ID: 1178149041

View in Genome Browser
Species Human (GRCh38)
Location 21:29773163-29773185
Sequence AAAACAAAGCAGTAAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 669}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178149041 Original CRISPR AAAACAAAGCAGTAAGGAAC AGG Intronic
901133152 1:6975358-6975380 CAAACAAAGCAGCAAGCCACAGG - Intronic
901329884 1:8398251-8398273 AAAGAAAAGCAGTAGGGAAGGGG + Intronic
902519173 1:17006154-17006176 AACACAAAACAGTAAGCACCTGG + Intronic
903051549 1:20604827-20604849 ATTCCAAAGCAGGAAGGAACTGG - Intronic
903126455 1:21251527-21251549 AAAACAAAACAGTTAACAACTGG + Intronic
904328212 1:29741176-29741198 AAAAAAAAGCAGCAAAGAACAGG + Intergenic
904506955 1:30964924-30964946 AAAACAATGCAGATAAGAACAGG + Intronic
905077704 1:35288076-35288098 AAAACTAAACAGTAAGGGAAAGG - Intronic
906553008 1:46681964-46681986 AAAAAAAAAAAGTCAGGAACAGG + Intronic
906632980 1:47387940-47387962 AAAAGATAGCAGTGAGGGACAGG + Intergenic
906647591 1:47486866-47486888 AAGAAAAAGCAGGAAGGAATTGG - Intergenic
906721563 1:48009212-48009234 AAAAAATAGCAGTAAGACACAGG - Intergenic
906857886 1:49328073-49328095 AAACCAAAGGTGAAAGGAACTGG + Intronic
907591195 1:55673233-55673255 AAAACAAAGAAGAAAGAACCTGG - Intergenic
907839620 1:58143828-58143850 AAAACATAGTAGAAAGGATCTGG - Intronic
907865608 1:58396736-58396758 GAAACAAAGCAGCAAAGCACAGG + Intronic
908012098 1:59788744-59788766 AAAACAAAGCAGGATGAAAAAGG - Intergenic
908507479 1:64819254-64819276 AAAATAAAGTAATAATGAACAGG + Intronic
908599427 1:65723120-65723142 AAAAGAAGGAAGTAAGGAAGAGG + Intergenic
908634345 1:66145779-66145801 GAAGCAAAGCTGTAATGAACTGG - Intronic
909591262 1:77351807-77351829 AAGACAAAGGAGAAAGGAGCTGG + Intronic
909633279 1:77788782-77788804 TAATCAAAACAGTAAGGTACTGG - Intronic
910395538 1:86789963-86789985 AAAATATAGTAGTAAGGATCTGG + Intergenic
910476566 1:87614054-87614076 AAAAAAAAGCAGTGAGACACAGG + Intergenic
910551901 1:88484973-88484995 AAAACAAAGCAATCAAGGACAGG - Intergenic
911320330 1:96406225-96406247 TAACCAAAGCAGTATGGTACTGG - Intergenic
912058213 1:105631897-105631919 AATACAAAGAAGTAAAGAAAGGG + Intergenic
912131039 1:106600664-106600686 AAAACAAAGAAGAAAGTAATTGG - Intergenic
912135320 1:106654043-106654065 AAAATAAAGCATTAGGGAAATGG + Intergenic
912846201 1:113077104-113077126 GAAATAAAACAGTAAGGAAAAGG - Intronic
912946018 1:114085036-114085058 TAATCAAAACAGTATGGAACTGG + Intergenic
913179736 1:116310066-116310088 AAACCACAGCAGTTTGGAACAGG + Intergenic
913182773 1:116338193-116338215 AAATCTAAGAAGTAAGGAAGAGG + Intergenic
913415419 1:118600679-118600701 AAAATAAGGCAGAAAGGAAATGG + Intergenic
913557603 1:119983807-119983829 AAAACAAAGCCGTAACTATCAGG + Intronic
913573160 1:120141845-120141867 AGAAGAAAGCTGCAAGGAACAGG + Intergenic
914294417 1:146306642-146306664 AGAAGAAAGCTGCAAGGAACAGG + Intergenic
914555461 1:148757425-148757447 AGAAGAAAGCTGCAAGGAACAGG + Intergenic
914877994 1:151526469-151526491 AAAAAAAAGAAGAAAGGGACTGG - Intronic
915272715 1:154766654-154766676 AAAACAAAACAGTAGGAAAGTGG - Intronic
915384953 1:155482142-155482164 AAACCGAAGAAGTTAGGAACTGG - Exonic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915709648 1:157883551-157883573 AAAAAAAAGCAGTAAGGAATGGG + Intronic
915993876 1:160544943-160544965 AAATCAAAGCATCATGGAACAGG - Intronic
916772749 1:167928594-167928616 AAAACAAAGCATTTAGAAATAGG + Intronic
916816189 1:168355065-168355087 AAACCAAAGCAGCATGGTACTGG - Intergenic
916843677 1:168626522-168626544 AAAATAAAGAAGTTAGGAAAAGG - Intergenic
916929669 1:169562550-169562572 AAAAGAAAACAGAAAGGAAGGGG - Intronic
919081751 1:192875656-192875678 TAAACAAAGGATTAAGGAAAAGG + Intergenic
919228985 1:194748045-194748067 AATTCAAATCAGTAAGAAACAGG - Intergenic
919824208 1:201492322-201492344 AAGGCAAAGCAGAAAGGAGCAGG - Intronic
919997086 1:202762170-202762192 AAAGGAAAGCAGTTAGGAATAGG - Intronic
920228234 1:204453327-204453349 CAAGCAAAGCAGGAAGGAAACGG - Intronic
920848086 1:209610253-209610275 AAAACAAAGCTCTAAAGGACAGG - Intronic
921913727 1:220581766-220581788 AAAAGAAAGCAGTTAGGAAGGGG + Intronic
922323533 1:224508564-224508586 GGAATAAAGCAGGAAGGAACTGG - Intronic
922386247 1:225086827-225086849 AAAATTTAGAAGTAAGGAACAGG + Intronic
923422164 1:233826997-233827019 TAACCAAAACAGTAAGGTACTGG + Intergenic
923589031 1:235302187-235302209 AAAACAAAGAAACAAGGAAAAGG + Intronic
924662849 1:246037761-246037783 AAAACAAAGCAATAGCAAACAGG - Intronic
1064385291 10:14885441-14885463 AAAGCACAGCAGGAATGAACAGG - Intronic
1064607530 10:17059433-17059455 AATGCAAAGCAGGAAGGAGCTGG - Intronic
1065179486 10:23110360-23110382 GAAACAAAGCAGTAAGAACCTGG - Intronic
1065703727 10:28450255-28450277 AAAACAAAGAATTTAGGATCTGG + Intergenic
1066120305 10:32279931-32279953 ATAACACAGTGGTAAGGAACTGG - Intronic
1066441985 10:35448287-35448309 AAAACAAAGCAGGAAGTTAAGGG + Intronic
1066674087 10:37870388-37870410 TAAACAAAACAGTATGGAACTGG - Intergenic
1067138960 10:43639821-43639843 AAAAAAAAACAGTAAGGATATGG - Intergenic
1067701729 10:48578102-48578124 AAAAAAAAGCAGTTAGGGCCAGG - Intronic
1067976659 10:51033468-51033490 AAAACAAAGCAGTGTGGGAAAGG - Intronic
1068436092 10:56992991-56993013 AATACAAAGTTGTAAGAAACAGG - Intergenic
1069098975 10:64294443-64294465 AAATCAAAGCAGTAAGAATGTGG + Intergenic
1069242121 10:66155913-66155935 AAAAAAAATCAGTAAGGAAAAGG + Intronic
1069301761 10:66916708-66916730 AAAGAAAATCAGTAAGGAAGAGG + Intronic
1069564408 10:69453614-69453636 AAAACAATTCAGTGAGGTACAGG - Intronic
1070116514 10:73534196-73534218 AAAAAAAAGGAGAAAGAAACTGG - Intronic
1070271846 10:74964148-74964170 AAAACAAAGCAGAAAAGATTGGG + Intronic
1071237283 10:83663870-83663892 AAAACACAGCAGTTAGGGAGAGG - Intergenic
1071261735 10:83925945-83925967 AAAACAAAATAGTAATAAACAGG + Intergenic
1071286235 10:84148666-84148688 AAAACAAAGCAGAAACCCACAGG - Intronic
1071376652 10:85012606-85012628 ATTACTAAGCAGAAAGGAACTGG + Intergenic
1071737430 10:88317824-88317846 AAAAAAAAGCAGCAAGGGTCTGG + Intronic
1072431102 10:95371137-95371159 AAAACCAAGCAAAAATGAACTGG + Intronic
1072557675 10:96535251-96535273 AACATAAAGGAGTAGGGAACTGG - Intronic
1073638077 10:105219856-105219878 AAAACACAACAGCAAGGAAGAGG + Intronic
1073718346 10:106135602-106135624 AAAAGAAAGCACTAGGGAACTGG + Intergenic
