ID: 1178140230

View in Genome Browser
Species Human (GRCh38)
Location 21:29674529-29674551
Sequence GTGTCGGGGGGGAACTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178140216_1178140230 11 Left 1178140216 21:29674495-29674517 CCACTCAAATCTTATCCCGAATT 0: 1
1: 3
2: 123
3: 1978
4: 11662
Right 1178140230 21:29674529-29674551 GTGTCGGGGGGGAACTTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1178140217_1178140230 -4 Left 1178140217 21:29674510-29674532 CCCGAATTGTAATCCCCATGTGT 0: 6
1: 17
2: 32
3: 60
4: 278
Right 1178140230 21:29674529-29674551 GTGTCGGGGGGGAACTTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1178140214_1178140230 13 Left 1178140214 21:29674493-29674515 CCCCACTCAAATCTTATCCCGAA 0: 1
1: 6
2: 117
3: 1872
4: 11469
Right 1178140230 21:29674529-29674551 GTGTCGGGGGGGAACTTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1178140218_1178140230 -5 Left 1178140218 21:29674511-29674533 CCGAATTGTAATCCCCATGTGTC 0: 8
1: 59
2: 90
3: 149
4: 215
Right 1178140230 21:29674529-29674551 GTGTCGGGGGGGAACTTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1178140215_1178140230 12 Left 1178140215 21:29674494-29674516 CCCACTCAAATCTTATCCCGAAT 0: 1
1: 4
2: 120
3: 1931
4: 11524
Right 1178140230 21:29674529-29674551 GTGTCGGGGGGGAACTTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178140230 Original CRISPR GTGTCGGGGGGGAACTTGGT GGG Intronic
900723172 1:4193686-4193708 GTGTGTGGGAGGGACTTGGTGGG + Intergenic
901055128 1:6445770-6445792 GTGGCGGGGGGAAGCTGGGTGGG - Exonic
902479241 1:16702844-16702866 GTGGCGGGGGGAAGCTGGGTGGG + Intergenic
902946815 1:19846801-19846823 GTGTCGTGGGAGCCCTTGGTTGG + Intergenic
906698198 1:47838990-47839012 GTGGCGGGAGGGCACTGGGTTGG + Intronic
907844970 1:58196801-58196823 GTGTCAGGGAGGAATCTGGTGGG - Intronic
913066710 1:115262405-115262427 GTATTGAGGAGGAACTTGGTAGG + Intergenic
915340519 1:155174539-155174561 GTGGTGGGGGGGAACACGGTTGG - Intronic
915722622 1:157995456-157995478 GTGTCGGGGAGGAAGGGGGTGGG + Intronic
1063833463 10:9984049-9984071 TTGTGGGGGGGGGACCTGGTGGG + Intergenic
1068851251 10:61743961-61743983 GGGTGGTGGGGGCACTTGGTAGG - Intronic
1070761330 10:79026344-79026366 GTGTCGAGGGGGGTGTTGGTGGG - Intergenic
1074418729 10:113290335-113290357 GTGTTGAGGAGGAACCTGGTGGG - Intergenic
1075605805 10:123806855-123806877 GTGTAGGGGAGGGACGTGGTGGG - Intronic
1076917255 10:133430481-133430503 GTGTCAGGGGTCTACTTGGTTGG - Intergenic
1076937352 10:133575240-133575262 GTGTCAGGGGTCTACTTGGTTGG - Intergenic
1077045851 11:544847-544869 GGATGGGGGGAGAACTTGGTGGG + Intronic
1077911139 11:6571918-6571940 GTGTTGGGGGTGAGCTTGGTGGG - Exonic
1078733239 11:13995585-13995607 GTGTAGGGGAGGGACCTGGTGGG - Intronic
1079547143 11:21646151-21646173 GTGTTGGGGGGGAAGGTTGTGGG + Intergenic
