ID: 1178149665

View in Genome Browser
Species Human (GRCh38)
Location 21:29779842-29779864
Sequence CAAAATGTAGATAGTGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 2, 3: 70, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178149665 Original CRISPR CAAAATGTAGATAGTGAGAT TGG Intronic
905518279 1:38578203-38578225 CAGGATGGAGAAAGTGAGATTGG + Intergenic
905893413 1:41530835-41530857 CCAAATGGAGAGAGAGAGATAGG + Intronic
907097547 1:51795505-51795527 CAGAATGAAGATAGAGAGAAAGG + Intronic
907158476 1:52355029-52355051 CAAAATGCAGGTGGAGAGATTGG - Intronic
907755935 1:57310835-57310857 GAAAATACAGATAGAGAGATGGG + Intronic
908491719 1:64651032-64651054 GAAAATGTAGAAAGAGAGGTGGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
910196023 1:84640387-84640409 CAAACTTTTGATAGTGAAATGGG - Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
913306535 1:117433498-117433520 CTAAATGTAAATAGTGAAAATGG - Intronic
913665101 1:121040934-121040956 CAAGATGTTGATAGTGAGGGAGG + Intergenic
914016493 1:143824208-143824230 CAAGATGTTGATAGTGAGGGAGG + Intergenic
914161290 1:145136793-145136815 CAAGATGTTGATAGTGAGGGAGG - Intergenic
914655110 1:149732748-149732770 CAAGATGTTGATAGTGAGGGAGG + Intergenic
915440750 1:155944142-155944164 TAAAATGGAGACAGAGAGATGGG + Intergenic
915730560 1:158050911-158050933 TAAAGTGTAGATAGTGAGACCGG - Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
916578438 1:166087356-166087378 CAAAATGGAGATGGTGGGCTGGG - Intronic
917661034 1:177177062-177177084 CAATATGTTGATAGTGTGGTGGG + Intronic
917688671 1:177444937-177444959 CCACAAGGAGATAGTGAGATTGG + Intergenic
918201408 1:182270520-182270542 CAAAAAGTAAATTGTGAGTTAGG + Intergenic
918552653 1:185761206-185761228 CAAAAAGGAGATGGTGAAATGGG + Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920792598 1:209107172-209107194 CAACATGGAGATAGATAGATAGG - Intergenic
921105611 1:211974469-211974491 AAAATTGTATATATTGAGATGGG - Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921722559 1:218489372-218489394 CAAAATGTAGATAGAGTAATAGG + Intergenic
921774903 1:219086098-219086120 TAAAATGTAGAAAGTGAAGTAGG - Intergenic
922597061 1:226822220-226822242 CACACTTTAGATACTGAGATGGG + Intergenic
924053010 1:240096078-240096100 GAAAATGTAGATAGAGAAAGAGG + Intronic
924426643 1:243957213-243957235 GAAAGTGTGGACAGTGAGATTGG + Intergenic
924837312 1:247664091-247664113 CAAAATGTGGAAAGTAAGAAAGG - Intergenic
1062876437 10:946615-946637 CAAAATTTAGAGAGAGAGAGGGG - Intergenic
1063853154 10:10216165-10216187 CAATATGTATATATTGACATCGG - Intergenic
1065400847 10:25299407-25299429 GGAAATGTAGTTAATGAGATGGG - Intronic
1065757680 10:28948714-28948736 CAAAAAGTAGATACTTTGATTGG - Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066644914 10:37596599-37596621 TTAAATGTAGATCTTGAGATGGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1071849420 10:89553346-89553368 CAAAATGTTGATTGTCAGAGAGG - Intronic
1071924188 10:90386739-90386761 CAAAATGAAGTTAGTGACAGTGG + Intergenic
1072090074 10:92118815-92118837 CCAACTGTAGATAGTGACGTGGG - Intronic
1072691172 10:97573074-97573096 CAAAATTAAGTCAGTGAGATGGG + Intronic
1072774199 10:98173136-98173158 GAAAATGTAGATGGGGAAATGGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073298804 10:102458084-102458106 CAAGATGTCAATAGTGTGATAGG - Intergenic
