ID: 1178142417

View in Genome Browser
Species Human (GRCh38)
Location 21:29699381-29699403
Sequence CTGGACACACAGATATACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178142410_1178142417 17 Left 1178142410 21:29699341-29699363 CCTTAAACCACTCTGACTGGGCC 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG 0: 1
1: 0
2: 4
3: 35
4: 207
1178142411_1178142417 10 Left 1178142411 21:29699348-29699370 CCACTCTGACTGGGCCTTATAAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG 0: 1
1: 0
2: 4
3: 35
4: 207
1178142414_1178142417 -4 Left 1178142414 21:29699362-29699384 CCTTATAAGAAGGGAAAATCTGG 0: 2
1: 8
2: 98
3: 383
4: 1062
Right 1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG 0: 1
1: 0
2: 4
3: 35
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178142417 Original CRISPR CTGGACACACAGATATACCA GGG Intronic
900813626 1:4826687-4826709 ATGGAGACACAGACATTCCATGG - Intergenic
901448904 1:9324458-9324480 CTGGGCACAGAGAGACACCATGG - Intronic
901744336 1:11362654-11362676 CTGGACACACATCTCTGCCACGG + Intergenic
902610340 1:17593445-17593467 CTGGGCCCACAGATAACCCAGGG - Intronic
904834161 1:33324238-33324260 CTGGACTGACAGATAGGCCAAGG - Exonic
904941778 1:34168723-34168745 TTGGACACAGATATGTACCATGG - Intronic
906100555 1:43257702-43257724 CTGGGCACACAGATGTTCCCAGG - Intronic
906143854 1:43548762-43548784 CTGGAGAGACAGATATCCCTGGG - Intronic
908501716 1:64749718-64749740 CCAGACACACACATATACAATGG - Intronic
909345293 1:74578149-74578171 TTTGACAGACAGATAAACCAAGG - Intronic
912244070 1:107942540-107942562 CAGGATACACAGATATAAAAAGG - Intronic
915724721 1:158009091-158009113 TTGGACACACAGTTGGACCAGGG + Intronic
916686198 1:167149421-167149443 ATGTAAACACAGCTATACCAAGG + Intergenic
917586562 1:176433032-176433054 CTACACACTCAGATATGCCAGGG - Intergenic
917838011 1:178956101-178956123 TGGGACACACAGAGAGACCAGGG + Intergenic
918403166 1:184184795-184184817 CTGGAGGCACATATACACCATGG - Intergenic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
922054256 1:222025203-222025225 CTGGACACACCTATCTATCATGG - Intergenic
1062834953 10:629384-629406 CTGGACACACAGACACTCCCAGG + Intronic
1064006101 10:11700321-11700343 TTGGACACACAGAGACACCAGGG + Intergenic
1064145346 10:12822448-12822470 GTGAACCCACAGATATAGCATGG + Intronic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1068702786 10:60037651-60037673 ATGTACACACACATACACCATGG - Intronic
1069821302 10:71230331-71230353 CTGAACACACAGAGAAGCCAAGG + Intronic
1070475426 10:76824673-76824695 CTGGACATCCAGATGTCCCAAGG + Intergenic
1072473735 10:95738242-95738264 ATGCACACACAGAGATTCCAGGG - Intronic
1075741885 10:124701076-124701098 CTGGGCAGGCAGAGATACCAAGG - Intronic
1076045615 10:127292026-127292048 TTGGACACACAGACTTTCCAAGG - Intronic
1076061370 10:127416650-127416672 CTGCTCCCACAGATATCCCACGG - Intronic
1077467143 11:2738757-2738779 CTGGCCACACAGACAGACCCTGG + Intronic
1078349254 11:10579417-10579439 CTGGACCCCAAGATATCCCAGGG + Intronic