1074142067 10:110681870-110681892 AAAAAAAAGCAGAAAAGAAAAGG - Intronic
1074486150 10:113883039-113883061 CAATCAAAACAGTAAGGTACTGG - Intronic
1074573467 10:114646556-114646578 AAAACAAGGCAGAAAGGGATTGG + Intronic
1074750318 10:116579858-116579880 AAAAAAAAGCAGTGAAAAACGGG - Intergenic
1074880155 10:117650393-117650415 AAACAACAGCAGTAAGGACCAGG - Intergenic
1075308893 10:121394664-121394686 AAAACAAAGCAGGAAAAATCAGG - Intergenic
1076062106 10:127420837-127420859 AAAACAAAAAAAAAAGGAACAGG + Intronic
1076205339 10:128594971-128594993 AAAAGAAGGCAGAAAGGAGCAGG - Intergenic
1077563810 11:3283449-3283471 AAAAGAAAGCAGAGAGGAAAGGG - Intergenic
1077569700 11:3329266-3329288 AAAAGAAAGCAGAGAGGAAAGGG - Intergenic
1079464851 11:20720189-20720211 AAAAAAAAACAGGAATGAACTGG - Intronic
1079526154 11:21390960-21390982 AATACAAAGGATTCAGGAACAGG - Intronic
1080335262 11:31188181-31188203 AAAACGAAGCAGAAATGAAGAGG + Intronic
1081022710 11:37967802-37967824 TGAACAAAGGAGGAAGGAACTGG + Intergenic
1081044460 11:38253980-38254002 CAAACAAAGCAGGCAGAAACTGG + Intergenic
1081096842 11:38946741-38946763 TAAACAAAGCAGCATGGTACTGG + Intergenic
1081222044 11:40474161-40474183 AAAACAAAGCTGGAAGCATCAGG + Intronic
1081251920 11:40846589-40846611 AAAACAAAGCTGGAAGCATCAGG - Intronic
1081531907 11:43967526-43967548 AAAACAAATCAGCAAAGAAATGG - Intergenic
1083175575 11:60947928-60947950 AAAAAAAAGCAGTGAGGACTAGG + Intronic
1083428271 11:62600903-62600925 AAAAGAGAGCCTTAAGGAACAGG + Intronic
1083453450 11:62762032-62762054 AACCCAAAGCAGGAAGCAACTGG - Intronic
1083736229 11:64682900-64682922 AGAACATAGCAGTTAGGACCAGG - Intronic
1084533555 11:69743475-69743497 AAAAAAAAGCAATAAGTATCAGG - Intergenic
1084995150 11:72969509-72969531 CACACAAAGAAGTAAGGAAATGG - Intronic
1085365032 11:75933124-75933146 TAAACAAAACAGTATGGTACTGG + Intronic
1086196746 11:84149475-84149497 AAAAATAAGCAGTAGGGAAAGGG - Intronic
1086375633 11:86197493-86197515 AAAACAAGGGAGTAAGAAAAAGG - Intergenic
1086451647 11:86923114-86923136 AAAAAAAAGTAGACAGGAACAGG - Intronic
1086567131 11:88240085-88240107 AACACACAGCTGCAAGGAACAGG - Intergenic
1086845834 11:91748545-91748567 AAACAAAAGCAGTAAGCCACTGG - Intergenic
1086980895 11:93197180-93197202 AAAATAAAAAAGTAAGGATCAGG - Intronic
1088343952 11:108801571-108801593 AAAAGAAAGTAGGAAGGAATTGG - Intronic
1088486485 11:110345601-110345623 AAAAAAAAGAAGTGAGGGACCGG + Intergenic
1088917727 11:114240051-114240073 AACAAAAAGCAGGAAGGAAGGGG - Intronic
1089728136 11:120500948-120500970 AAAACAAAGCAGGCGGGGACGGG - Intergenic
1089899717 11:121967818-121967840 AAATCAAAGCAGTAAGTAAAAGG - Intergenic
1089925559 11:122253824-122253846 CAAACTTAGCAGTAAGGACCTGG + Intergenic
1090592311 11:128285372-128285394 AAAACAAAACAGAAAGAAGCAGG + Intergenic
1090864432 11:130685861-130685883 AAATCAAAACAGTATGGAACTGG + Intronic
1090979001 11:131700484-131700506 ATAACAACCCAGTAAGCAACTGG - Intronic
1092659775 12:10725249-10725271 CAAACAAAGCAGTGAGCAGCTGG + Intergenic
1093705986 12:22275556-22275578 AAAAAAAAGCAATGAGGAGCTGG + Intronic
1093767761 12:22984314-22984336 ATAGCAAAGCAGAAAGGTACAGG + Intergenic
1094029660 12:25996688-25996710 GAAACAAAGCAGTAAGCTAAAGG - Intronic
1094343528 12:29440382-29440404 AAAACAAAGAAATAAAGAAGGGG - Intronic
1095141058 12:38662756-38662778 AAACCAAAACAGAAAGGCACTGG + Intronic
1095150412 12:38788074-38788096 AAAACAGAGAAGTAGGGAATAGG + Intronic
1095272134 12:40231598-40231620 AAAAAAAAGTACTAAGGATCTGG + Intronic
1095627819 12:44338401-44338423 AAAACAAAGCTGGAAGGTATAGG + Intronic
1095992126 12:48042386-48042408 AAAACCAGGCAGTAATGGACAGG + Intergenic
1096060240 12:48692309-48692331 AAATGAAAACGGTAAGGAACAGG + Exonic
1096181126 12:49550982-49551004 GAGACAAAGCAGTAAGGAGCTGG - Intronic
1096279261 12:50237706-50237728 AAAACAAAACAGTATGATACTGG + Intronic
1096592832 12:52673232-52673254 AAAACAAAGCACTAAACACCAGG + Intergenic
1096714189 12:53481345-53481367 AAAACAAATCAGTAAGCCACTGG - Intronic
1097309595 12:58103823-58103845 AAAACAAAGCTGTAGGCAAATGG + Intergenic
1097553572 12:61107801-61107823 AAAAAAAAACAGTAAGGATGAGG - Intergenic
1099353455 12:81603862-81603884 AAAGGAAAACAGTAAGGGACAGG - Intronic
1099378497 12:81924531-81924553 AAAGCAAGGTAGTAAGGAATAGG - Intergenic
1100275830 12:93071072-93071094 AAAAAAAAGTAGGAAGGAAAAGG - Intergenic
1101202916 12:102455621-102455643 CAAACTAAGCATTAAGGAAAGGG - Intronic
1101419437 12:104537679-104537701 AAAAAAAAGCAGGGAGGTACTGG - Intronic
1101591537 12:106129535-106129557 GAAACAAAGAAGTAAGGAAGTGG + Intronic
1101885785 12:108660466-108660488 AAAAAAAAGAAGTAGGAAACTGG + Intronic
1101977770 12:109376554-109376576 AGAACAAAGCAGTGAGAAAAGGG - Intronic
1102222375 12:111203247-111203269 AAAAAAAATCAGTAAGGGCCAGG + Intronic
1102623611 12:114216765-114216787 AAAAGAAGGAAGAAAGGAACCGG + Intergenic
1103632832 12:122276483-122276505 AAACCGAAGCAGAAAGGAAGGGG + Intronic
1104547849 12:129728496-129728518 AGCACAACTCAGTAAGGAACTGG + Intronic
1106037308 13:26055492-26055514 AAAACAATGGAGTAAGGAGGGGG - Intergenic
1106816021 13:33408078-33408100 AACACACAGAAGTAAGGCACAGG - Intergenic
1107239752 13:38218240-38218262 AAAACAAAAAATTAAGGAACAGG - Intergenic
1107248361 13:38325272-38325294 AAAACAATGCAAAAAGGAAATGG + Intergenic
1107507684 13:41050968-41050990 AAAACAAAGCAGAATATAACAGG - Intronic
1107789246 13:43984549-43984571 AAAACAAAGGAAGAAGGAAGAGG + Intergenic
1108383580 13:49877735-49877757 AAAACAAAACAGAAAGAAAAAGG + Intergenic
1108579217 13:51814582-51814604 TCACCAAAGCAGTAAGGAAGAGG - Intergenic
1108852538 13:54750854-54750876 GAAACAAAACATTATGGAACTGG + Intergenic
1109040191 13:57324561-57324583 TAAACAAAGCAGTGTGGTACTGG + Intergenic
1109104363 13:58231481-58231503 AAAATGAAGCATTAAAGAACTGG + Intergenic
1109231364 13:59761942-59761964 AAACCCAAGTTGTAAGGAACTGG - Intronic
1109518467 13:63476283-63476305 ATAACAAGGCAGTCAGAAACTGG - Intergenic
1109530710 13:63642414-63642436 TAATCAAAGCAGCATGGAACTGG - Intergenic
1109611628 13:64772698-64772720 AAAACAAAGCAGCATAGTACTGG - Intergenic
1109629154 13:65021219-65021241 AAACCAAAGCAGCATGGTACTGG - Intergenic
1109739066 13:66527690-66527712 AAAAGAAAGTATAAAGGAACAGG + Intronic
1109822719 13:67679567-67679589 AAAGCAAAGCAGAAAAGGACTGG - Intergenic
