGCCCAGGGGGCTGCAGG + Intergenic
1148341196 17:46874505-46874527 CCAGATTCCCAGAGGGCAGCAGG - Intronic
1149986485 17:61351396-61351418 TTTTACTCCCAGAAGCCAGCTGG - Intronic
1150229739 17:63543561-63543583 CTTGCTTCCCATAAGGCAGCCGG + Exonic
1150515221 17:65801862-65801884 CTTTATTTCCCGTGGGCAGGGGG - Intronic
1150608235 17:66712663-66712685 CGTCATTCCAAGAAGGCAGCAGG + Intronic
1152085264 17:78214189-78214211 CTCTACTCCCAGAAGGCCGCGGG + Exonic
1153764991 18:8366708-8366730 CATTACTGCCAGAGGGCGGCAGG - Intronic
1157528837 18:48405626-48405648 CTAAATTCCCCTAGGGCAGCTGG + Intronic
1157590434 18:48833421-48833443 CATCTTTCCCAGAGGGCTGCAGG - Intronic
1162860731 19:13504657-13504679 ATTTTTACACAGAGGGCAGCTGG + Intronic
1165483838 19:36083332-36083354 CCTCATTCCCAATGGGCAGCAGG - Intronic
1165890103 19:39106845-39106867 CTGTCTTCCTTGAGGGCAGCAGG + Intronic
1166200389 19:41233772-41233794 ATTCAATCCCAGAGGCCAGCTGG + Intronic
1166510258 19:43403067-43403089 CTTTATCGCCAGATGGCAGTTGG - Intronic
1166977982 19:46616183-46616205 CTATATTCCCAGTGGGCACGAGG + Intergenic
1168593415 19:57654840-57654862 CTATATTCCCACAGGGGGGCTGG + Intergenic
926298773 2:11587595-11587617 CTTTACTCCCCGAGCCCAGCAGG + Intronic
927098866 2:19771438-19771460 CTTTATTCGAAGAGGAAAGCTGG - Intergenic
927208845 2:20626575-20626597 CTTTCTCCCCAGAGAACAGCAGG - Intronic
927214252 2:20657856-20657878 CCTCAACCCCAGAGGGCAGCTGG + Intergenic
929259021 2:39844264-39844286 TTTTATTCTGAGAGGGGAGCAGG + Intergenic
930489305 2:52047904-52047926 TTTTACTCCCAGAGAGCTGCAGG - Intergenic
931229796 2:60364703-60364725 CTTTATGCAGAGAGGGCTGCCGG - Intergenic
936385087 2:112022246-112022268 CTTTGTTCCCAGTGGGCATTTGG + Exonic
940018966 2:149136466-149136488 CCTCATTCCCAGATGGCAGTGGG + Intronic
940446873 2:153786515-153786537 GTTTCTTCCCCAAGGGCAGCAGG - Intergenic
941359375 2:164532886-164532908 CTCGTTTCCCAGAGGGCAGAGGG - Intronic
945191805 2:207196531-207196553 CTATATTCCCAGAGTCTAGCAGG - Intergenic
945205500 2:207327428-207327450 CTTTATTCCCAGAGAATAACTGG - Intergenic
947551562 2:231050419-231050441 CTTTATTCCCTGGGGTCAGGAGG + Intergenic
948834206 2:240616941-240616963 TTTCATTCCCAATGGGCAGCTGG - Intronic
1169853815 20:10081985-10082007 CTTTAATCACAGTAGGCAGCCGG + Intergenic
1171991443 20:31699627-31699649 ATTTATTCCAAGAGTGGAGCAGG + Intronic
1172152640 20:32801199-32801221 CCTTATTCCCTGAGACCAGCAGG - Intronic
1172762036 20:37329616-37329638 CCTTACTCCCTGAGGTCAGCTGG + Intergenic
1173332496 20:42087028-42087050 TTTGTTTCCCAGAGGGCATCTGG + Intronic
1173787331 20:45803765-45803787 ATTTATGCCCACAGGGAAGCTGG - Intronic
1174180082 20:48669047-48669069 CATCCTTCCCAGAGGGCTGCAGG - Intronic
1175743088 20:61434514-61434536 ATTCTTTCCCAGAGGACAGCCGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1178140112 21:29673078-29673100 CTTTATTCCCAGAGGGCAGCTGG + Exonic