1078539246 11:12200119-12200141 CTGAACACACAGAAATACAGAGG + Intronic
1078636580 11:13056051-13056073 CTGAATAAACTGATATACCAGGG - Intergenic
1081102335 11:39020432-39020454 CTTGAAACTCATATATACCAGGG - Intergenic
1082781060 11:57287700-57287722 TTGGACACACGGACACACCAGGG + Intergenic
1083067011 11:59934765-59934787 GTGAACACACAGGGATACCAGGG + Intergenic
1084537032 11:69763364-69763386 CTGGACACACAGACACACAGAGG + Intergenic
1086676088 11:89608664-89608686 CTGGACACACAGACATCCCAGGG - Intergenic
1086799689 11:91156699-91156721 TTGGACACAGACATATACCTAGG + Intergenic
1087860259 11:103144787-103144809 CTGGAAACACAGATATACGGTGG + Intronic
1088979139 11:114845975-114845997 ATGGACCCCCAGACATACCACGG + Intergenic
1089208688 11:116786248-116786270 CAGGAAACACAGATAACCCAAGG + Intronic
1089496678 11:118911546-118911568 CTGGAGTCACTGAGATACCAGGG + Intronic
1089586544 11:119513183-119513205 CTGGAGGCACAGAGACACCAGGG - Intergenic
1091827720 12:3525521-3525543 CAGGACCCACAGATATTCCTTGG + Intronic
1091868432 12:3863909-3863931 CTGGACAAACTGGTATAGCACGG + Intronic
1097218802 12:57434776-57434798 CTGGACACACACTTCTTCCAGGG + Exonic
1099783514 12:87231324-87231346 CTGGACAGACTAATACACCATGG - Intergenic
1101002663 12:100372317-100372339 TTGGACACACAGAGACACCAGGG - Intronic
1101579267 12:106027221-106027243 CTTGACACACAGATGAGCCAAGG - Intergenic
1103034081 12:117642213-117642235 CTGGGAACACAGATATAAAAGGG - Intronic
1103332134 12:120161704-120161726 CTGGACACACTTAAATACCCAGG + Intronic
1103849493 12:123922760-123922782 TTGGACACACAGAGACACCAGGG - Intronic
1104052743 12:125207093-125207115 CTGGCCAAACAGATATGCCCTGG - Intronic
1108574253 13:51777998-51778020 CTGGTCACACAGAGACTCCATGG - Intronic
1112334774 13:98505168-98505190 CCGGAAACACAGATCCACCAAGG + Intronic
1112694943 13:101937414-101937436 CTGGACACACAGAGATCCCAGGG + Intronic
1113060061 13:106313440-106313462 CTGCATACACATATATACCTAGG - Intergenic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1114396583 14:22368632-22368654 ATGTATACACATATATACCATGG + Intergenic
1116345017 14:43782575-43782597 CTCGACACAAATATATACAAAGG - Intergenic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1119105055 14:71915883-71915905 GTGGACACAGAGAAACACCAGGG + Intergenic
1119222019 14:72916444-72916466 GTGGGCACAGAGAAATACCAGGG + Intergenic
1119999425 14:79285635-79285657 TTGGACACACAAAGACACCAGGG - Intronic
1121467540 14:94125803-94125825 CTGGAGACCCAGATATGGCAGGG - Intergenic
1122656389 14:103263305-103263327 ATGAACACACAGAAATACAAAGG - Intergenic
1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG + Intergenic
1123175285 14:106410795-106410817 CTGCAAACACAGAGACACCAAGG + Intergenic
1123186176 14:106518883-106518905 CTGCAAACACAGAGACACCAAGG + Intergenic
1123189716 14:106557249-106557271 CTGCAAACACAGAAACACCAAGG + Intergenic
1123200420 14:106658030-106658052 CTGCAAACACAGAGACACCAAGG + Intergenic
1202943404 14_KI270726v1_random:4984-5006 CTGCAAACACAGAGACACCAAGG - Intergenic