1082865284 11:57894561-57894583 GTTTCAGGGAGGAACCTGGTGGG - Intergenic
1085146187 11:74199940-74199962 GTGTTGTGGGGGGACCTGGTTGG - Intronic
1089723373 11:120450767-120450789 GTGTTGGGGGAGAACTGGGGTGG + Intronic
1090058199 11:123441310-123441332 GTGTAGGAGGAGAACCTGGTGGG - Intergenic
1091584981 12:1810984-1811006 GTGTGGGGAGGGGACTTTGTGGG + Intronic
1092964780 12:13631094-13631116 GTGTTGGGGAGGGACCTGGTGGG - Intronic
1097013066 12:55966797-55966819 GTGGCGGTCGGGAACTCGGTGGG + Exonic
1098194679 12:67987219-67987241 ATGTCGGGGAGGGACTTAGTGGG + Intergenic
1101326861 12:103723454-103723476 GTGTCATGGAGGAACCTGGTAGG - Intronic
1101540012 12:105656453-105656475 GTGTTGGTGAGGAACCTGGTGGG - Intergenic
1104017228 12:124969232-124969254 GTGTCAGGTGGGAGCTGGGTTGG - Intronic
1104587201 12:130056890-130056912 GTGTTGGGGAGGGACCTGGTAGG + Intergenic
1109679470 13:65730994-65731016 GTGTTGGGGAGGGACCTGGTGGG + Intergenic
1110370134 13:74730382-74730404 ATGTTGGGGGGGAACATGGTGGG - Intergenic
1114927654 14:27423553-27423575 GTGTTGGAGGGGGACTTGGTAGG - Intergenic
1122460410 14:101889713-101889735 GTGTCAGTGGGGAACTGGGCAGG + Intronic
1124690267 15:31815916-31815938 GTGCCGGCTGGGAACATGGTGGG - Intronic
1127710158 15:61589207-61589229 GTGTCGGGGAGGGGCCTGGTGGG - Intergenic
1129070577 15:72946810-72946832 GTGTCGGTGGTGGACTGGGTAGG - Intergenic
1139350443 16:66331657-66331679 GTGTCATGGAGGAACCTGGTGGG + Intergenic
1140310898 16:73847372-73847394 GTGTCGAGGGGGGATTTGGCTGG + Intergenic
1142891552 17:2947265-2947287 GTGGTGGGGGGAGACTTGGTTGG + Intronic
1145388267 17:22435168-22435190 GTGTCGGGGCGGGGCTTGGCGGG - Intergenic
1146924643 17:36735948-36735970 GTGTCGGAGGTGAGATTGGTGGG + Intergenic
1148793269 17:50185447-50185469 GGGTTGGGGGGAAAGTTGGTTGG + Exonic
1149570660 17:57670015-57670037 GTCTAGGGCTGGAACTTGGTGGG + Intronic
1149575604 17:57709959-57709981 GTGTCGGGGTGGGACTAGATGGG + Intergenic
1152184304 17:78844559-78844581 GTGTGGGGCGGGGACTTGGAGGG - Intergenic
1152851967 17:82642239-82642261 CTGTCGGGGCAGAGCTTGGTGGG - Intronic
1153760615 18:8327918-8327940 GTGTCTGGAGGGAACTTTTTAGG - Intronic
1157353702 18:46914562-46914584 GTGTCGGGGGTGGAGTTGGGGGG - Intronic
1164775887 19:30853260-30853282 GTGTTGGGGGGTAACTGGGATGG - Intergenic
1164995943 19:32720403-32720425 GTGTGGGGGTGGAGCTGGGTGGG - Intronic
1167097280 19:47381115-47381137 GTCCCGGGGGGGCACTTGGGTGG + Intronic
1167208490 19:48118285-48118307 GTGTCGTGGAGGGACCTGGTGGG + Intronic
1202713280 1_KI270714v1_random:28750-28772 GTGGCGGGGGGAAGCTGGGTGGG + Intergenic
925225175 2:2177792-2177814 GGGTTGGGGAGGAACCTGGTGGG - Intronic
928136733 2:28693512-28693534 GTGCTGGGGGGGAAGTTGGAGGG - Intergenic
929165446 2:38876595-38876617 GTGTCCTGGAGGAACTGGGTGGG + Intronic