1073386958 10:103133805-103133827 AAAAATATTGATAGTGACATGGG + Intronic
1073398833 10:103240470-103240492 CAAAATGCAGGAAGTGAGAAAGG + Intergenic
1073738142 10:106373664-106373686 AAAAATGTAGAAATTGGGATGGG + Intergenic
1073920251 10:108450275-108450297 CAAAATGTACTAAGTGAGAAAGG + Intergenic
1074153205 10:110776879-110776901 GAAATTGTAGATAGTGACCTAGG + Intronic
1074918154 10:117979165-117979187 CAGAATGTTGATAGTGGGGTAGG + Intergenic
1075370789 10:121933125-121933147 TAAAATGTAGCTAGTGTGACTGG + Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078886691 11:15507382-15507404 CTAAATGTATATGGTGATATGGG - Intergenic
1079084560 11:17435999-17436021 CCAACTGTAGATAGTGATGTGGG + Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1080373418 11:31678955-31678977 TAAAATGTAGAAAATGAGAGTGG + Intronic
1081199154 11:40195421-40195443 CAAAATGTAGGGGTTGAGATTGG + Intronic
1081957774 11:47108474-47108496 CAAAAACTAAATAGTGAGAAGGG + Intronic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083206863 11:61156265-61156287 TAAAATGCAGCTTGTGAGATTGG + Intronic
1084913023 11:72406579-72406601 CAAAATGATGGAAGTGAGATAGG - Intronic
1085862316 11:80248730-80248752 TAAAATGGAGATAGAGAGAATGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088119260 11:106348995-106349017 GAAAAGGCAGATAATGAGATTGG + Intergenic
1091669789 12:2444828-2444850 CAAAGTAGAGATAGTGGGATTGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094245366 12:28285504-28285526 CAAAAGGTACATAATGAGCTTGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094435412 12:30415620-30415642 CATAATCAAGACAGTGAGATAGG - Intergenic
1094554197 12:31482036-31482058 CAAAATCTTGATGGTGGGATAGG + Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1098226095 12:68326652-68326674 GAAAATGTAGATAATGGGGTAGG - Exonic
1098305714 12:69100530-69100552 AAAAATGTAGACACTGATATGGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099510167 12:83525128-83525150 CAAAATGCAAATAGAGAAATTGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100332722 12:93600048-93600070 CAAAATGTAAAGAATAAGATTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104339553 12:127935211-127935233 CAAAATCTAGTTCATGAGATGGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107378300 13:39828576-39828598 CAAAATGAAGGAGGTGAGATTGG + Intergenic
1107696025 13:43001110-43001132 CACAATGTAGCCAGTGAGAAGGG + Intergenic
1107776181 13:43845351-43845373 AAATATGTAGATAAAGAGATGGG - Intronic
1108191570 13:47945702-47945724 GAAACTGTAGAAAGTGAAATTGG - Intronic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109656579 13:65399163-65399185 CAAAATGCAGAGAGTGTGAAAGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110800001 13:79683784-79683806 CATAATGTAGATCATGAGTTTGG + Intergenic
1110803567 13:79728703-79728725 AAAAATGTTGGTAGTGTGATAGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1114279852 14:21182596-21182618 GAAAATGTACCTAGTGAAATGGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114495547 14:23129241-23129263 TAAAATGTAGATGGGCAGATGGG + Intronic
1114913923 14:27237590-27237612 GAAAATGCAGATAGGGAAATAGG - Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115015253 14:28603569-28603591 CTAAATATAGATAAGGAGATAGG + Intergenic
1115290101 14:31760990-31761012 TAAAATGTAAAAAGTAAGATGGG - Intronic
1115813321 14:37134113-37134135 CAAAATGGAGAGAGGGAGGTGGG + Intronic