1124927687 15:34087473-34087495 TCAGACACACAGATAGACCAAGG - Intronic
1128902140 15:71433815-71433837 CTGCACACACACATATCCCCAGG + Intronic
1129142806 15:73616440-73616462 ATTAACACTCAGATATACCACGG + Intronic
1129481955 15:75833605-75833627 CTTGACACACAAAGAAACCAAGG + Intergenic
1129520911 15:76185907-76185929 TTGGACACACAGTGAAACCAAGG + Intronic
1131375705 15:91921225-91921247 TTGGATACACAGAGAGACCAGGG - Intronic
1131952421 15:97694942-97694964 CTGCACACACAGAGAGTCCAGGG + Intergenic
1131968944 15:97873472-97873494 TTGGACACACAGAGATACCAGGG - Intergenic
1133849514 16:9488902-9488924 CTGGACATAGAGATACACCAGGG + Intergenic
1133977182 16:10607570-10607592 CTGGACACAGACATGTACAAGGG + Intergenic
1134767912 16:16777869-16777891 CTGGATCTACAGATATACCAAGG - Intergenic
1135694030 16:24571592-24571614 CTGGACAGAAAAATAAACCAAGG + Exonic
1135856687 16:26018152-26018174 CTGGCCACACAGAGATAAAAAGG - Intronic
1136627001 16:31467387-31467409 CTGGACACACAGATCTTGCTTGG + Intergenic
1137874937 16:51987130-51987152 CTGGACACACAGCCACACCCAGG + Intergenic
1138469335 16:57220289-57220311 GAGGACACAAAGATATACCATGG - Intronic
1138585302 16:57965896-57965918 GTGCACACACAGACATACCAAGG + Intronic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1142024294 16:87804334-87804356 CTGGACAGGCAGGGATACCAGGG - Intergenic
1142863966 17:2779332-2779354 CTGGCCACACAGAAATACCCCGG - Intronic
1144838760 17:18172735-18172757 TTGGATACACAGAGATACCAGGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1151600653 17:75104203-75104225 CTGGTCACACAGATGAACCCTGG - Intronic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1156007048 18:32454231-32454253 CTGGACCCAAAGATACTCCATGG + Intronic
1156930008 18:42630064-42630086 CTGATGATACAGATATACCAAGG - Intergenic
1157578069 18:48757118-48757140 TTTGACACACAGAGACACCAGGG - Intronic
1158069890 18:53458659-53458681 CTGGACACTCAGTGATGCCAAGG + Intronic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1159957983 18:74533301-74533323 CTGGACACACACACATACACAGG + Intergenic
1160017049 18:75152684-75152706 CTGGAGACAAAGAAATACCACGG + Intergenic
1160327865 18:77967347-77967369 CTGGGCACACAGAGTCACCAAGG + Intergenic
1160606520 18:80054837-80054859 ATACACACACACATATACCATGG + Intronic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
925225539 2:2181231-2181253 GTGCACACACAGATATACACAGG - Intronic
925441448 2:3890066-3890088 ATATACACACACATATACCATGG - Intergenic
925679008 2:6397168-6397190 TTGGATACACAGAGATACCAGGG - Intergenic
926816290 2:16801003-16801025 CTGGAGACACAGAAACACAAAGG + Intergenic
928091615 2:28378067-28378089 CTGCACACACAGGTGTGCCAGGG + Intergenic
928111809 2:28516706-28516728 CTGGGCACACAGATATGGCTAGG + Intronic
931106351 2:59060878-59060900 CTGGAAACTCAGGTAAACCAGGG - Intergenic
934648612 2:96073675-96073697 CTGGACACTCAGATAGCCCAGGG - Intergenic
936415413 2:112304531-112304553 TTGGACACAGAGAAACACCAGGG - Intronic
936827207 2:116596971-116596993 CTGTACACATAGATATTCAAAGG + Intergenic