1179894124 21:44351835-44351857 CTCTAATCCCAGAGGCAAGCAGG - Intronic
1181449741 22:23011592-23011614 TTTTCTTCCCAGAGGGCACTTGG + Intergenic
1183772002 22:39934707-39934729 CTTAATTCCCAAACAGCAGCGGG + Intronic
949229481 3:1733878-1733900 CTTTATTTCTAGAGTCCAGCAGG + Intergenic
953462842 3:43095361-43095383 CTGTAAGCCCAGAGGGCAGTGGG - Intronic
953702644 3:45208621-45208643 CTTTATTCCAAGATGGCAGCTGG - Intergenic
954401752 3:50322829-50322851 CTTTCCTCTCAGGGGGCAGCAGG - Intronic
954979643 3:54733309-54733331 CCTTGTGCCAAGAGGGCAGCTGG + Intronic
960142025 3:114159988-114160010 CGTTGTTCCCACAGGGCAGATGG + Intronic
960166101 3:114403229-114403251 CTTTCTTCACAGAAGGGAGCTGG + Intronic
960475407 3:118118484-118118506 CCTTCTTCCCATAGGGAAGCAGG - Intergenic
960566789 3:119141875-119141897 CTTTTTACCCAGATGCCAGCAGG - Intronic
962416260 3:135184777-135184799 GTATCTTCACAGAGGGCAGCAGG + Intronic
962601125 3:136991579-136991601 AGTTATTCCCAGAAGGCAGCAGG - Intronic
965370505 3:167856121-167856143 CTTTTTTCCCTGAGGGCCACAGG + Intergenic
965478541 3:169187505-169187527 CTATATTGCCACAGAGCAGCTGG - Intronic
965668428 3:171120881-171120903 CCGTAGTCCCAGAGAGCAGCAGG + Intronic
968813443 4:2810211-2810233 CTATCTTCCCAGAGGGAAGCTGG - Intronic
969251508 4:5971334-5971356 CTTGATTCCTAGTGGACAGCAGG - Intronic
971218130 4:24680867-24680889 CTTAATACCCAAAGGGCAGAGGG - Intergenic
971476775 4:27080113-27080135 TTTAATGCCCAGAAGGCAGCTGG - Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
971728339 4:30343122-30343144 ATTTATTACCAGAGCACAGCCGG + Intergenic
972071943 4:35032091-35032113 TTTTATGCCCAGAGAGAAGCTGG - Intergenic
972591924 4:40496076-40496098 CTTTTTTCTCAGAGGAAAGCAGG - Intronic
972794234 4:42399525-42399547 ACTTACTCCCAGAGGGCAGCTGG - Intronic
974286583 4:59876836-59876858 ATCTATTCCCAGAAGGAAGCAGG + Intergenic
979960334 4:127012613-127012635 TTTTATTCAGAGAAGGCAGCTGG + Intergenic
987383541 5:17308303-17308325 CTTTATTACCAGTGGGTACCTGG + Intergenic
988420549 5:31000416-31000438 CTTTATAGCCAGATGGCAGTAGG - Intergenic
995407125 5:111810976-111810998 TTTTATTCCCAGTGAGCACCAGG - Intronic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
997685218 5:135783727-135783749 CTTAATTTCCAGAGGGAAGGAGG + Intergenic
999053394 5:148548297-148548319 ACATCTTCCCAGAGGGCAGCAGG - Intronic
1000927494 5:167211640-167211662 CTATAGTCTCAGAGGGCAGTGGG + Intergenic
1001087105 5:168708211-168708233 CTCCATGCCCAGATGGCAGCTGG + Intronic
1002494019 5:179599654-179599676 CTGTTTTCCCAGAGGGGAGGAGG + Intronic
1002618924 5:180472735-180472757 TTTTATACCCAGAGGACAGCTGG + Intergenic
1004125245 6:12866692-12866714 TTTTATTTGCAGAGGGAAGCTGG - Intronic
1005657275 6:27953647-27953669 CTGTAATCCCAGCGGGAAGCTGG - Intergenic
1007092571 6:39193395-39193417 CCTTTTGCCCAGAGGGCAGTGGG - Intronic
1007747627 6:44052730-44052752 TCTTATTCCCAGAAAGCAGCTGG - Intergenic