1109934061 13:69258184-69258206 TAACCAAAACAGTAAGGTACTGG + Intergenic
1110349891 13:74494704-74494726 AAAACAAAACAGCATGGTACTGG + Intergenic
1110512508 13:76367668-76367690 AAATCAAAACAGTATGGTACTGG + Intergenic
1110657893 13:78022284-78022306 AAAACATAGAAGTCAGGAAATGG + Intergenic
1110668563 13:78147831-78147853 AAAGCAAATCATTAGGGAACAGG - Intergenic
1110799679 13:79680457-79680479 AAAACAAAACATTAAAGACCAGG - Intergenic
1111164631 13:84443065-84443087 AAACCAAAGCAGCATGGTACTGG - Intergenic
1111318634 13:86594458-86594480 AAACCAAAACAGTATGGTACTGG + Intergenic
1111618203 13:90689308-90689330 AAAATAAGACAGTCAGGAACTGG + Intergenic
1112285239 13:98098003-98098025 AAAAGAAAGCAGCAGGGAAAAGG - Intergenic
1112429187 13:99335365-99335387 AAAAAAAAACAGTAATGAATTGG - Intronic
1112596142 13:100808989-100809011 TAAACAAGGCTGGAAGGAACTGG + Intergenic
1112817216 13:103286997-103287019 AAAAGGAAGCACTCAGGAACGGG - Intergenic
1112849025 13:103681331-103681353 AAAACAAAACATTAAGCAAATGG - Intergenic
1113116741 13:106882257-106882279 AAAACAAAGTAGAAAGAAAAAGG + Intergenic
1113241532 13:108343934-108343956 AGAAGAAAACAGTAAAGAACAGG - Intergenic
1114399975 14:22401203-22401225 CAAAGAAAGCAATTAGGAACAGG + Intergenic
1114667376 14:24387293-24387315 AAAAGAATGCAGTAGGGAAAGGG - Intergenic
1115826679 14:37286138-37286160 AGTAAAAAGCAGTAAAGAACAGG - Intronic
1116072736 14:40069835-40069857 AAAAATAAGAAGTAAGTAACAGG + Intergenic
1116342507 14:43742420-43742442 AAAATAAAGCAGTAAAGGATAGG - Intergenic
1117652714 14:57923663-57923685 AAAACAGAGAACTAGGGAACAGG - Intronic
1118104591 14:62643041-62643063 AAAACAAAACAGTATGGTAAAGG + Intergenic
1118216177 14:63810678-63810700 AAAACAAAATATTAAAGAACAGG - Intergenic
1118314694 14:64718767-64718789 AAGACAAAACAGCAAGGTACTGG - Intronic
1119005947 14:70928824-70928846 AAAATAAAGCAGAAAGGTAGAGG - Intronic
1119060518 14:71469502-71469524 AAATCAAAGCAGTATAGAGCTGG + Intronic
1119207940 14:72808717-72808739 AGCACAAAGCAGCAGGGAACCGG + Intronic
1119280336 14:73401467-73401489 AAAACAAAGAAGTACAGATCTGG + Intronic
1119517233 14:75257890-75257912 AAAAAAAAGAAGAAAGAAACAGG - Intronic
1120773058 14:88402410-88402432 TAATCAAAACAGTATGGAACTGG + Intronic
1120865143 14:89290144-89290166 AAAAAGTAGCAGTAAAGAACTGG - Intronic
1121381621 14:93475174-93475196 AAAACAATGCAATAAGAAAAGGG + Intronic
1121476358 14:94209734-94209756 AAACAATAGCAGAAAGGAACAGG + Intronic
1121923525 14:97905865-97905887 AAAAGAAAGCATTAAGCAAATGG - Intergenic
1122653412 14:103240167-103240189 AAAAAAAAGCAATTAGTAACAGG - Intergenic
1202836241 14_GL000009v2_random:79343-79365 AATACAAGGCAGTTAGGGACTGG + Intergenic
1202887790 14_KI270722v1_random:124397-124419 TAACCAAAGCAGCAAGGTACTGG + Intergenic
1123958978 15:25374141-25374163 CAAAAAAACCAGTAACGAACAGG + Intronic
1124701283 15:31914763-31914785 GAAACAAAGCATTAAGGAAAAGG + Intergenic
1124716140 15:32064098-32064120 AAAACAAAGCTATTGGGAACTGG - Intronic
1125314922 15:38421079-38421101 AAAAAAAAGAAGAAAGAAACAGG - Intergenic
1125812299 15:42551714-42551736 AAACCAAAGGAGTAAGGCACTGG + Intronic
1126419781 15:48459282-48459304 AAAACAAAGCAGCTAGGGCCAGG + Intronic
1126657521 15:50995215-50995237 AAGAAAAATCAGTAGGGAACAGG - Intronic
1126744014 15:51807090-51807112 ATAGCAAAGAAGAAAGGAACTGG + Intronic
1126897609 15:53276013-53276035 AAAACAAAGCAAAAAGGCAGAGG + Intergenic
1127302467 15:57668831-57668853 AAAACAAAAAAGTAAGTCACAGG - Intronic
1127886667 15:63207542-63207564 AAAACAAAAAACTAAGGAAAAGG - Intronic
1128020663 15:64387683-64387705 ACAACAAAGCAGGAAGAAGCAGG + Intronic
1129960101 15:79676318-79676340 AAACCAAAGAAGCCAGGAACTGG + Intergenic
1129979384 15:79853160-79853182 GAAACAAAGTATTAAAGAACAGG + Intronic
1130442341 15:83967799-83967821 AAACCAAAACAGTATGGTACTGG + Intronic
1130561143 15:84960214-84960236 AAAAAAAAGCAGGCAGGCACAGG - Intergenic
1130791717 15:87162358-87162380 CAAACAAATCAGTAACCAACTGG - Intergenic
1130999468 15:88927826-88927848 AAAAAAAAGAAGTAAAGAAGAGG - Intergenic
1131131368 15:89902783-89902805 AAGAAAAACCAGTAAGGACCAGG + Intronic
1133106740 16:3515887-3515909 AATACTAAGCAGTGAGGAATTGG - Intronic
1133615863 16:7476329-7476351 ACAAGAAAGCATTAAGGAAAGGG - Intronic
1133682124 16:8129490-8129512 AAAAGAAAGCAGAGAGGAAAGGG + Intergenic
1133782904 16:8953462-8953484 AAACCAAGACAGTAAGAAACGGG + Intronic
1133789876 16:9001406-9001428 AAAAAAAAGCAAGAAGAAACAGG - Intergenic
1133856306 16:9552322-9552344 AAAACAAAACAGAGAGCAACAGG - Intergenic
1136920437 16:34266532-34266554 AAAAGAAAGAAGTAAAGAACGGG - Intergenic
1137021238 16:35429759-35429781 AAAAAAAATCAGTAAGGTTCTGG - Intergenic
1138405031 16:56785342-56785364 CAAAGAAAGCAGGAAGAAACTGG - Intronic
1139297401 16:65914269-65914291 TAATCAAAACAGTATGGAACTGG - Intergenic
1140100137 16:71908977-71908999 AAACAAAAGATGTAAGGAACAGG - Intronic
1140744320 16:77967880-77967902 CAAACAAAGCAGTACGGACTAGG + Intronic
1140838043 16:78813711-78813733 AAGAGAAAGCAGTAAGTATCAGG - Intronic
1141598800 16:85113130-85113152 AAATCACGACAGTAAGGAACGGG + Intergenic
1141942687 16:87288622-87288644 AAAAAATAGCAGAAAGGAAGGGG + Intronic
1142201577 16:88763524-88763546 AAAACAAAACAGAACAGAACAGG + Intronic
1142542501 17:671236-671258 AAAAGAAAGAAGAAAGGAAAAGG + Intronic
1142897953 17:2994417-2994439 AAAGAAAAGCTCTAAGGAACTGG - Intronic
1143254015 17:5542584-5542606 AAAGTAAAGCAGAAAGGAGCAGG - Intronic
1144549923 17:16231204-16231226 AAAATAAATCAGTAAGAAGCTGG - Intronic
1144637085 17:16917021-16917043 AAAACAAAGAGGAAAGGAAAAGG - Intergenic
1146429787 17:32781367-32781389 CATAGAAAGCAGGAAGGAACAGG - Intronic
1146664663 17:34690815-34690837 AACACAACTCAGTAAGGAAAAGG + Intergenic
1146966115 17:37031590-37031612 TAAATAAAGCAGGAAGCAACAGG - Intronic
1146993049 17:37293191-37293213 GAAACAATGTAGTAAGGAACCGG - Intronic
1147171101 17:38619367-38619389 AAAACAAAACAAAAAGAAACAGG + Intergenic
1147210132 17:38868438-38868460 AAAATAAAGGAGAAAGGAAGAGG - Intergenic
1148349610 17:46930637-46930659 AAAAAAAAGCATAAAGGAAGGGG - Intronic
1148624641 17:49059684-49059706 AAAAAAAAGAAGTAAGAATCAGG + Intergenic
1148962041 17:51401547-51401569 CAAACGAAGCAGGAAGGAAATGG - Intergenic
1149338355 17:55660915-55660937 CAGACAAGGCAGTGAGGAACAGG - Intergenic
1149609413 17:57949227-57949249 AAGACAAAGCACTGAGGAAGGGG - Intronic