937154978 2:119712494-119712516 TTGGATACACAGAGACACCAGGG + Intergenic
938962215 2:136354068-136354090 TTGGACACACAGAGATATCAGGG + Intergenic
939351854 2:141048480-141048502 CTGGAGATACTGATATTCCAAGG + Intronic
940089381 2:149898728-149898750 TGGGACACACAGAAATACCAGGG + Intergenic
941354196 2:164468549-164468571 CTGCACACACAGACATACACAGG + Intergenic
942298061 2:174536441-174536463 CTGGACACAGATATAAACCTTGG + Intergenic
943371131 2:187017352-187017374 TTACACACACATATATACCAGGG - Intergenic
944072724 2:195691210-195691232 ATAGATACACATATATACCATGG - Intronic
944161128 2:196661430-196661452 TTGGACACACAGAGACACCAGGG - Intronic
945647582 2:212518819-212518841 CTGGACAAACAGTGATTCCAGGG + Intronic
947070426 2:226282097-226282119 GTGCACACAGAGAGATACCAGGG + Intergenic
1170204285 20:13781661-13781683 CTGGACACACAGAGCTCCCAGGG - Intronic
1170489011 20:16852120-16852142 ATATACACACACATATACCATGG - Intergenic
1172883230 20:38215095-38215117 CTGGACACACAGACAGATGATGG - Intronic
1173720058 20:45250022-45250044 CTGGTGACACAGAAATACAAAGG + Intergenic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178276213 21:31239966-31239988 TTGGACAAACATATATACCTAGG - Intronic
1178281729 21:31289191-31289213 CTGGTCACTCACATAAACCAGGG - Intronic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1181133771 22:20750239-20750261 CTGGACACACAGAAATACTGGGG + Intronic
1181465155 22:23106933-23106955 CTGCACACACAGGGAAACCAGGG + Intronic
1181479610 22:23190139-23190161 TTGGACACAGAGAGATGCCAGGG - Intronic
1182549217 22:31091945-31091967 CTGCACACACAGAGAAACCGAGG + Intronic
1185224080 22:49643239-49643261 CTGGACACACAGTTTGACCCAGG + Intronic
1185251997 22:49807410-49807432 AAGGACACACATATAGACCATGG + Intronic
950625582 3:14244334-14244356 TTGGACACACAGAGACCCCAGGG - Intergenic
952425766 3:33173328-33173350 CTGAACACACACATACTCCATGG + Intronic
952545199 3:34411750-34411772 CTGGACACTGAGATATACTGAGG - Intergenic
953078277 3:39591727-39591749 CTGGACAGCCAGATATAACCTGG - Intergenic
956568389 3:70665608-70665630 CACGACACACAGATATACGCAGG + Intergenic
958551996 3:95626916-95626938 TTGGTCAAATAGATATACCACGG - Intergenic
959381657 3:105648351-105648373 CTGGACACACAGAGAAACACAGG + Intergenic
961658685 3:128457063-128457085 ATGGAGACACAGAGATGCCAAGG - Intergenic
962847996 3:139287839-139287861 CTGGACAGACAGGTAAACGATGG + Intronic
963655017 3:148036656-148036678 CTGGACCCAGAGAGAGACCACGG + Intergenic
965014175 3:163135073-163135095 CTGAACACACACATAAATCATGG + Intergenic
965256126 3:166414452-166414474 CTGGACACATAGTTATGACAAGG - Intergenic
966758506 3:183393563-183393585 CTGGGCAAACAAATATACTAGGG + Intronic
967755118 3:193160010-193160032 TTGGACACTCAGAGATATCAGGG + Intergenic
970000450 4:11360183-11360205 ATGCACACACAGACAAACCATGG + Intergenic
973128746 4:46622321-46622343 CTGAACACACAAAAATACAAAGG - Intergenic
976049757 4:80997916-80997938 CTGGACACATTGATATAACCTGG + Intergenic
976201977 4:82587957-82587979 TAGGACACACAGAGACACCAGGG - Intergenic