1116625346 14:47255984-47256006 CTAAATGTAGAGAGTGGGGTAGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1119394662 14:74317504-74317526 CAAAATGTCAATAGTGAGCCAGG + Intronic
1120550085 14:85859664-85859686 CAAAATAAAGAAAGGGAGATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121761270 14:96447046-96447068 GCAAATGCAGATAGTGAGTTTGG - Intronic
1121987842 14:98525720-98525742 GAAAATGTTTATAGGGAGATTGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123574089 15:21648422-21648444 AAAAATGTAGATATTAAGAGGGG - Intergenic
1123610705 15:22091007-22091029 AAAAATGTAGATATTAAGAGGGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1126466452 15:48965240-48965262 CCACATGTACTTAGTGAGATGGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126847427 15:52773906-52773928 CAACATATAGATAGAGAGAGAGG - Intronic
1127720880 15:61698121-61698143 CAAAATGAAGAAAATGAGACTGG + Intergenic
1127876011 15:63112018-63112040 CAAAATGGAGATAGTGATGCAGG - Intergenic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1128726775 15:69993861-69993883 CAAAATCTAGATGGAGGGATGGG - Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1202982954 15_KI270727v1_random:382768-382790 AAAAATGTAGATATTAAGAGGGG - Intergenic
1133838031 16:9383855-9383877 CAAAATGGAGTTAGGAAGATGGG - Intergenic
1133967713 16:10543669-10543691 CAAAATGGAAATAGAGAGAAAGG + Intronic
1134490679 16:14693600-14693622 CAAAGGATGGATAGTGAGATAGG + Intronic
1134496060 16:14732723-14732745 CAAAGGATGGATAGTGAGATAGG + Intronic
1136154742 16:28375077-28375099 CAAATGATGGATAGTGAGATAGG - Intergenic
1136208350 16:28740181-28740203 CAAATGATGGATAGTGAGATAGG + Intergenic
1136597347 16:31260431-31260453 CAAAGTGGAGATGGTGAGAGGGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1136939441 16:34508265-34508287 CAAAGTGGAGCTGGTGAGATTGG + Intergenic
1136960380 16:34840296-34840318 CAAAGTGGAGCTGGTGAGATTGG - Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140016349 16:71190211-71190233 CAAAATGTATACAGTGAACTTGG + Intronic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1148802444 17:50239654-50239676 GACAATGTAGACAGAGAGATGGG - Intergenic
1153176870 18:2385054-2385076 CAAAATATAGATAATTATATGGG + Intergenic
1154347788 18:13557892-13557914 CAAAGTGAAAATAATGAGATTGG - Intronic
1155382780 18:25242758-25242780 CAAAATGGAGAGAGTGGGAGAGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156659413 18:39329112-39329134 ACAAATGTATATTGTGAGATTGG - Intergenic
1156780083 18:40840256-40840278 GAAAATGCAGATAGTAAAATGGG - Intergenic
1156799567 18:41093072-41093094 TAAAATGGGGATAGTGAGAATGG - Intergenic
1159239576 18:65724517-65724539 CTAAATTTAGATAGTGTGATGGG + Intergenic
1160933131 19:1580142-1580164 CGAAATGAAGATGGTGAAATAGG - Intronic
1161435140 19:4258548-4258570 CACAAGGGAGAAAGTGAGATGGG - Intronic
1168391070 19:56008356-56008378 CAAAAAGTAGATTGGGGGATGGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
927222197 2:20723304-20723326 GAAAATGGAGTAAGTGAGATGGG + Intronic
928346613 2:30503325-30503347 ATAAATGTTCATAGTGAGATAGG - Intronic
928794601 2:35001552-35001574 CAAAATATAGAAAGCAAGATTGG + Intergenic
928824566 2:35404422-35404444 CAAAGTCTAGATAGATAGATGGG + Intergenic
928961076 2:36926650-36926672 CAAAATGTAGGTAGTTTGTTAGG + Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