1149717136 17:58802406-58802428 TAATCAAAGCAGTATGGCACTGG - Intronic
1149962592 17:61128339-61128361 CAAACAAATAAGAAAGGAACTGG - Intronic
1150479546 17:65498880-65498902 AACAGAAAGCAGAAAAGAACTGG + Intergenic
1150553605 17:66233548-66233570 AAAAGAAAGAAGGAAGGAAGGGG + Intronic
1150764442 17:67992587-67992609 AAAAAAAAGCAGTATGTAACCGG + Intronic
1151103510 17:71584458-71584480 AAAACAAATATGTAAAGAACAGG + Intergenic
1152939824 17:83162444-83162466 AAAACAAAACAGTACGGCCCTGG + Intergenic
1153695928 18:7641740-7641762 AGAAAAAAGCAGTAAAGAATAGG + Intronic
1154307289 18:13239904-13239926 AACAAACAGCAGTCAGGAACTGG - Intronic
1155650583 18:28136123-28136145 AAGACAAAGTAATAATGAACTGG + Intronic
1156056732 18:33014551-33014573 AAAAAACAGCAGTAAGAAAGTGG - Intronic
1156342575 18:36223464-36223486 TAATCAAAGCAGTATGGTACTGG - Intronic
1156996012 18:43467432-43467454 AAAAGAAGGCAGGAAGGAAAGGG + Intergenic
1157994858 18:52542841-52542863 AAAAAAAAGCAACTAGGAACAGG + Intronic
1158417247 18:57259421-57259443 GCAATAAAGCAGTCAGGAACTGG + Intergenic
1158471459 18:57740930-57740952 AAAATAAAGCAGCAAGGTTCAGG - Intronic
1158912768 18:62083743-62083765 AAAATAACTCAGTAGGGAACAGG + Intronic
1159616621 18:70587642-70587664 GAATCAAAACAGTAAGGTACTGG - Intergenic
1159872508 18:73774579-73774601 AAAGCAAACCAACAAGGAACGGG + Intergenic
1159893696 18:73976906-73976928 AAAACAAACCAAAAAGGAAGAGG + Intergenic
1160059441 18:75516036-75516058 AAAACTAAGCAGGAATGAAAGGG + Intergenic
1160744079 19:702431-702453 AAAAAAAAACAGCAAGGTACTGG + Intergenic
1161173713 19:2827064-2827086 AACAAAAAGCAGGATGGAACAGG - Intronic
1161352309 19:3800661-3800683 AAAAGAAAGCAGAAGGGAAATGG + Intronic
1161559659 19:4965587-4965609 AAAAAAAAGCAGTTGGGGACTGG - Intergenic
1162586511 19:11562481-11562503 AAAACAAATCAGTTAGGGCCAGG - Intronic
1163814956 19:19459309-19459331 AAATCAAAACTGAAAGGAACTGG - Intronic
1164043777 19:21515957-21515979 AAACCAAAGCAGCATGGTACTGG - Intronic
1164093491 19:21982630-21982652 TAAACAAAACAGTATGGTACTGG + Intronic
1164240728 19:23386426-23386448 TAAACAAAGCAACATGGAACTGG + Intronic
1164284055 19:23795049-23795071 TAAACAAAGCAACATGGAACTGG - Intronic
1164316575 19:24093660-24093682 TAAACAAAGCAACATGGAACTGG - Intronic
1164623822 19:29714024-29714046 AACAAAAAGCAGGAAGGAAGGGG - Intronic
1165243917 19:34487088-34487110 AAAAAAAAGCAGGCAGGGACTGG - Intronic
1166936851 19:46339167-46339189 AAAAGAAAGCAGAGAGGAAAGGG - Intronic
1168117934 19:54235161-54235183 TAACCAAAACAGTAAGGCACTGG - Intronic
1168446317 19:56418022-56418044 TAATCAAGGCAGTATGGAACTGG - Intronic
1202663196 1_KI270708v1_random:91239-91261 TAACCAAAGCAGCAAGGTACTGG + Intergenic
925212100 2:2058257-2058279 AAAACAATGTAGTAAGAAAATGG - Intronic
925515136 2:4673890-4673912 AAAAAAAGCCAGTAAGGTACAGG - Intergenic
926438503 2:12861962-12861984 AAAAAAAAGAAAAAAGGAACCGG - Intergenic
927185341 2:20478324-20478346 AAACCATATCAGTAAGGAAGTGG - Intergenic
927349445 2:22091430-22091452 TAAACAAAACAGCATGGAACTGG - Intergenic
927760971 2:25753417-25753439 AAAACAAAACAGAAGGAAACTGG + Intronic
928414603 2:31081426-31081448 AAAAATAAGCAGGAAGGAAAGGG + Intronic
928450434 2:31373619-31373641 AAAAAAAATCTGTAAGGAAGAGG + Intronic
928766677 2:34654729-34654751 TAAACAAAGCAGCATGGTACTGG + Intergenic
928875544 2:36034268-36034290 AAAACCAACCAGTAAGGCAAGGG - Intergenic
929344824 2:40869158-40869180 AACAGAAAGCAGGAAGGTACAGG - Intergenic
929449717 2:42028544-42028566 AAAACAAAGTAGAAAGTAAATGG - Intergenic
929708042 2:44236420-44236442 AAAAAAAAGTTGTAATGAACTGG + Intronic
930451324 2:51541558-51541580 AAAGCAAATGAGGAAGGAACAGG - Intergenic
932878374 2:75476217-75476239 AAATTAAAACAGGAAGGAACAGG - Intronic
932920675 2:75910922-75910944 AAACCAAAGCAGCATGGTACTGG - Intergenic
933008547 2:77026396-77026418 AAAACCAAGCATTTAGGATCTGG - Intronic
933417036 2:81999395-81999417 AAAAAAAAAAAGTAAAGAACAGG + Intergenic
935209065 2:100922902-100922924 AGAACAGAGCAGTAATGAGCTGG + Intronic
935219953 2:101003476-101003498 AAAATAAAGCATTAGGGAAGGGG - Intronic
935861569 2:107336861-107336883 AAGACAAAGCCGCAAGGAAAGGG - Intergenic
935959500 2:108410686-108410708 AACACAAAGCTTTGAGGAACAGG - Intergenic
936589380 2:113788644-113788666 AAAAAAATGGAGTAAGGGACTGG + Intergenic
936821130 2:116522674-116522696 AAAAAAAAGCAATGAGGAAAGGG - Intergenic
936879704 2:117234732-117234754 AAATCAAAACAGTAGGGTACTGG + Intergenic
936956521 2:118028166-118028188 AAAAAAAATCAGTTAGGACCAGG + Intergenic
936971714 2:118182919-118182941 AAATGAAATCAGGAAGGAACTGG + Intergenic
937814092 2:126231813-126231835 AAAAAAAAGCAGGCAGGAAAGGG - Intergenic
938557952 2:132442750-132442772 AAAAAAAAGCAGCAAGGAAATGG - Intronic
938615096 2:132989425-132989447 AAGACAAAGCAGTGGGGACCCGG + Intronic
938703287 2:133898342-133898364 AGAACAGAACAGAAAGGAACAGG - Intergenic
939591596 2:144070927-144070949 AAAACAAAGCATTAATGAATAGG + Intronic
939691027 2:145260488-145260510 AAAAGAAAGCAGTAGGCAATGGG - Intergenic
940218320 2:151323755-151323777 AAAGAAAAGAAGTAAGGAACAGG + Intergenic
940242620 2:151579097-151579119 AAAAAAAAAAAGTAAGAAACTGG + Intronic
940380171 2:153006176-153006198 AAAATAAATCAGTAATAAACTGG + Intergenic
940903130 2:159145128-159145150 AAATGAAAGCAGTAAGGTGCAGG + Intronic
940986396 2:160056181-160056203 AAAACGAAACAGAATGGAACAGG + Intronic
941048445 2:160703627-160703649 AAAACAAAACAGTAGAAAACTGG - Intergenic
941507439 2:166364916-166364938 AAATCACAGCAGTTAGCAACCGG + Intronic
941743131 2:169057574-169057596 TAAACAAAACAGTATGGCACTGG + Intergenic
941819505 2:169829888-169829910 GAAACTAAGCGGGAAGGAACTGG - Intronic
942067982 2:172289802-172289824 AAAACAAAGCTGTAATGAGTAGG - Intergenic
942300561 2:174557249-174557271 AAGACAAAGGAGAAGGGAACTGG + Intergenic
942334465 2:174868067-174868089 AAAACAAAGAAAGAAGGAAGGGG - Intronic
942512138 2:176714270-176714292 AAAACAAAGCAGTGGGGAGAGGG - Intergenic
942975499 2:182012859-182012881 AAAACAAACAACTAAGAAACAGG + Intronic
943095970 2:183429906-183429928 AAAACCACGCACTAAGGAAGTGG - Intergenic
943300449 2:186191300-186191322 AAAAGAAAGAAGGAAGGAAAAGG + Intergenic
943556313 2:189408904-189408926 AAAACAAAGCAAAATGGAATAGG + Intergenic
943601138 2:189922700-189922722 AAAACATAGCAATAAGTAATAGG - Intronic
943840740 2:192576563-192576585 AAAACAGAGCAAAAGGGAACTGG - Intergenic