977303887 4:95299212-95299234 TTGGACACACAGAGACACCAGGG + Intronic
979568948 4:122193068-122193090 CTGGACACAGAGGTACACAAGGG - Intronic
981276612 4:142906041-142906063 TTGGTAACACAGATATACCAAGG - Intergenic
981927774 4:150158217-150158239 GTGGACACACACAGATGCCAGGG - Intronic
981956827 4:150485559-150485581 CTGGACACAGAGACATACACAGG + Intronic
982616219 4:157638773-157638795 TGGGACACCCAGATATACAAAGG + Intergenic
986424476 5:7616903-7616925 TAGGACACACAGAGACACCAGGG + Intronic
986444404 5:7808625-7808647 CTGGACAGACAGATACACCCAGG - Intronic
987968514 5:24909531-24909553 CTGGTCAAACACATATAGCATGG - Intergenic
989147611 5:38264287-38264309 ATGGACACCCAGATACTCCAGGG - Intronic
989164251 5:38419115-38419137 TTGGACATACAGACATACCAGGG - Intronic
989233261 5:39112790-39112812 TTGAACACACAGATATAGGAGGG - Intronic
991002745 5:61798769-61798791 CTGGACACACCGTTATGCCATGG - Intergenic
993080853 5:83298560-83298582 GTGAATAAACAGATATACCAGGG - Intronic
993300192 5:86199152-86199174 TTGGACGCACAGAGATGCCAAGG - Intergenic
994251313 5:97540814-97540836 CTGAACATACACATATATCATGG - Intergenic
996980270 5:129483544-129483566 CTTCACACACACACATACCAGGG - Intronic
998330693 5:141323791-141323813 CTGGTATCACAGATATTCCATGG - Intergenic
998556402 5:143128755-143128777 CTCGAGACACAAATGTACCAGGG - Intronic
1000884254 5:166733360-166733382 ATGCACACAAAGATATCCCATGG + Intergenic
1001166156 5:169370210-169370232 CTACACACACAAAAATACCAAGG + Intergenic
1001818832 5:174693848-174693870 CTGGACAAACAGGTAACCCATGG - Intergenic
1003257771 6:4489255-4489277 CCGGACACACAGAGACACCGGGG - Intergenic
1003716231 6:8649417-8649439 TGGGACACAGAGAGATACCAGGG - Intergenic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1005120152 6:22380368-22380390 CTGGTCACACAGCTAAACAAGGG - Intergenic
1012038488 6:94173341-94173363 CTGGACACACAGCCATAAAAAGG + Intergenic
1012132567 6:95515775-95515797 TTGGACACACAAATATAGAAAGG + Intergenic
1012445203 6:99300264-99300286 CTGGACACTCAGAGAATCCATGG + Intronic
1012629703 6:101449670-101449692 CTGGAGACACAGAGACACAAAGG - Intronic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1015789447 6:136951701-136951723 CCGGAGTCACAGAGATACCAAGG - Intergenic
1016099722 6:140084139-140084161 CTGAACACACATAGATACTAAGG + Intergenic
1016516385 6:144897138-144897160 TTGGACACACAGAGACACTAGGG - Intergenic
1016792685 6:148082160-148082182 CTGGACTCACAGAAAAAGCACGG - Intergenic
1017017087 6:150110187-150110209 TTGGACACACAGAGATGCCAGGG + Intergenic
1017054157 6:150423144-150423166 CAGGAAGCACAGATATCCCAAGG - Intergenic
1019008672 6:168824741-168824763 TTGGACACACAGAGATACTGGGG + Intergenic
1021129477 7:16894020-16894042 GTGGTCTCTCAGATATACCAAGG - Intergenic
1022614998 7:31920259-31920281 CTGGACACACAGATATCTCCAGG + Intronic
1022641579 7:32190381-32190403 CTGGACAGGCAGGTAGACCAAGG - Intronic
1023269809 7:38450334-38450356 CTGGACACAAAGATAGACTCTGG + Intronic
1030045740 7:105493694-105493716 GGGGACACACACAGATACCAGGG + Intronic