932140323 2:69271472-69271494 CAAAATGTGGCTAGTGTGACTGG - Intergenic
932328695 2:70883671-70883693 CACAATGTAGATAGTTACCTAGG + Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933987569 2:87604576-87604598 CAAAATGTACACAGTGAAACCGG - Intergenic
934762333 2:96863618-96863640 CCAGATGGAGAGAGTGAGATGGG + Intronic
934968194 2:98741561-98741583 ATAAATGTGGCTAGTGAGATAGG - Intergenic
935231156 2:101097679-101097701 AAAAATGTAAAAAGTGAGATGGG - Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
936306271 2:111346232-111346254 CAAAATGTACACAGTGAAACCGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938440336 2:131325237-131325259 TCAAATCTAGATAGTGAAATTGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941092922 2:161198813-161198835 CTAAAAGTAGATAATTAGATTGG + Intronic
941292857 2:163697908-163697930 GACAATGAAGATAGAGAGATTGG - Intronic
941340619 2:164299550-164299572 AAAAATGTAGAGAGTGAGTTAGG - Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941614735 2:167706544-167706566 CTCAATGGTGATAGTGAGATGGG + Intergenic
943644314 2:190392293-190392315 CAAAATGTCAATAGTGATAAAGG - Intergenic
943673793 2:190696508-190696530 AAAAATTTGTATAGTGAGATAGG + Intergenic
943698990 2:190969480-190969502 CAAAAAGTAGATTAAGAGATGGG - Exonic
943968039 2:194363624-194363646 CACATTGTAGATGGTTAGATAGG - Intergenic
944140293 2:196448903-196448925 CAAAAAATGGATAGTGAGAGAGG - Intronic
944711008 2:202335276-202335298 AAAAATGTATATAGTGACGTGGG - Intergenic
945475533 2:210277493-210277515 CAAAAAGTAGAGAGTTAGATTGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945751730 2:213794568-213794590 CCAAAGGCAGATATTGAGATGGG + Intronic
946829531 2:223713817-223713839 CAAGATTTACATAGTGATATAGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948330939 2:237164708-237164730 AAAATTGTTGAAAGTGAGATTGG + Intergenic
1169872942 20:10266757-10266779 CAAAATGTAAAGAGTGAAAATGG + Intronic
1170046231 20:12088363-12088385 CAAAATGTTGGTTGTGAGAAAGG - Intergenic
1170311658 20:14998677-14998699 GAAAAGGTAGAGAGTAAGATTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1173211094 20:41032359-41032381 TAAAATGTTGACAGTGAGTTAGG + Intronic
1175013340 20:55762582-55762604 CAAAATATAGTAAGAGAGATTGG + Intergenic
1175112462 20:56658217-56658239 CAAAATGAAGATGGTGATAATGG + Intergenic
1175589436 20:60176780-60176802 AAAAAGGTAGATTGAGAGATGGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177244837 21:18509920-18509942 CAATATGTTGACAGTGAAATGGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177398722 21:20573113-20573135 CAAAAGATAAATAGTGAGTTAGG - Intergenic
1177605689 21:23375309-23375331 AAAAATGTTCATAGTGAGTTGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1178806453 21:35843735-35843757 TAAAATGTAGCTAGTGATCTTGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
949656532 3:6227173-6227195 CAAAATGTATGTGTTGAGATGGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951566051 3:24013552-24013574 CAAAATTTAAAAAGTGAAATAGG + Intergenic
951750484 3:26029054-26029076 TAAAATGTAGGTAGGTAGATAGG - Intergenic
956276057 3:67502322-67502344 AACATTGTAGATAGTAAGATAGG - Intronic
956340416 3:68216840-68216862 CAAAATGAATAAAGTGATATGGG + Intronic
956696376 3:71922427-71922449 AAAAATGTAGGTAGTTAGGTAGG + Intergenic
957206396 3:77204824-77204846 TAAAATTTAGGTAGGGAGATAGG + Intronic
957388497 3:79530452-79530474 CAAAATGTACATTGAGAGAAAGG + Intronic
