ID: 1178143882

View in Genome Browser
Species Human (GRCh38)
Location 21:29716492-29716514
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 2, 1: 12, 2: 57, 3: 109, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178143879_1178143882 4 Left 1178143879 21:29716465-29716487 CCTAGAGACTTGTTGCATGGCTT 0: 7
1: 1451
2: 1904
3: 1424
4: 939
Right 1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG 0: 2
1: 12
2: 57
3: 109
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902083342 1:13836868-13836890 CAATATCCTGGTTGTAATGTTGG - Intergenic
905065297 1:35175858-35175880 CAGAATACTGATGGGAATGTTGG - Intergenic
907229934 1:52987356-52987378 CCAAATAATGATAGTAATGATGG - Intronic
907467240 1:54646719-54646741 AAATATTCTGATAGTAATGATGG - Intronic
907546539 1:55264674-55264696 AAAAACTCTGATAGTTATGTAGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909957563 1:81799571-81799593 CAAAATACTGATAGGTATTTAGG + Intronic
911989187 1:104670623-104670645 CAAAAGGCTGGTAGGAATGGTGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
913201369 1:116497443-116497465 CAAAATGCTGTTAGGTAAGTGGG - Intergenic
913417488 1:118627278-118627300 TCAAATGTTGATAGGAATGTGGG + Intergenic
915091302 1:153428274-153428296 CACAAGGCTGATAGGAAGGTGGG + Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
916532219 1:165667916-165667938 AAAAATGTTGATAGTTTTGTAGG - Intronic
916685932 1:167146386-167146408 CAAAAAGAAGATAGCAATGTTGG - Intergenic
917890428 1:179432373-179432395 CAAAGTGCTGATTGTAAACTTGG + Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920274143 1:204791538-204791560 CAAAATGGGGATAATATTGTGGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922476843 1:225912236-225912258 CAAAGAGCAGATAGTAATGATGG + Intronic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924387432 1:243511946-243511968 CAAAATTCTGAAGGTTATGTGGG + Intronic
1063296221 10:4809549-4809571 CAAAAGGCTCATAGAACTGTTGG + Intronic
1064993981 10:21280463-21280485 CAAAAGGCAGATAGGAAGGTGGG + Intergenic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065401167 10:25303089-25303111 GTAAATGCTGATAGTAATTTAGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1070818304 10:79339239-79339261 CAAAGTGCTGAGATTAATTTGGG + Intergenic
1072077139 10:91988203-91988225 AAAAATGCAGAGACTAATGTGGG - Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073152200 10:101319735-101319757 CAAAATGCTGATAAGCCTGTGGG + Intergenic
1074409003 10:113208050-113208072 AAATATGCTGATAGTATTATGGG - Intergenic
1076786611 10:132752779-132752801 CAAAATGCTGAGAGAAAAGGAGG - Intronic
1077379148 11:2220400-2220422 TAAAATGCTGATAGACATGCAGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079740810 11:24057904-24057926 CAAAATTCAGGTAGCAATGTGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079872817 11:25821779-25821801 CAAAATGCCAATAGTGATGCAGG + Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081368845 11:42273233-42273255 GAAAATATTGATAGTAATTTTGG + Intergenic
1082288069 11:50337823-50337845 CAATAAAATGATAGTAATGTTGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1086330049 11:85744884-85744906 CAAAAGGTTTATAGCAATGTAGG + Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087533122 11:99408593-99408615 CAAAGTGCTGAGATTAATGCAGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088069123 11:105759411-105759433 TAAAATGCTGACATTTATGTGGG + Intronic
1088432295 11:109772057-109772079 CACATTTCTGATAGGAATGTAGG + Intergenic
1088800717 11:113304836-113304858 CAAAATGTTAATAGTACTGTTGG + Intergenic
1090153874 11:124415221-124415243 CAAAATGCTTATATTCCTGTGGG + Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090555020 11:127864748-127864770 GAAAATGGTGCCAGTAATGTAGG - Intergenic
1090557418 11:127891419-127891441 CAATCTTCTGATATTAATGTGGG + Intergenic