1010809964 6:80289922-80289944 CTCTAGTCCCACAGGGAAGCTGG - Intronic
1015002680 6:128238415-128238437 CTTTGTTGCCACAAGGCAGCTGG + Intronic
1015342344 6:132115688-132115710 TTGTATTCCCAGAGTTCAGCTGG + Intergenic
1019898712 7:4002933-4002955 CTTCCTTCCCAGAGGGCACTGGG + Intronic
1021927837 7:25550416-25550438 CTTTAATCCCAGAGGGGAGAAGG - Intergenic
1024105404 7:46079588-46079610 CTTTATACCCTGAGGGTAACTGG + Intergenic
1024673915 7:51621189-51621211 GTTTCTTCCCAGGGGGAAGCCGG - Intergenic
1024934929 7:54702266-54702288 CTTTATTCGTAGAGGCCAGATGG + Intergenic
1026116306 7:67498607-67498629 TTTTATTGAGAGAGGGCAGCAGG + Intergenic
1026765540 7:73157230-73157252 TTGTGTTCCCAGAGGCCAGCAGG - Intergenic
1026898456 7:74023923-74023945 CTCTCTTCCCAGAGGCCACCAGG - Intergenic
1026966913 7:74446038-74446060 CTTTATTCCCATAGGGCTGGAGG + Intergenic
1027042013 7:74966923-74966945 TTGTGTTCCCAGAGGCCAGCAGG - Intronic
1027081628 7:75235431-75235453 TTGTGTTCCCAGAGGCCAGCAGG + Intergenic
1029390213 7:100270012-100270034 TTGTGTTCCCAGAGGCCAGCAGG + Intronic
1029622463 7:101698690-101698712 CTTTATTCCCAGGGGGCCCCAGG + Intergenic
1033353973 7:140584661-140584683 CTGAATGCCCAGAGGGCAGGGGG - Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1034292879 7:149946486-149946508 ATTTGGTCCCAGAGGTCAGCAGG + Intergenic
1034592556 7:152154511-152154533 CTGTATTCACAGATGTCAGCAGG - Intronic
1034813190 7:154150386-154150408 ATTTGGTCCCAGAGGTCAGCAGG - Intronic
1035205536 7:157291810-157291832 CTTTGCTCCCAGAGCCCAGCTGG - Intergenic
1035746767 8:1966603-1966625 TTTTAATCCCAGACAGCAGCCGG + Intergenic
1039011325 8:33096557-33096579 CTTTCTGACCAGAGGGCAACTGG - Intergenic
1039473272 8:37826722-37826744 CTCTCCTCCCAGCGGGCAGCCGG + Intronic
1039841180 8:41294206-41294228 CTTTAAACCCTGAGAGCAGCTGG - Intronic
1041001474 8:53459058-53459080 CTCTTTTCCCAGAGGTCAGTGGG - Intergenic
1045189769 8:99871247-99871269 CTTTGTTCCCAGGAGGAAGCAGG + Intronic
1047541300 8:125768899-125768921 CTTTGTTCTCAGCAGGCAGCTGG + Intergenic
1047861965 8:128976903-128976925 TGATATTCTCAGAGGGCAGCAGG - Intergenic
1056280947 9:85040790-85040812 CTGTGTCCCAAGAGGGCAGCGGG - Intergenic
1057466156 9:95316912-95316934 TTTTATTCCCGGAGGGAGGCGGG - Intronic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1061720070 9:132546037-132546059 CCTTGTCCCCAGAGGCCAGCAGG + Intronic
1186371165 X:8948930-8948952 CTTTCTTCTCAGAGAGAAGCAGG + Intergenic
1187178522 X:16919342-16919364 CTTTATTCACTTAGGACAGCTGG - Intergenic
1188955954 X:36435337-36435359 CTTTTTTCCAAGATGGCAGATGG + Intergenic
1189901635 X:45712652-45712674 CTTCAATCCCAGAGGTCAGAAGG - Intergenic
1190435557 X:50421245-50421267 ATCTTTTCCCAGAGGGCAGGAGG + Intronic
1194121217 X:89965900-89965922 CTTTATTGCCCGGGGCCAGCAGG + Intergenic
1197511329 X:127372292-127372314 CTTTCTTCCCAGAGGTCAGATGG + Intergenic
1200474074 Y:3623351-3623373 CTTTATTGCCTGGGGCCAGCAGG + Intergenic