957556988 3:81774709-81774731 CAAAATGAAGAAACTGACATTGG - Intergenic
957816596 3:85307881-85307903 CAAAATGAAGATATTAAAATAGG + Intronic
958113833 3:89188567-89188589 CAATATGTAGATGGTGATATTGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958457964 3:94356987-94357009 GAAAATGTAGAAAGTGAGGAAGG + Intergenic
958583342 3:96053796-96053818 AAAAATGTGGATAGTGATGTGGG - Intergenic
958901131 3:99887738-99887760 TATGATGTAGATATTGAGATAGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
962123390 3:132588112-132588134 CAAAATTTGGAAAGTGAGATGGG - Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963078371 3:141368654-141368676 CAAAATGTAGGAAGTCAGAATGG + Intronic
963344853 3:144083244-144083266 CAAAATGTATATAAAGACATAGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963973941 3:151460226-151460248 GAAAATGTACATAATGAAATAGG + Intergenic
964276587 3:155014952-155014974 CAAAAGGTATAAAGTGAAATGGG + Intergenic
964398267 3:156271280-156271302 TAAAAAGGAGATAGAGAGATAGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965178589 3:165368933-165368955 CTACATGTGGATATTGAGATTGG - Intergenic
965227053 3:166003006-166003028 AAAAATGTAAAAAGTGAGACTGG - Intergenic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965854177 3:173067663-173067685 GAAGATGTAGAGAGGGAGATAGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967379732 3:188843915-188843937 CAAAGTGTAGAGTGTGAGAGAGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970118272 4:12723625-12723647 GAAAATGCAGAGAATGAGATGGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970469742 4:16365494-16365516 CAAAACGTAGAAAAGGAGATGGG + Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971886500 4:32456312-32456334 CAAAAAGTAGTTGGTGAGGTGGG - Intergenic
971982507 4:33771111-33771133 AAAAATGTAGGTGGTGAAATAGG - Intergenic
972426760 4:38940642-38940664 CAAAATTTACATAGTGAAAAAGG + Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973204185 4:47541872-47541894 CTGAAGGTAGATATTGAGATAGG - Intronic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974085990 4:57262081-57262103 AAAAATGTAGCTAGAGAGAAAGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975090056 4:70390790-70390812 TAAAATGTAGAAAGAGAGACTGG + Intergenic
975620503 4:76291538-76291560 AAAAAAGTAGATATTGATATTGG - Intronic
975969545 4:80016884-80016906 CAAATTGGAGATGGTGAGAAGGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977734327 4:100394664-100394686 CAAACTGTTTACAGTGAGATAGG + Intergenic
979931801 4:126641091-126641113 AAGAAAGTAGATAGTAAGATGGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
981848306 4:149195844-149195866 GAAAATATAGCTAGTGAGAGAGG - Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983416715 4:167465935-167465957 CAATATGAATATAGTGATATTGG - Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984042398 4:174751140-174751162 AAAAATGTAGATAGATAGGTAGG - Intronic
984213292 4:176877074-176877096 GAAAATGTTCTTAGTGAGATGGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988464747 5:31477807-31477829 CCAAAGGTAGAGAGTGGGATAGG + Intronic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990350695 5:54912676-54912698 CAAAAAGAAGTTACTGAGATTGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991154861 5:63421055-63421077 AAAAATGTAGGTAGATAGATTGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992226002 5:74620352-74620374 CTACATGGAGATAGTGAGACAGG + Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994151906 5:96457311-96457333 CAAAGGGTAGAAAGAGAGATAGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994800996 5:104375453-104375475 CAAAATGGAAATAGTGAAAGAGG + Intergenic