1090685477 11:129113107-129113129 CAAAATGCTACTAGTGATGCTGG - Intronic
1091637780 12:2210964-2210986 CAAGATGGTTATAGTAATGGAGG + Intronic
1091852236 12:3708810-3708832 CAAAATGTTGTCATTAATGTTGG - Intronic
1091956905 12:4652537-4652559 CCAAATGCTGAAAGTGAAGTAGG - Intronic
1091971402 12:4789960-4789982 CAAAATGCTGGGATTACTGTAGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095379923 12:41578396-41578418 CAAAGTGCTGATATTACTTTGGG + Intergenic
1095427370 12:42091737-42091759 CAAAATGCTAACAGCATTGTAGG - Intronic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1099124305 12:78733154-78733176 CAAAAAGCTGTTTGTAATATTGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099599563 12:84716230-84716252 CAAAATGCTGGCAAGAATGTGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099982233 12:89618251-89618273 CAAAATGCAAATATTACTGTGGG + Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101479162 12:105080585-105080607 CAAAATGGTCATAATAATCTAGG + Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102411465 12:112723563-112723585 CAAAATGCCATTAGTGATGTTGG - Intronic
1102417593 12:112777917-112777939 CAAAATGCTTTTTGTCATGTAGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105645908 13:22317133-22317155 CAAAATACTTACAGTACTGTTGG + Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1106193012 13:27470671-27470693 CAAGATGTTGATAGTAAGGAAGG + Intergenic
1107410694 13:40155936-40155958 TAAAATACTGAAAGTAATTTGGG - Intergenic
1107913823 13:45129186-45129208 CAAAATGCAAATAGTAGAGTAGG - Intronic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109594887 13:64538373-64538395 CAAAATGCTGATATTAAAGGTGG - Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110378312 13:74820105-74820127 CCAAATGGTGATGGTAGTGTTGG - Intergenic
1111172490 13:84545896-84545918 CCAAATGCTGATTGTCCTGTAGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1112542123 13:100324942-100324964 CAAAGTGCTACTAGTAATGCTGG + Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113220250 13:108092588-108092610 CAAGTTGATGAGAGTAATGTAGG + Intergenic
1114058320 14:18995623-18995645 TAAAATGCTGACATTCATGTAGG - Intronic
1114104226 14:19406131-19406153 TAAAATGCTGACATTCATGTAGG + Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114797321 14:25731153-25731175 CAAATTGCTGATGATAATGTTGG - Intergenic
1114887765 14:26875693-26875715 TAAAATGTTGTTAGTAATGGTGG + Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115932719 14:38515256-38515278 CAAAAAGCTTATGGTAATGTAGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116627067 14:47278794-47278816 CAAAAAGCTAATAATAATGTAGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1118060557 14:62133606-62133628 CAAAATTCTGAATTTAATGTAGG - Intergenic
1118545939 14:66888642-66888664 ACAAATGAAGATAGTAATGTAGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120120060 14:80668060-80668082 TAAAATGCTTAGAATAATGTTGG - Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121747048 14:96304975-96304997 CAAAATAATTATAGTAAAGTTGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127876011 15:63112018-63112040 CAAAATGGAGATAGTGATGCAGG - Intergenic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1128283420 15:66416218-66416240 CAAAATGCTAAAAGCAAGGTAGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1134356838 16:13490229-13490251 CAATATGCTGACTGGAATGTTGG + Intergenic
1135346025 16:21689219-21689241 CAATATGATGATAACAATGTGGG + Intronic
1135894927 16:26390976-26390998 AAGAATTCTGATAGAAATGTTGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137264171 16:46855126-46855148 CAAAGTGCTGAAAGAAATGCAGG + Intergenic
1137752859 16:50879782-50879804 GAAGATGCTGATATTCATGTTGG + Intergenic
1138267102 16:55667536-55667558 CACATTGCTGACAGTAATGGTGG - Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140676756 16:77339730-77339752 GAAAATGTTAATAGAAATGTTGG - Intronic