932591199 2:73068958-73068980 GTGGTGGGAGGGAACGTGGTGGG + Intronic
936583296 2:113726670-113726692 GTGGAGGGTGGGAACTTGCTGGG - Intronic
936583362 2:113727027-113727049 GTGTCAGGGAGGGACCTGGTGGG + Intronic
939371709 2:141309724-141309746 GTGAGGGGAGGGAACTTGGGAGG + Intronic
942022165 2:171876664-171876686 GTGTGGGGGGGCAACCTAGTGGG - Intronic
946581094 2:221128829-221128851 GTGTCAGGGAGGGACCTGGTGGG + Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948935500 2:241161713-241161735 GTGCTGGAGGGGAACTTGGGAGG + Intronic
1171280164 20:23889623-23889645 GTGTCTGAGGGGAACTAAGTGGG + Intergenic
1172785339 20:37464801-37464823 GTGTCCTGGGTGAACTTTGTGGG - Intergenic
1174117099 20:48233959-48233981 GTGTTGGAGGAGAACCTGGTGGG - Intergenic
1174545256 20:51320309-51320331 GTGTCAGGGAGGGACCTGGTGGG - Intergenic
1175532406 20:59682918-59682940 GGGTCGGGGGGGACATTGGAGGG + Intronic
1175684030 20:61013986-61014008 GTGTTGGGGAGGGGCTTGGTGGG - Intergenic
1178140230 21:29674529-29674551 GTGTCGGGGGGGAACTTGGTGGG + Intronic
1178961821 21:37072968-37072990 GTGTCGGGAGGGGCCTGGGTGGG - Intronic
1179070107 21:38063645-38063667 GTGTCGGGGAGGGACCTGGTGGG - Intronic
1179254460 21:39703212-39703234 GTGTCGGAGGGGAGCCTGGTGGG + Intergenic
1183570572 22:38650315-38650337 GTGTAGCTGGGGAACATGGTTGG - Intronic
1183605890 22:38866552-38866574 GTCTCGGGGAGGAGCTTGGGGGG + Exonic
949528771 3:4932856-4932878 ATTTTGGGGGGGAAATTGGTTGG + Intergenic
949537200 3:5005137-5005159 GTGTGGGGAGAGAACTTGGTTGG - Intergenic
949941367 3:9157367-9157389 GTGTTGGAGGGGGACCTGGTGGG - Intronic
954145148 3:48630814-48630836 GTCTCTGGGGGCCACTTGGTGGG - Intronic
955236299 3:57142681-57142703 GGGGCGGGGGGGAGGTTGGTGGG + Intronic
956161185 3:66354719-66354741 GTGTCGGGGAGGAACCCAGTGGG + Intronic
958049279 3:88323739-88323761 GTGTCGAAGGGGAACCTGGTGGG + Intergenic
961348005 3:126277303-126277325 GTGTTGGAGGGGGACTTGGAAGG - Intergenic
962806256 3:138929690-138929712 GTTTTGGGGTGGGACTTGGTTGG - Intergenic
964383843 3:156126382-156126404 GAGTCTGGGGGGAAATTTGTAGG + Intronic
965519820 3:169661296-169661318 GTGTGGGGGGGGGAGTTGGCGGG - Intronic
966315491 3:178640487-178640509 GTGTTGGGGAGGGACGTGGTGGG - Intronic
967146857 3:186613541-186613563 GTGTCAGGAGGGAGCTGGGTGGG + Intronic
967523866 3:190469749-190469771 GTGTCAGGGAGGGACCTGGTAGG + Intergenic
968067014 3:195764321-195764343 GTGTTGGTGGAGAGCTTGGTAGG + Intronic
968700417 4:2054462-2054484 GTGTCGGGGAGGGGCCTGGTGGG - Intergenic
978502168 4:109421153-109421175 GTGTTGGGGAGGGACCTGGTGGG - Intergenic
982330682 4:154178726-154178748 GTGTTGGAGGGGGGCTTGGTTGG + Intergenic
987046991 5:14117498-14117520 GTGTTGGGGGGGAACCTGGGAGG + Intergenic
988389505 5:30609507-30609529 GTGTTGTGGAGGAACCTGGTGGG - Intergenic