944418271 2:199500466-199500488 AAAACAATGCAGTGGGGAAAGGG + Intergenic
945013655 2:205491482-205491504 TAAACAAAACAGTATGGTACTGG - Intronic
945059277 2:205894251-205894273 AAAACAAAACAGGAATGAAATGG - Intergenic
945686763 2:212980520-212980542 AAATCAGAGCAGTAAGAAAGTGG - Intergenic
945791022 2:214305631-214305653 AAAAACAAGCAATAAGGAAAAGG - Intronic
945993849 2:216419540-216419562 AGAACAAAGGAGTGAGGACCAGG - Intronic
946728367 2:222684571-222684593 AAAAAAAAGAAGTAAGATACTGG - Intronic
1169062864 20:2674161-2674183 AAAAAAAATCAGGAAGGAAAAGG + Intergenic
1170005545 20:11664802-11664824 AAAAGGAAGCAATAAAGAACAGG - Intergenic
1170433985 20:16305146-16305168 AAAGAAAAGCAGTTAGGAACCGG + Intronic
1170534031 20:17322846-17322868 AAAACAAAACAAAAAAGAACTGG - Intronic
1170985842 20:21257651-21257673 AAAAAAAAGCAAAAAGAAACTGG - Intergenic
1171387859 20:24782298-24782320 AAAAGAAAGCGGAAAGGAGCAGG + Intergenic
1171432680 20:25093902-25093924 AAAATAAAGCACTAAAGACCAGG + Intergenic
1171994245 20:31719979-31720001 GAATCAAAGCAGGAGGGAACAGG + Intronic
1172820634 20:37730607-37730629 AAAACAGAGCAGTAGTGAAAGGG - Intronic
1172955581 20:38755831-38755853 AAAACAGAGCAGTCACAAACAGG - Intronic
1173381843 20:42551848-42551870 AAAACAAACAAGCAAGGAATGGG - Intronic
1173541832 20:43859047-43859069 AAAATAAAGAAGTCAGGAATAGG - Intergenic
1173761547 20:45564971-45564993 AAGACAAAGAAGGAAGGAAAAGG + Intronic
1173767487 20:45626225-45626247 AGAACAAAGCTGGAGGGAACAGG - Intronic
1173890720 20:46507596-46507618 AAAATAAAGCAGTAAAAAATAGG + Intronic
1173978587 20:47205921-47205943 AAAGGAAACCAGCAAGGAACTGG + Intergenic
1174719306 20:52794505-52794527 AAAACAAAGCCGTAAATAAGTGG + Intergenic
1175135096 20:56817305-56817327 AATAAAAAATAGTAAGGAACAGG - Intergenic
1175202629 20:57288665-57288687 AAAACAAAACAGTAATAAGCTGG + Intergenic
1175560526 20:59924877-59924899 AACATAAAGCAGTAAGGAAAGGG + Intronic
1176886635 21:14264279-14264301 AAAACAAAGCAGTGAGATTCTGG - Intergenic
1177910827 21:27029872-27029894 AGAACAATGCAGTAATGAAAGGG + Intergenic
1178149041 21:29773163-29773185 AAAACAAAGCAGTAAGGAACAGG + Intronic
1178860398 21:36284251-36284273 AAAAAAAAGAAAGAAGGAACAGG - Intronic
1179546958 21:42118947-42118969 AAAACACAGCAGACAGGAAAGGG + Intronic
1179653322 21:42829355-42829377 TAACCAAAACAGTAAGGTACTGG - Intergenic
1180329935 22:11468124-11468146 TAACCAAAGCAGCAAGGTACTGG + Intergenic
1181159504 22:20949856-20949878 ACAACAAAGCAGCAGGAAACAGG - Exonic
1181612186 22:24023553-24023575 AAAATAAAACAGAAAGGAAATGG - Intronic
1182073963 22:27482242-27482264 AAAATAAATCAGTAAGGACAAGG + Intergenic
1182327868 22:29527947-29527969 AAAACAAAGCAATATGAAATGGG + Intronic
1182824348 22:33251402-33251424 AAAACAGAGCAGAAAGTCACTGG - Intronic
1182875424 22:33687371-33687393 AAAAAAAAGCAGCAAGGTAAAGG - Intronic
1183752802 22:39731711-39731733 AAAACAAAGCAGAGAGCCACAGG + Intergenic
1183921467 22:41172585-41172607 GGAAGAAAGCATTAAGGAACTGG + Exonic
1183944837 22:41319406-41319428 AAAACAAAGCAAAAAGTAGCCGG + Intronic
1184086479 22:42269300-42269322 AAAAAAAAGCAAAAAGGAAAAGG + Intronic
1184304155 22:43584085-43584107 TGAACCAAGCAGGAAGGAACTGG + Intronic
1184772809 22:46607783-46607805 AAAACAAACCAGAAAGGAGCTGG - Intronic
1185378319 22:50493379-50493401 AAAACAAAACAGTGTGGCACTGG + Intergenic
949199232 3:1353112-1353134 AAAATAAAGCAGCAAGGAAAGGG - Intronic
949830668 3:8210829-8210851 AAACCAAAGCAGTAGGGCAGAGG - Intergenic
949989506 3:9567247-9567269 AAAACAAACAAGTAAAAAACTGG - Intergenic
950239988 3:11360641-11360663 AAACCAAAGCAGCAAGGAGCTGG + Exonic
950327572 3:12126260-12126282 CAAACCAAGAAGCAAGGAACTGG + Intronic
950733230 3:14980959-14980981 GATACAAAGCATTAAGGAATTGG + Intronic
950864816 3:16180707-16180729 AAAAGAGAGCAGAGAGGAACAGG + Intronic
951447234 3:22796903-22796925 AACACAAAGCATTAAGGATATGG + Intergenic
951969649 3:28429715-28429737 TACACAAAGCAGCAAGGCACTGG - Intronic
952037837 3:29224668-29224690 AAAACAAAGGAGTAAGCAAAGGG - Intergenic
952399166 3:32947995-32948017 AAACCTAAGCAGAAAGGAGCAGG - Intergenic
952824221 3:37511572-37511594 AAAAGAAATCAGTAAGACACAGG - Intronic
955246900 3:57233495-57233517 AAAACAAAACAGAAACGAAGCGG + Intronic
955451352 3:59070643-59070665 AAAACAATTCAGAAAAGAACTGG - Intergenic
955753109 3:62202833-62202855 ACAACAAAGAAGTCATGAACTGG - Intronic
957265968 3:77966269-77966291 AAAAGAAAGCAGTAGGGACAAGG + Intergenic
957357551 3:79112092-79112114 AAAACAAAGTAATAAGAAATGGG - Intronic
957496733 3:81001985-81002007 AAAACAAAACAGTAAGAAATGGG + Intergenic
957518413 3:81286698-81286720 AAAATAAAGGAGTAAGAAAATGG - Intergenic
957753961 3:84462965-84462987 AAACCAAAGTAGAAAGAAACAGG + Intergenic
957851925 3:85819216-85819238 AGAACAAAGCAGGCAGGAAAAGG - Intronic
958147512 3:89645134-89645156 AAAACAAAGCAAAAAGGAGTTGG + Intergenic
958905828 3:99941176-99941198 AAAAAAAAGACGTAAGGAATAGG - Intronic
959267798 3:104166742-104166764 TATACAAAGCAGTAACTAACAGG + Intergenic
959725549 3:109537961-109537983 AAAAGAAAGAAGAAAGGAAGGGG + Intergenic
959730429 3:109595105-109595127 AAGGCAAAGCAATAAGGAAATGG - Intergenic
959816444 3:110679144-110679166 AGACCTAAGCAGAAAGGAACAGG + Intergenic
959945865 3:112124759-112124781 AAAGCAAAGCAGCAAAGTACAGG + Intronic
961005069 3:123399480-123399502 AAAACAAAGCAGTATGGAGAGGG - Intronic
961413318 3:126739187-126739209 AAAACAAGGAAGTAAAGAAAGGG - Intronic
961579172 3:127864501-127864523 AAAACAAAAAATTAAGCAACTGG - Intergenic
961860492 3:129913312-129913334 ATTAGAAAGCAGAAAGGAACAGG + Intergenic
962132319 3:132694081-132694103 ACAACTAAGCAGTATGGTACTGG + Intronic
963072670 3:141317923-141317945 AAAATAAATCAGTAAGAAAAAGG + Intergenic
963100056 3:141592817-141592839 AAAAAAAAGAAGTAAAGAAGGGG + Intronic
963736369 3:149021751-149021773 AAAAAAAAAAAGTTAGGAACTGG - Intronic
963939953 3:151087332-151087354 AAAATAAAGCAGGCAGAAACGGG - Intronic
964415709 3:156445309-156445331 AAAACAAAGCACAAAGGAAAAGG + Intronic
964430130 3:156596942-156596964 CAAACAAATCAGTAAGAAAAAGG + Intergenic
964478247 3:157116520-157116542 GAAATAAAGCACTAAGGGACAGG + Intergenic
965869781 3:173252098-173252120 GAATCATAGCAGAAAGGAACAGG + Intergenic
965982859 3:174714175-174714197 TAAACAAAACAGCATGGAACTGG - Intronic
966035159 3:175403176-175403198 AAAACAAAGCAAAAAAGAAAAGG - Intronic