1140690249 16:77476768-77476790 TAAAATGCTAATAGAAATGGTGG - Intergenic
1141823621 16:86464171-86464193 GAAAATGGTGATAGTGATGGTGG + Intergenic
1203141445 16_KI270728v1_random:1769858-1769880 CAAAGTGCTGAAAGTACTGAAGG - Intergenic
1203145973 16_KI270728v1_random:1799706-1799728 CAAAATACTTATTGTATTGTTGG + Intergenic
1143334308 17:6160789-6160811 TAAAATACAAATAGTAATGTTGG + Intergenic
1146158264 17:30542452-30542474 GAAAATGTTCATAGTAATGATGG - Intergenic
1146259796 17:31413801-31413823 AAAACTGCTGATAGCACTGTAGG - Intronic
1147295562 17:39479451-39479473 CAGAATGCAATTAGTAATGTTGG + Intronic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149665463 17:58362146-58362168 GATAATGCTGATAGCAAAGTGGG - Intronic
1150845482 17:68653430-68653452 CAAAATGAGGATAATAACGTCGG + Intergenic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1153360956 18:4196389-4196411 AAAAATGCTGATTGCCATGTGGG + Intronic
1155905934 18:31451267-31451289 CCAAATGCTCATAGCAGTGTTGG - Intronic
1155931040 18:31708803-31708825 CAAAATGGTGATGGCAATGGGGG + Intergenic
1155981471 18:32184622-32184644 CAAAATGCTGTTGCTAAAGTGGG - Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156578395 18:38346746-38346768 AAAAATGCTGCAAGTAATCTGGG - Intergenic
1156780083 18:40840256-40840278 GAAAATGCAGATAGTAAAATGGG - Intergenic
1157928560 18:51793414-51793436 CAAAAGGCTGATTTTAGTGTTGG - Intergenic
1157977784 18:52345046-52345068 CAAGTTTCTGATAGTAGTGTGGG - Intronic
1159767531 18:72508539-72508561 TAAAATACTGATAGAAATGAAGG + Intergenic
1160304846 18:77722750-77722772 AAAAATGCTGAAAGTATTCTAGG - Intergenic
1164708540 19:30338328-30338350 GACAATGTTGATAGTAATGATGG + Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166629113 19:44389468-44389490 CATAATGCTGATTTTACTGTGGG - Intronic
1166638140 19:44470212-44470234 CACAATGCTGATTTTACTGTGGG + Intergenic
1167735412 19:51291619-51291641 CAAAATGATGACAGAAATCTGGG + Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
924984719 2:260084-260106 CAAAATGCAGACAGTAGTATTGG - Intronic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
932128849 2:69169317-69169339 CAAAATTCTGATAATAAGTTTGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
934899554 2:98147528-98147550 CAAAAATTTTATAGTAATGTGGG - Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935423020 2:102889939-102889961 TAGAAAGCTGATAGTAGTGTAGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
938476738 2:131622565-131622587 TAAAATGCTGACATTCATGTAGG - Intergenic
938544514 2:132315736-132315758 CACAATGCTGATTTTATTGTGGG + Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940838530 2:158552529-158552551 CAAAACGTTGGTAGAAATGTGGG + Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942905764 2:181179053-181179075 TAAAATTCTGATAGCAATGCTGG - Intergenic
943175740 2:184471805-184471827 CAAAATGCTTAAACTAATGAGGG + Intergenic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943296644 2:186148667-186148689 CAAAACACTGATAGTAATCCAGG - Intergenic
944102885 2:196047433-196047455 CAAGTTGATGATAGTTATGTTGG - Exonic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945711098 2:213295816-213295838 CAAAAGACAGATAGCAATGTAGG + Intronic
946974515 2:225133357-225133379 CAAGATGCTTGTAGCAATGTGGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171873378 20:30548472-30548494 CACAATGCTGATTTTATTGTGGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173566749 20:44044826-44044848 AATAATGCTGCTAGGAATGTGGG - Intronic