988465362 5:31485771-31485793 GTGTGGAGGGGGAAATTGATCGG - Intronic
990637876 5:57749936-57749958 GTATGGGGAGGGTACTTGGTTGG - Intergenic
993189870 5:84668530-84668552 GTGTGTGGGGGGAATTTGGGGGG + Intergenic
993390849 5:87318664-87318686 GTGTTGGGAGGGGACCTGGTAGG - Intronic
995090629 5:108171809-108171831 GTGTTGTGGGAGGACTTGGTGGG + Intronic
1000005275 5:157177253-157177275 GTGGAGGGGGAGAAATTGGTAGG - Intronic
1001543977 5:172558703-172558725 GTGTGGAAGGGGAACTGGGTGGG - Intergenic
1003772807 6:9325887-9325909 GGGTGGGAGGGGAACATGGTGGG - Intergenic
1005470706 6:26159561-26159583 GAGTCGGGAGGGAACTAGGAGGG + Intronic
1009983129 6:70749293-70749315 GTGTTGGGAAGGGACTTGGTGGG - Intronic
1011590249 6:88964566-88964588 GCGTCGGTGGGGAACTTTCTGGG + Intergenic
1017209218 6:151836492-151836514 GTGTCCTGGGGGAACTCAGTGGG - Intronic
1018093591 6:160366005-160366027 GTGTCATGGGGGAACCTGGTGGG - Intronic
1020979921 7:15054297-15054319 GTGTCTGGGAGAGACTTGGTGGG - Intergenic
1021621475 7:22554365-22554387 GTGTCAGGGAGGGACCTGGTGGG - Intronic
1021894883 7:25223997-25224019 GTGCTGGGAGGGAACATGGTAGG - Intergenic
1024591879 7:50893377-50893399 CTGTCATGGGGGAACCTGGTGGG - Intergenic
1026848636 7:73711513-73711535 GTGTCTGTAGGGAGCTTGGTGGG - Intronic
1031875022 7:127129958-127129980 GTGTGAGGGAGGAACCTGGTGGG + Intronic
1034083540 7:148302560-148302582 GTGTCAAGGGGGGACCTGGTGGG + Intronic
1034336395 7:150326354-150326376 GTGTCCTGGGGTAACTGGGTAGG + Intronic
1040540371 8:48348101-48348123 GTGTCAGGGGGGCCCTTGCTGGG - Intergenic
1042372764 8:68010767-68010789 GTGTAGGGGAGGAAGGTGGTGGG + Intronic
1043533514 8:81175712-81175734 GTGTTGGGGTGGGACCTGGTGGG - Intergenic
1044327033 8:90869942-90869964 GTGTTGGGGAGGTACCTGGTGGG + Intronic
1047977282 8:130142876-130142898 GTGGTGGGGGGGCAGTTGGTGGG + Intronic
1049236031 8:141512882-141512904 GTGTCGGGGGGCCACCTGGCCGG + Intergenic
1052635176 9:31093818-31093840 GTGTCAGGGGGAAGCCTGGTAGG + Intergenic
1053108455 9:35435379-35435401 GTGTTGGGGAGGGACCTGGTAGG - Intergenic
1054842580 9:69759695-69759717 GTGTCGGGCGGGACCGTTGTCGG - Intronic
1058498814 9:105590146-105590168 GTGCTGGGGGGGGACCTGGTGGG + Intronic
1060156210 9:121321426-121321448 GTGTCGTGGGGGTACTGGCTGGG + Intronic
1062527396 9:136983491-136983513 GTGTCGGGGCAGAATGTGGTGGG + Exonic
1188103930 X:26125380-26125402 GTGTTGGGGAGGAACCTGGTGGG - Intergenic
1188231605 X:27670668-27670690 GTGTTGGAGGGGGACCTGGTGGG + Intronic
1190190128 X:48270089-48270111 GTGTCGGAGGGGAATCTGGCTGG + Intronic
1191089719 X:56607506-56607528 TTTTGGGGGAGGAACTTGGTGGG - Intergenic
1198967009 X:142237780-142237802 GTGTGTGGGAGGGACTTGGTGGG + Intergenic
1199317677 X:146400018-146400040 ATGGCGGTGAGGAACTTGGTGGG + Intergenic
1201290947 Y:12420812-12420834 GGGTCGGGGGGCAGCTGGGTTGG - Intergenic