966590651 3:181678904-181678926 TAAACAAAACAGTATGGTACCGG - Intergenic
966718783 3:183040117-183040139 AAAAAAAAAAAGGAAGGAACCGG + Intronic
966819241 3:183911753-183911775 AAAACAAAGGAGAAAGAAAGAGG - Intergenic
966973051 3:185062666-185062688 ATAACAAATCAGTATGGTACTGG + Intergenic
967256471 3:187597751-187597773 AAAACAAAGAAGAAAGGAAAAGG - Intergenic
967615711 3:191563452-191563474 AAAACAGATGAGTAAGAAACTGG + Intergenic
967704401 3:192633015-192633037 AAAACAAAGCAAAAAGGAGAGGG - Intronic
968673582 4:1865052-1865074 AAAAAAGAGCAAGAAGGAACAGG - Intergenic
968678725 4:1901139-1901161 AAAACAAGGCGAGAAGGAACAGG + Exonic
968718597 4:2181107-2181129 AAAAAAAAGAATTAAGGAAAGGG + Intronic
969051375 4:4375549-4375571 AAAAAAAAGAAGGAAGGAAAGGG - Intronic
969243185 4:5915399-5915421 ATGACAAAGGAGAAAGGAACTGG - Intronic
969546473 4:7832781-7832803 AAAACAAAACAGCATGGTACTGG + Intronic
970112876 4:12658368-12658390 AAAACAAATCAGTAGTTAACAGG - Intergenic
970123390 4:12782573-12782595 AACACAAAGCAGTAAGCCATGGG - Intergenic
970771006 4:19612368-19612390 AAAAGACAGCTGTAAGGGACAGG + Intergenic
970812727 4:20114176-20114198 AAAACAGAGAAGAAAGGAAGGGG - Intergenic
970966366 4:21933024-21933046 AAAGCAAAGCAGAAAAGAAAAGG + Intronic
971596838 4:28540298-28540320 AAAAGAAAGCAGAAAGAAAGGGG - Intergenic
971856411 4:32050407-32050429 AAAACAAAACAGTAAAACACAGG + Intergenic
972023572 4:34346936-34346958 AGAACAAAACAGTTGGGAACAGG - Intergenic
973234233 4:47880824-47880846 AAAAAAACGCAAAAAGGAACAGG + Intronic
973537868 4:51901933-51901955 AAAACAAAGCAAAAAAGAACAGG - Intronic
974082378 4:57225692-57225714 TAACCAAAACAGTAAGGTACTGG - Intergenic
974118094 4:57605675-57605697 AAAATAAAGAAGGAAGGAAAAGG - Intergenic
974159443 4:58119096-58119118 AAAACTAAGCAGGGAGGAGCCGG + Intergenic
974633577 4:64528720-64528742 AAACCAAAGCAGCATGGTACAGG + Intergenic
974762230 4:66292271-66292293 TAAACAAAGCAGCATGGTACTGG + Intergenic
974976497 4:68900516-68900538 CAAACAAATCAGGAAGGCACAGG + Intergenic
975219872 4:71801876-71801898 AAAAAAAAGAAGAAAGAAACAGG - Intronic
976289919 4:83407088-83407110 AATATAAAGCAGTTAGGAAATGG + Intergenic
976428054 4:84929184-84929206 AAAACAGCCCACTAAGGAACTGG + Intronic
977234562 4:94492703-94492725 AATAAAAAGGAGTAAGAAACCGG - Intronic
977677259 4:99761811-99761833 GAAACACAGCAGTCAGAAACAGG - Intergenic
977945232 4:102905475-102905497 AAATGAAAGCATTAAGCAACAGG + Intronic
978122757 4:105100689-105100711 AAAACAAACCTGTTAGAAACTGG + Intergenic
978971768 4:114816141-114816163 AAATCTAATCAGTAAGGAAGAGG - Intergenic
979064415 4:116110483-116110505 TAAACAAAGCAGCATGGTACTGG + Intergenic
979651006 4:123131513-123131535 GAAACAAAGTAGAAAGGGACTGG - Intronic
979806051 4:124972407-124972429 AAAACAAAGCAGTCACGGCCGGG - Intergenic
980219297 4:129895082-129895104 AAAATAAAGCAGTAAATAAAAGG + Intergenic
981291013 4:143074698-143074720 TAATCAAAACAGTATGGAACTGG - Intergenic
981416209 4:144496849-144496871 AAAAGAGACCAATAAGGAACTGG + Intergenic
981902412 4:149881996-149882018 AAAAGCAAGCAGGAAGGAATAGG + Intergenic
982195833 4:152912780-152912802 AAAATAATGCACTGAGGAACTGG + Intronic
982411656 4:155084659-155084681 ATGATAAATCAGTAAGGAACAGG + Intergenic
982440461 4:155429474-155429496 AAAACAAAAAAGCAAGTAACTGG - Intergenic
982954341 4:161743419-161743441 AAATCAAAACAGTATGGTACTGG - Intronic
983367591 4:166814478-166814500 AGAACAAAGCAGGTAGGAAAAGG + Intronic
983725415 4:170917387-170917409 AAAACAAAGCAGAAATTAAAAGG + Intergenic
984092478 4:175391295-175391317 AAACCAAAGCAGCATGGTACTGG + Intergenic
984174241 4:176396546-176396568 AGAACAATGCAGAAAGGGACAGG - Intergenic
984352549 4:178613936-178613958 AAAACTCAGGAGTAAGGAAGAGG + Intergenic
985376301 4:189342965-189342987 AAAAGAAAGAACTAAAGAACTGG - Intergenic
985419331 4:189768110-189768132 AAAATAAAGCAACAAAGAACTGG + Intergenic
1202763715 4_GL000008v2_random:133889-133911 AATACAAGGCAGTTAGGGACTGG - Intergenic
986471242 5:8078376-8078398 AAGACAAAGCAGTGAAGAAATGG + Intergenic
987011801 5:13773952-13773974 AAAACAGAGCAGGAAAGAAAAGG + Intronic
987796209 5:22630411-22630433 AAAACAAAACAGCATGGTACTGG + Intronic
988310150 5:29547016-29547038 AAAACAAAGTAAGAAAGAACTGG - Intergenic
988387844 5:30589924-30589946 AAACCAAAACAGTAAAGAAATGG + Intergenic
988583749 5:32491121-32491143 AAAACAAAGCAGCCAGTAGCTGG + Intergenic
988703273 5:33697706-33697728 AAAAGAAAGCAGAGAGGAAAGGG - Intronic
989144446 5:38234955-38234977 TGCACAAAGCAGTAAGGCACTGG - Intergenic
989783969 5:45304797-45304819 AAAACAAACAAGTCAGGAAAAGG - Intronic
990110945 5:52323733-52323755 AAAACAAAACAGCACAGAACAGG - Intergenic
990642995 5:57809316-57809338 AAAACAAAGGATTTAGCAACTGG + Intergenic
991170542 5:63619812-63619834 AAAACACAGTAGTATGGACCAGG - Intergenic
992021017 5:72624192-72624214 AAAACAAAATAATAAAGAACTGG - Intergenic
992111102 5:73494895-73494917 AAAACAAAGCAGCAGGAAAAAGG - Intergenic
992441798 5:76803544-76803566 CAGACAAAGCAGGAAGGAATGGG - Intergenic
993093558 5:83456655-83456677 TAAGCAAAACAGTATGGAACTGG + Intergenic
993163357 5:84318423-84318445 AAACCAAAACAGCAAGGTACTGG + Intronic
994608501 5:102004227-102004249 CAAACAAAACAGTATGGTACTGG - Intergenic
995005175 5:107183918-107183940 AAAACAGAGCTATAAGGAAATGG + Intergenic
995312376 5:110728838-110728860 AAAAAAAAGCAGAAAAAAACTGG - Intronic
995331189 5:110948657-110948679 AAAAGAAATAAGTAAAGAACGGG - Intergenic
995652434 5:114384937-114384959 AAAAATAATCATTAAGGAACTGG + Intronic
995988225 5:118206746-118206768 AAAACAAGGCAATAAGCAAAAGG + Intergenic
996415336 5:123204322-123204344 AAAACAAAGGAGTCAAGAAGAGG + Intergenic
996653254 5:125908290-125908312 TAAACAAAACAGTATGGTACTGG - Intergenic
996898898 5:128520911-128520933 AATACGAAGCAGAAAGGAAAAGG + Intronic
997099300 5:130950761-130950783 TAACCAAAGCAGCAAGAAACTGG - Intergenic
998231857 5:140365950-140365972 AGAAGAAAGAAGTAAGGAAGAGG - Exonic
999902631 5:156101668-156101690 CAAAGAAAGCAATAAAGAACTGG - Intronic
1000388111 5:160694620-160694642 AAAATGAAACAGAAAGGAACTGG - Intronic
1000430446 5:161145517-161145539 AAAACAAAACCATAAAGAACAGG - Intergenic
1000500002 5:162036461-162036483 TAAACAAAGCAGCCAGGAAGCGG - Intergenic
1000579810 5:163022081-163022103 AAAAAAAAGCAGTGAGACACTGG - Intergenic
1000724267 5:164749644-164749666 AAAAAAAAGCAAAAAGAAACAGG + Intergenic