1175887468 20:62300607-62300629 CAGCATGCTCATAGGAATGTGGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177478071 21:21650425-21650447 CAATATGCTAATAGAAATATGGG + Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177858234 21:26423340-26423362 CCAAAGGCTGAGAGAAATGTAGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180476808 22:15718242-15718264 TAAAATGCTGACATTCATGTAGG - Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181879769 22:25968894-25968916 CAAATGGCTGATAGTCATGGTGG + Intronic
1182458284 22:30466709-30466731 CAAAATGGGGATAGCAATGTAGG - Intronic
1183324767 22:37185222-37185244 CAGGATGGTGATATTAATGTAGG + Exonic
1184317211 22:43704156-43704178 AAATCTGCTGATAGTCATGTTGG - Intronic
949185780 3:1189918-1189940 CAAAATGATGATATGAATTTAGG + Intronic
949409708 3:3750063-3750085 CAAAATGCTGACCATAATGGAGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951314471 3:21171770-21171792 AAAAATGCTGCTATTAGTGTGGG + Intergenic
954212808 3:49107867-49107889 CAAAAAGCTGATAGCACTGGGGG + Intergenic
956065371 3:65392010-65392032 TAAACTGCCGATAGTACTGTTGG + Intronic
956321629 3:68004003-68004025 CAAAATACTGATAGTATTAGTGG - Intergenic
957014844 3:75051105-75051127 CAGAATGTTGATAGTAAAGGAGG + Intergenic
957903964 3:86534174-86534196 CAAAATACTGGTAGAAATATGGG - Intergenic
958138129 3:89523341-89523363 CAGAATGCTGCAAGTAATTTGGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958493466 3:94809926-94809948 CAAAATCCTGATTCTTATGTAGG + Intergenic
958583342 3:96053796-96053818 AAAAATGTGGATAGTGATGTGGG - Intergenic
959225365 3:103575304-103575326 AAAAATGGTGATAGTCATTTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959525982 3:107377750-107377772 CAAGATGATGATAGTTATGACGG + Exonic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
961306361 3:125960854-125960876 CAGAGTCCTGAGAGTAATGTGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963966079 3:151372085-151372107 CAAGAAGTTGATAGTAAGGTGGG + Intronic
964025196 3:152064768-152064790 AAAAATGGTGATAATAGTGTTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964696895 3:159518690-159518712 CTAAAAGCAGATAGAAATGTAGG + Intronic
964730666 3:159861184-159861206 CACAATGCTGCTAGTAAGGTGGG + Intronic
964828999 3:160862188-160862210 CAAAATACTAAAAGTAATTTTGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971722330 4:30261677-30261699 TAAAATGCTGATAGAAATTCTGG - Intergenic
971739473 4:30501936-30501958 GGAAAGGCTGATAGTACTGTGGG - Intergenic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
972001763 4:34045493-34045515 CCAAATGCACATAATAATGTTGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974226917 4:59058409-59058431 CAAAATGCGGTTAATAATGCTGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975341328 4:73244252-73244274 CAAAATATTAATATTAATGTTGG + Intronic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
975819658 4:78257024-78257046 CAAAATGGTGGTAGTGATGGTGG - Intronic
976231484 4:82848009-82848031 CAAATTGCTGATAGGATTGATGG - Intronic
976465782 4:85367300-85367322 CAAAATGAAGACATTAATGTTGG + Intergenic
976787870 4:88842931-88842953 CAAAATACTGAGAGAAATATCGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979362811 4:119784286-119784308 CCAAATATTGATAGTGATGTGGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
980972941 4:139583874-139583896 CAAAATGCTGTTAGGAAGGCAGG - Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982137134 4:152282431-152282453 CACAATGCTGATCGTTGTGTAGG - Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982262835 4:153510117-153510139 CCAAAGGCTGATACTAATTTGGG - Intronic
983186458 4:164706350-164706372 CAAATTGAGGACAGTAATGTGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983790247 4:171787858-171787880 GATAATGATGATAATAATGTTGG - Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
984565485 4:181325137-181325159 CAAATTACTGACAATAATGTGGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990026298 5:51194592-51194614 GAAATTACTGAAAGTAATGTGGG + Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991074707 5:62522178-62522200 CAAAATGCTGATCTTGAAGTTGG - Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992044611 5:72873379-72873401 CAGACTGCTGATACTACTGTTGG + Intronic