1030364169 7:108627147-108627169 CTACAGACACAGATATCCCATGG + Intergenic
1030541011 7:110830808-110830830 CTGGACACTCAGATACTCCAAGG + Intronic
1030700978 7:112640353-112640375 CTAGTCAGAGAGATATACCATGG - Intergenic
1031105555 7:117537898-117537920 CTGCAAACACATATATAGCAAGG + Intronic
1031920079 7:127593868-127593890 GTGGATACACAGACATCCCAAGG + Exonic
1032067404 7:128782106-128782128 CTGGGCACACAGAAATGCCTGGG + Intergenic
1032987903 7:137359277-137359299 CTGGATACATAGATATAACCAGG - Intergenic
1034066716 7:148144024-148144046 CTGGAAACACAGAGATTCCAGGG + Intronic
1034784551 7:153913739-153913761 CTAGTCACACAGTTATGCCAAGG - Intronic
1037776997 8:21842105-21842127 CTGGACATACAGAGATAAGAAGG - Intergenic
1039089551 8:33813655-33813677 CTGCACCCATAGATTTACCATGG + Intergenic
1039846976 8:41332418-41332440 GTGGAGACACAGAGATCCCAAGG - Intergenic
1040015505 8:42696080-42696102 CTGGACACAGAGAGATACAGAGG + Intergenic
1040283363 8:46083660-46083682 CTGAAAACACAAATATCCCATGG + Intergenic
1040698568 8:50033676-50033698 TAGGACACACAGAGATACCAGGG - Intronic
1043561659 8:81500582-81500604 CTGGAAACACAGGCATAACATGG - Intergenic
1046270630 8:111892236-111892258 GTGTACACACAAATATACTATGG + Intergenic
1047372965 8:124271381-124271403 TTGGACACAGAGAGATACCAGGG + Intergenic
1047449094 8:124946991-124947013 ATCCACACACAGATATAGCATGG + Intergenic
1048250490 8:132862941-132862963 CTGGATACTCAGAAATGCCAGGG - Intergenic
1048754535 8:137722465-137722487 ATGCACACACACATATATCAGGG - Intergenic
1050688545 9:8199360-8199382 CTGGATAGACATATACACCATGG - Intergenic
1051340347 9:16104541-16104563 CTGGACCCACAGAGATTTCAGGG + Intergenic
1052666426 9:31500487-31500509 CTGTACACACACATACACAATGG + Intergenic
1053362237 9:37496847-37496869 CTGGACTCACAGAGATAAAAAGG - Intronic
1061749223 9:132764490-132764512 CTGGTACCACAGATATACAAAGG + Intronic
1061769279 9:132905611-132905633 CTGGACAGACTGATACAGCAGGG - Exonic
1062104881 9:134749913-134749935 CTGGCCACACAGACATACCTAGG - Intronic
1185461801 X:336301-336323 ATGGACACACAGAGGAACCACGG + Intronic
1186217742 X:7317931-7317953 TGGGACACAAAGATATACAATGG - Intronic
1189377518 X:40477084-40477106 CTGTAAACACAGATACACTAGGG - Intergenic
1192165545 X:68825431-68825453 TAGGCCACACTGATATACCAAGG - Intergenic
1193326311 X:80181898-80181920 CTAGTTACACAGATATAACAAGG + Intergenic
1193960447 X:87918511-87918533 CTGGACACAGGGATAGACAATGG + Intergenic
1195042124 X:101024170-101024192 GTGGACACACAGAGACACCAAGG + Intronic
1195790181 X:108575917-108575939 CTGGTCCCACTGGTATACCAGGG + Exonic
1197130487 X:123000131-123000153 CTGCACACACACATACACCATGG + Intergenic
1197954777 X:131934229-131934251 CTGGAAACCTAGAAATACCATGG - Intergenic
1199377167 X:147126871-147126893 ATGTGCACACATATATACCATGG - Intergenic
1200298665 X:154949741-154949763 GTGTACACACAGAGACACCAGGG - Intronic
1201762094 Y:17551659-17551681 CAGAACACACATATGTACCATGG + Intergenic
1201839458 Y:18354329-18354351 CAGAACACACATATGTACCATGG - Intergenic