1000774972 5:165408260-165408282 AAAACAAAACAGCATGGTACTGG + Intergenic
1002503543 5:179663343-179663365 AAAAAAAAACAAAAAGGAACTGG - Intergenic
1003310646 6:4966969-4966991 AAATAAAAGCAGGAAGGAAAGGG + Intergenic
1003428505 6:6016695-6016717 TAATCAAAACAGTATGGAACTGG - Intergenic
1003652036 6:7969680-7969702 CAAACAAAGCAGTTAGAATCTGG - Intronic
1004334135 6:14748731-14748753 AAAACCAAGCACAAAGGAAGAGG + Intergenic
1004876175 6:19957079-19957101 AATAGAAAGCAGTAAGGAGAGGG + Intergenic
1005385919 6:25284017-25284039 AAAACAAAACAGAACAGAACCGG - Intronic
1005410694 6:25542563-25542585 AAAACAAGTGAGTAGGGAACAGG - Intronic
1006619357 6:35352169-35352191 AAAACAAAACAAAAAAGAACTGG - Intronic
1006891749 6:37434616-37434638 AAAACAAAAAAGAAAGAAACAGG - Intronic
1007123354 6:39401787-39401809 AAAAACAAGAAATAAGGAACAGG - Intronic
1008211854 6:48734649-48734671 AAAAGAGAGCACTAAGGAAAGGG - Intergenic
1008486559 6:52042313-52042335 AATCCAAAGCATTAAGGAAAAGG + Intronic
1009553342 6:65128932-65128954 AAAAAAAACCAGCATGGAACTGG + Intronic
1009753526 6:67903919-67903941 CAAACAAAACAGTATGAAACTGG + Intergenic
1011743894 6:90390087-90390109 AAAACAAAACAGCAAAGAACAGG - Intergenic
1011792688 6:90915454-90915476 TACACAAAGCAGTAAGGCCCTGG - Intergenic
1012074870 6:94670869-94670891 AAACAAATGCAGGAAGGAACAGG + Intergenic
1012360136 6:98367185-98367207 AAAAAAAATCAGAAAGGAAAGGG + Intergenic
1012796055 6:103763039-103763061 CAATCAAAGCTCTAAGGAACTGG + Intergenic
1012900749 6:105003495-105003517 AAAAAAAATCAGTAAGGCACAGG - Intronic
1012928880 6:105296190-105296212 AAAAAAATACAGTAAGGAAATGG - Intronic
1012976149 6:105783154-105783176 AAAATAAATCAGTTAGAAACAGG + Intergenic
1013049966 6:106523373-106523395 AGAACAAAGTAGTAATGAATGGG - Intronic
1013252009 6:108343916-108343938 GAAAGAAAGCAAAAAGGAACAGG + Intronic
1013303332 6:108824350-108824372 AGGACAAAGCAGTATGGAGCAGG - Intergenic
1014016635 6:116538406-116538428 AAAAAAGAGCAGTAACCAACTGG - Intronic
1015296789 6:131603981-131604003 AAAATAAAGCAAAAAGGAATAGG - Intronic
1015329448 6:131960519-131960541 AAAACAAAACAGAAAAAAACAGG - Intergenic
1015354176 6:132257539-132257561 AAATCAAAGCACCAAAGAACAGG - Intergenic
1015446902 6:133316823-133316845 AACACAAGGCAGTTAGGAAGTGG - Intronic
1015723307 6:136269531-136269553 AAAAGAAAGAAGTAAAGAACGGG - Exonic
1015907836 6:138136072-138136094 AAAAGAAATCAATAAGAAACTGG - Intergenic
1015934077 6:138390826-138390848 AAAACAAAAAAGAAAGGAAGAGG + Intergenic
1016232945 6:141828281-141828303 GAAACAAGGTAGAAAGGAACCGG - Intergenic
1016270572 6:142283944-142283966 AAAAGAAAGCAGGAAAGAAGGGG - Intergenic
1016644147 6:146384919-146384941 AAAACATAGCAATAGGAAACAGG + Intronic
1017267030 6:152459330-152459352 AAAACAAAGCTGGAAGACACAGG - Intronic
1017456368 6:154604745-154604767 AAAACAAAACAGGAAAGATCTGG - Intergenic
1017702952 6:157093831-157093853 AAAATAAGGCAGGAAGGAAACGG - Intronic
1020038755 7:4985350-4985372 AAAGCAAATCAGGAAGGAGCAGG - Intronic
1021357477 7:19669556-19669578 AAAAAAAAGCAATAAAAAACGGG - Intergenic
1021893383 7:25209952-25209974 AAATCAAAACAGTAGGGTACTGG - Intergenic
1021964236 7:25901887-25901909 ATAATAAAGCACTAAGGAAATGG + Intergenic
1022001044 7:26226359-26226381 AAAACAAATTACTAAAGAACTGG + Intergenic
1022212781 7:28227773-28227795 AAAAGAAAGAAGGAAGGAAGGGG - Intergenic
1022420460 7:30216166-30216188 AAAGAAAAGAAGGAAGGAACAGG + Intergenic
1022742123 7:33132480-33132502 AAGACAAATCAGTGAGCAACTGG + Intronic
1022905985 7:34857490-34857512 ATTGCAAAGCAGTAAGGAAAGGG + Intronic
1023897890 7:44449472-44449494 AAGACAAAGAAGGAAGGCACAGG + Intronic
1024206598 7:47167785-47167807 CAAACAAAGCAGTAAGAAACAGG - Intergenic
1024446655 7:49487775-49487797 AAAACAAAACAAAAACGAACAGG + Intergenic
1024685922 7:51745002-51745024 TAAACAAAGGAAAAAGGAACTGG - Intergenic
1024728152 7:52223921-52223943 AAAACAATTCAGTTAGGAAATGG + Intergenic
1025996270 7:66529447-66529469 AAAAAAAAGCAGCAAGCAACAGG + Intergenic
1026366032 7:69649374-69649396 AACACAAAGCTGTATGTAACAGG - Intronic
1026407159 7:70078211-70078233 AAAAAAAAACAGTATGGAAAGGG - Intronic
1027057156 7:75057648-75057670 AAAGCAAGCCAGTAAGGACCGGG + Intronic
1027591622 7:80125977-80125999 AAAACAAAACAGAAAAAAACAGG - Intergenic
1028159080 7:87465393-87465415 TAAACAAAGCGGCCAGGAACTGG + Intronic
1028429495 7:90731111-90731133 AAAACAAAGCAATAGGAAAAGGG - Intronic
1028656461 7:93213722-93213744 AATATAAAGCAGTGAGGACCCGG + Intronic
1028758209 7:94463013-94463035 AAAACAAAACAGTTATGAATAGG + Intergenic
1029048218 7:97654288-97654310 GAAACAAAGAAGTTAAGAACAGG - Intergenic
1029163688 7:98570992-98571014 AGAACAGGGCAGTAAGGAAAGGG + Intergenic
1029351888 7:100019195-100019217 AAAAAAAATCACTCAGGAACGGG - Intronic
1030545637 7:110891781-110891803 TAAAGAAAGAAGTAATGAACTGG + Intronic
1030609930 7:111678357-111678379 GAAACAAAGAAATAAGGAACAGG + Intergenic
1030933754 7:115558165-115558187 AAAAAAAAGCAATAAGCAAGAGG - Intergenic
1030954453 7:115834666-115834688 AAAAGAAAGCAGGAAGAAAAAGG - Intergenic
1031666907 7:124495879-124495901 AAACCAAAGCAGCATGGTACTGG - Intergenic
1031694205 7:124829018-124829040 AAAACAAAATAGTAAGGCATAGG + Intronic
1032621971 7:133543594-133543616 AAAATAAAGCTTAAAGGAACTGG - Intronic
1032806945 7:135364592-135364614 AGAGAAAAGCAGTAATGAACAGG + Intronic
1032895842 7:136250000-136250022 AAAACAAAGCAGTGATGACAGGG - Intergenic
1032988324 7:137363060-137363082 ATAACAAAGCATTAAGAAAGTGG + Intergenic
1033520573 7:142156163-142156185 AAAACAAAGTACAAAGAAACAGG + Intronic
1033812705 7:145035070-145035092 TAACCAAAGCAGCATGGAACTGG - Intergenic
1033822338 7:145149403-145149425 AAAACAAAGGAGTGGGAAACTGG - Intergenic
1035089165 7:156291661-156291683 TAATCAAAGCAGTGAGGAATTGG - Intergenic
1035431246 7:158824073-158824095 AAAATAAAGCAGTAAATATCAGG - Intronic
1036020979 8:4846007-4846029 AAAACAAAGAAGTGAGAAAGTGG - Intronic
1036116310 8:5963945-5963967 AAAACAAAGAAGTGAAGAATTGG + Intergenic
1036400885 8:8406789-8406811 GATAGGAAGCAGTAAGGAACTGG + Intergenic
1038129131 8:24709571-24709593 AAAATAAAGTTGTAAGGAACTGG + Intergenic
1039001840 8:32989979-32990001 TAAACAAAGCAGCATGGTACTGG - Intergenic
1039421310 8:37444104-37444126 AACAAAAAGCAGTCAGAAACTGG + Intergenic
1039454734 8:37698955-37698977 AAAAAATAACAGAAAGGAACAGG - Exonic