992867923 5:80976407-80976429 CCAAATGCTGTTATTAATTTTGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993103484 5:83570769-83570791 AAAAATAGTGATAGTACTGTTGG + Intronic
993269542 5:85776473-85776495 AAAAATGGTGATAATAATGTTGG + Intergenic
993574217 5:89581251-89581273 CAAAATGCTTACATTAATTTAGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995657140 5:114439468-114439490 CAAAATGCTGGTCATAATGGTGG + Intronic
996502345 5:124230761-124230783 CCAAATGCTGGTAGTGAAGTAGG - Intergenic
999324084 5:150632275-150632297 CAAAATGCAGATTGTAATTCAGG - Intronic
999364920 5:151016582-151016604 CAAAATGGGGATAATAATGTTGG + Intergenic
999762615 5:154714084-154714106 CAAAATGGGGATTGTAATCTGGG + Intronic
999796778 5:154996127-154996149 CAAAGGGCTTATAATAATGTGGG + Intergenic
1000073141 5:157759881-157759903 CAAAATACTGAGAGTAAAGGAGG - Exonic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1000934925 5:167296012-167296034 CATAATGCTGATAGTACCTTTGG - Intronic
1001738388 5:174027135-174027157 TAAAACACTGATACTAATGTGGG + Intergenic
1003219660 6:4147916-4147938 AAAAATGCTGCTATGAATGTAGG + Intergenic
1003509783 6:6769893-6769915 CAAAATGCAGCTAGAATTGTGGG + Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1005199540 6:23327573-23327595 CAAGATGGTGATAGTGATGGTGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007466782 6:42057962-42057984 CTAAATGTTCATAGTAATTTTGG + Intronic
1008170861 6:48203691-48203713 CAAAATGAAGATGGAAATGTTGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1009627055 6:66147295-66147317 CAAAATGGAGATAGTCATGCGGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011489765 6:87878985-87879007 CAAAATTTTGATAGTGATGGTGG - Intergenic
1011958608 6:93056958-93056980 CAGAATACTGATAATAAAGTTGG + Intergenic
1012015580 6:93845592-93845614 CAAAATGCTTATAGTCCAGTAGG + Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013232998 6:108174206-108174228 CAACTTGCTGATAATAAGGTTGG + Intronic
1013269565 6:108533615-108533637 CAAAGTGGTGATGGTAAGGTGGG - Intergenic
1013815651 6:114094459-114094481 CAAATTCCTGTTAGAAATGTAGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016694267 6:146974474-146974496 CAAGATGAAGATAATAATGTAGG + Intergenic
1016841223 6:148527422-148527444 CAAAATGTTGCAAGTATTGTTGG - Intronic
1017454479 6:154588421-154588443 AAAAATGCTCTTAGTAATGCAGG - Intergenic
1017502614 6:155039440-155039462 CAAAATGCTGATGGCCATGGTGG + Intronic
1018040535 6:159917983-159918005 GACAATGCTGATAGTATTTTTGG + Intergenic
1018590103 6:165410179-165410201 TAAAATGCTGGTATTAATGAGGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020635658 7:10693042-10693064 CAAGATAGTGATAGTACTGTTGG - Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022021758 7:26406345-26406367 CAAAATCCTGACAGTAATTTGGG - Intergenic
1022295317 7:29045731-29045753 CAAAATGTTGATGGTAATCATGG - Intronic
1022947858 7:35305209-35305231 CAAACTGCTTATAATAATGTGGG + Intergenic
1023955468 7:44883930-44883952 CAAAATGCTGATTTCAATGGAGG + Exonic
1024223334 7:47304762-47304784 CAGAATGCTGAGAGGCATGTGGG - Intronic
1024226347 7:47329038-47329060 CCAAATGCTGAAAAAAATGTGGG - Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024711139 7:52016037-52016059 TTAATTGCTGAGAGTAATGTGGG + Intergenic
1025529530 7:61861269-61861291 CAAACTGCTGAATGAAATGTAGG + Intergenic
1026490410 7:70858241-70858263 CAATATGCTGAAAGCAATATGGG - Intergenic
1027443283 7:78243304-78243326 CAAAATGTTAATAGCAATGTGGG + Intronic
1027452423 7:78347627-78347649 AAAAATGATGACAGTAATGGTGG - Intronic
1027789376 7:82620015-82620037 CAGAATGCTGATAGAAATACTGG + Intergenic
1028228806 7:88281357-88281379 CAAAATGCAGATGGTAATGAAGG - Intronic
1028300015 7:89187047-89187069 TAAAATGCTGAGAGTAAATTTGG - Intronic
1028696424 7:93718030-93718052 TAAAATGGTGATAGCAATTTTGG + Intronic
1030771653 7:113483194-113483216 CAAAATGGGGATAGGAAGGTAGG - Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031297788 7:120025870-120025892 CAAAAGTATTATAGTAATGTAGG - Intergenic
1032610644 7:133408552-133408574 GAAGATGCTGATGGTAATGATGG + Intronic
1032863903 7:135906774-135906796 AAAAATCCTGATGGTAATATGGG + Intergenic
1032955287 7:136963557-136963579 GAATATGCTGAAATTAATGTTGG + Intronic
1033408685 7:141095977-141095999 ATAAATGCTGATGGTAACGTAGG + Intronic
1033562429 7:142545177-142545199 CAAAATGATGATGGAGATGTAGG - Intergenic
1033880259 7:145872830-145872852 CAAGCTGCTAATAGAAATGTGGG - Intergenic
1033975369 7:147094243-147094265 CAGAATGTTGATAGAAATTTGGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035427655 7:158791368-158791390 AAAAATGCTGCTAAGAATGTGGG + Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038812004 8:30856885-30856907 CAAAATTCTGATAGATTTGTTGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040690094 8:49927104-49927126 CAAAATGTTGACAAGAATGTGGG + Intronic
1040774004 8:51016695-51016717 AAAAATGCTAATAATCATGTGGG + Intergenic
1041149407 8:54915709-54915731 CACAATGCTGACAGTTATTTTGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043766545 8:84141115-84141137 GAAAATTCTGATAAGAATGTTGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044105969 8:88207523-88207545 CAAAGTGCTGCTAGTGATGCTGG + Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045518607 8:102883400-102883422 AATAATGCTGGTAGTAATGTAGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046770862 8:118114722-118114744 CAAAATGATGATACCATTGTAGG - Intergenic
1048231022 8:132642003-132642025 CAAAATGATAATAGCAATGGTGG + Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050802197 9:9629473-9629495 CAGGATGCTGATTGTAATTTGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051809858 9:21036681-21036703 CAATATGTTGATAGTAACCTAGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057438149 9:95061438-95061460 CAAAATGCAGAAAGTAAGTTTGG + Intronic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059109015 9:111537054-111537076 CAAAGTGCTGCTAGTAATGCTGG - Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060047588 9:120352976-120352998 CAAAATGCAAACAGTACTGTCGG - Intergenic
1061829981 9:133285561-133285583 CAAAATGGGGATAGCAATGCTGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185551746 X:987513-987535 CAAAGTGCTGAAAGTACTGAAGG + Intergenic
1185958842 X:4524032-4524054 CAAAATGCTAATTTTATTGTGGG + Intergenic
1187000667 X:15173547-15173569 CAAAATGCAGTGAGTAATGTGGG + Intergenic
1187191470 X:17039223-17039245 CAAAATCCTGATAATAGTGAAGG + Intronic
1187981072 X:24758023-24758045 AAAATTGATGAAAGTAATGTTGG + Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189586706 X:42469097-42469119 AAAAATGCTGATGGGAATGCAGG + Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1193747897 X:85305041-85305063 AGAAGTGCTGTTAGTAATGTTGG + Intronic
1194025010 X:88740274-88740296 CACAATGGTGCTAGAAATGTGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1195805869 X:108764395-108764417 CAGAATGTTGCTAGAAATGTGGG - Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196091653 X:111750591-111750613 AAAAATGCTGACAGAAATGAAGG - Intronic
1197044263 X:121976982-121977004 CAAATTGTTGATAGTATAGTGGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198535902 X:137586005-137586027 CAAAATGGGGACAGTAATGGTGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199388998 X:147257723-147257745 CAAAATGCTGATAAGAAGTTGGG + Intergenic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201747298 Y:17391546-17391568 CAAAATGCTGATTTTATTGTGGG + Intergenic