1039776067 8:40738047-40738069 AAAGAAAAGCAGGAAGGGACGGG + Intronic
1040731412 8:50451780-50451802 AAAAAAATACAGAAAGGAACAGG + Intronic
1040738279 8:50538381-50538403 AAAATTAAGCAGAAAGGAAGCGG - Intronic
1040774610 8:51025552-51025574 TAAACAAAGCAGTATGGTCCAGG - Intergenic
1040812679 8:51473755-51473777 AAAAAAAAACAGTAAGTGACTGG + Intronic
1040957080 8:52990344-52990366 GAAACAAAGCAGATACGAACAGG + Intergenic
1041108386 8:54463316-54463338 AAAACAAATCAAAGAGGAACAGG - Intergenic
1041214258 8:55584080-55584102 AAAACAAAGCACTGAAGAAATGG - Intergenic
1041262220 8:56031486-56031508 TAATCAAAACAGTATGGAACTGG + Intergenic
1041276799 8:56168368-56168390 AAAAGAAAGCAAAAAGGGACTGG + Exonic
1041519042 8:58734386-58734408 AAAACAAAACAGTATGGTGCTGG - Intergenic
1041776092 8:61524366-61524388 AAAACAAAACAAAAAAGAACAGG + Intronic
1041891083 8:62869611-62869633 AAAACAAAGCAGGCAGAAAAAGG + Intronic
1042262861 8:66877562-66877584 AAATCAAAGCATTAAGCAATTGG + Intronic
1042345654 8:67724734-67724756 AAAAATAATCAGTAAGCAACGGG + Intronic
1043200190 8:77359648-77359670 AAAACATAGCAGTAGAGAATGGG - Intergenic
1044593723 8:93938852-93938874 AAAACAAAGAAGTAAGAACTTGG - Intergenic
1044747210 8:95382468-95382490 AAAACAAAGCAGTAAAGAGAAGG - Intergenic
1044818854 8:96141997-96142019 AAAACAAAGCAGTAATGTTGAGG - Intergenic
1045052357 8:98338706-98338728 AAAACAAAACACTAAAAAACAGG + Intergenic
1046023654 8:108696825-108696847 AAAACAAACTAGTAAATAACAGG + Intronic
1046255306 8:111689212-111689234 TAACCAAAGCAGCATGGAACTGG - Intergenic
1047909417 8:129511045-129511067 AAAGCAAAGCTGAAAGGAAAAGG - Intergenic
1048658316 8:136568272-136568294 TAAACAAAACAGTATGGTACTGG + Intergenic
1048757090 8:137751619-137751641 AAAACAAACCAATAAGGATTGGG - Intergenic
1049369474 8:142257021-142257043 AGAACAAAGCAGTTTGGAAGTGG - Intronic
1050071970 9:1824656-1824678 AAAACAAAGGAGTTTGGAAAGGG - Intergenic
1050089691 9:2005185-2005207 AAAAAAAAGAATTAAGGAAAAGG + Intergenic
1051485995 9:17608744-17608766 AAAACAAGGAAGTTATGAACCGG + Intronic
1052212675 9:25925638-25925660 AAATCAAAACAGTATGGTACCGG + Intergenic
1052537432 9:29764918-29764940 AAAACAAAAAAGAAATGAACAGG + Intergenic
1052741969 9:32402175-32402197 AAAAAAAAGAAGGAAGGAATGGG - Intronic
1053754162 9:41286217-41286239 TAAACACAGCAGTCAGGGACTGG + Intergenic
1054259680 9:62850571-62850593 TAAACACAGCAGTCAGGGACAGG + Intergenic
1054332090 9:63769455-63769477 TAAACACAGCAGTCAGGGACAGG - Intergenic
1054873278 9:70068738-70068760 AAAAAAAGGCAATAGGGAACAGG + Intronic
1055308919 9:74958113-74958135 AAAACAAAACATTGAGGAAAAGG - Intergenic
1056186437 9:84139740-84139762 AAAACAACGCGGTAAGGATTCGG - Intergenic
1056256771 9:84807387-84807409 AAAACAGAGAAGGAAGAAACTGG - Intronic
1057498218 9:95576752-95576774 AAAACAAAAAAGAAAGGAAGAGG + Intergenic
1058022627 9:100105313-100105335 AAAACAAAGTCGGAAGGAACAGG - Intronic
1058186634 9:101863270-101863292 AATGCAAAGCAGAAATGAACAGG - Intergenic
1058295928 9:103306522-103306544 AAATCAAAGCAGTATGGTTCTGG + Intergenic
1060297636 9:122353996-122354018 CAAAGTAAGCACTAAGGAACTGG + Intergenic
1062559568 9:137134961-137134983 AAAAAAATCCAGTCAGGAACAGG + Intergenic
1203544468 Un_KI270743v1:118762-118784 AATACAAGGCAGTTAGGGACTGG - Intergenic
1185860224 X:3571564-3571586 AACACAAATCAGTAGGCAACAGG - Intergenic
1185953360 X:4461048-4461070 AACACAGAGCAGCATGGAACAGG - Intergenic
1186576743 X:10774978-10775000 AAAACAAAGCATTCTAGAACTGG - Intronic
1187365979 X:18666249-18666271 AACACAAGGAAGTAGGGAACAGG + Intronic
1187683000 X:21786807-21786829 AAAACAAAACAGTAAGAGGCAGG + Intergenic
1187703411 X:21986365-21986387 AAAAAAAAAAAGTCAGGAACAGG + Intronic
1188115015 X:26232088-26232110 TGCACAAAGCAGTAAGGCACTGG + Intergenic
1188847000 X:35085055-35085077 TAAACAAACCAATAAGTAACTGG - Intergenic
1189282496 X:39828671-39828693 AAAAGAAAGAAGGAAAGAACAGG + Intergenic
1189573832 X:42328521-42328543 TAACCAAAGCAGTATGGTACTGG + Intergenic
1190585459 X:51935715-51935737 TAACCAAAGCAGTATGGTACTGG - Intergenic
1190715151 X:53096826-53096848 AAAAAAAAGCAGTAAAAAATGGG + Intergenic
1191067106 X:56360453-56360475 TAAACAAAACAGTATGGTACTGG + Intergenic
1191666068 X:63703998-63704020 AAAGCATAGCAGAAAGGAGCAGG + Intronic
1191896766 X:66000936-66000958 TAATCAAAGCAGGAAAGAACAGG + Intergenic
1192387350 X:70684916-70684938 TAATCAAAGCAGTATGGTACTGG + Intronic
1192732756 X:73817713-73817735 AAAAAAAAACAGCAAGGAAAAGG + Intergenic
1192747663 X:73955770-73955792 AAAACAAAGCAAAAATTAACTGG + Intergenic
1192827285 X:74710916-74710938 CAAAAAAAGCAGTAATAAACTGG + Intergenic
1192935258 X:75851956-75851978 AAAACAAAAGAGGAAAGAACTGG - Intergenic
1192943563 X:75939475-75939497 TAACCAAAGCAGCATGGAACTGG - Intergenic
1193632199 X:83903803-83903825 TAATCAAAGCAGCATGGAACTGG + Intergenic
1193727029 X:85053696-85053718 AAAATAAATCAGTTAGAAACAGG + Intronic
1193799360 X:85916065-85916087 TAACCAAAGCAGTATGGTACTGG + Intronic
1193915840 X:87362638-87362660 AAAACAAAACAGCATGGTACTGG + Intergenic
1193946241 X:87739162-87739184 AAAAAAAAACAGTGAGAAACAGG - Intergenic
1193981074 X:88182487-88182509 AAAACAAAAAAGAAACGAACAGG - Intergenic
1194071417 X:89329922-89329944 AAAACAAAGAAGGAAGAGACTGG - Intergenic
1194376530 X:93140866-93140888 AAAAGAAGGCAGTAATGAAGGGG - Intergenic
1194614217 X:96081487-96081509 AAAACAAATCAGCATGGTACTGG + Intergenic
1195564906 X:106329583-106329605 AAAAAAAAGAAGTGAGGAAGAGG + Intergenic
1195662589 X:107394896-107394918 TAAACAAAGCAGCATGGTACTGG - Intergenic
1196343677 X:114626406-114626428 AAAAGAAAGAAATATGGAACTGG + Intronic
1196768382 X:119270282-119270304 AAAAGAACTCAGTAAGGATCAGG - Intergenic
1197290584 X:124652200-124652222 AAAGCAAAGAAGTAAGAAATAGG - Intronic
1198005344 X:132488614-132488636 AAAAGAAAGAAGGAAGGAAGGGG + Intronic
1198864305 X:141105195-141105217 AAAAGAAAGCAGAGAGGAAAGGG - Intergenic
1198898384 X:141482221-141482243 AAAAGAAAGCAGAGAGGAAAGGG + Intergenic
1199825695 X:151497728-151497750 AAAACAAAAGGGTAAGGAAGAGG + Intergenic
1200725648 Y:6665653-6665675 AAAACAAAGAAGGAAGAGACTGG - Intergenic
1201380377 Y:13370225-13370247 TAAACAATGCAGTAAGAAAGTGG + Intronic
1201670453 Y:16514691-16514713 AAAAAAAAAAAGGAAGGAACAGG - Intergenic
1201973173 Y:19817746-19817768 AAAAGAAAGCAGAAACGAAAGGG + Intergenic