995591386 5:113703947-113703969 CAAAATGAAGATATTGAAATGGG - Intergenic
996660865 5:126000963-126000985 CAAACTGTAGATTTTAAGATTGG + Intergenic
997898631 5:137742758-137742780 TAAAATGGAGACAGTAAGATAGG - Intergenic
999698432 5:154206632-154206654 CAAAGTGTACATGGTGGGATTGG + Intronic
1000077221 5:157802265-157802287 TAAAATGTAGACAGTAAGATGGG - Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000998366 5:167981448-167981470 CCAAATGTAGATAGGGTAATAGG + Intronic
1002855464 6:1034034-1034056 CTAAATGTACAATGTGAGATTGG + Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1005265193 6:24104987-24105009 CAAACTGTAGACAGTGAAACCGG - Intergenic
1005363745 6:25056794-25056816 CAAAATGTGCTTAGTGAGAGTGG + Intergenic
1005402361 6:25447983-25448005 CAAAATGTATATGGAGAGGTGGG - Intronic
1006003626 6:30986058-30986080 CAAAATGTTGATACTGGGCTGGG - Intronic
1007055543 6:38880429-38880451 CAAAATCTAGCCAGTGCGATGGG + Intronic
1007545298 6:42688888-42688910 AAGAATTTAGATAGTGATATAGG + Intronic
1007707559 6:43799995-43800017 GAAAATGGAGATGGTGAGAGAGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1008799821 6:55352987-55353009 CAAACAGTAGATACTGAGAGAGG + Intronic
1009603142 6:65829464-65829486 CAAAATGAAGAAAGTAACATTGG - Intergenic
1010396149 6:75394489-75394511 CAAAATAAAAATAATGAGATAGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010811445 6:80304586-80304608 CAAAATTTATAAAATGAGATGGG - Intronic
1011838340 6:91462699-91462721 CAAAATATAGATGATGCGATTGG + Intergenic
1011895451 6:92218830-92218852 TAAAATGTAGCTAGTGATACAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012848413 6:104418628-104418650 CAAAATGGAGAAAGTGAGTAAGG - Intergenic
1013863756 6:114668496-114668518 CAGAATGTTGATAGTGGGAGAGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014908047 6:127054695-127054717 CAAAATGAAGTTTGTGAAATAGG + Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015295537 6:131587489-131587511 AAAAATATAGATAGGGAGATGGG + Exonic
1016299790 6:142617875-142617897 CAAAATGTAGAGAGGGAAGTAGG + Intergenic
1016321299 6:142849034-142849056 CAAATTATAGATATTGAAATAGG - Intronic
1016582393 6:145643942-145643964 TAAGATGTAGATAGTGACGTAGG + Intronic
1017297036 6:152809631-152809653 CAAAATTTAGATAATGAGCTAGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021322025 7:19224069-19224091 CAAAATGTAGATATGGACAACGG - Intergenic
1023499059 7:40828929-40828951 TGAAATGAATATAGTGAGATGGG + Intronic
1023522910 7:41066746-41066768 CATATTATAGAAAGTGAGATGGG - Intergenic
1024425620 7:49222779-49222801 AATAAAGAAGATAGTGAGATAGG + Intergenic
1024922255 7:54571256-54571278 CAAAATTTAGGTCATGAGATTGG + Intergenic
1026582867 7:71632645-71632667 CAGAATGTAGCAAGTGAGAAGGG + Intronic
1026805301 7:73425611-73425633 AAAAATATATATAGAGAGATAGG + Intergenic
1027748738 7:82113461-82113483 AAAAATGGAGATTTTGAGATGGG + Intronic
1028166269 7:87541324-87541346 CAAAATGAATATAGTGAAAATGG + Intronic
1028895240 7:96033711-96033733 CAAAATGTACATAAGGAGACAGG + Intronic
1029011681 7:97268679-97268701 GAAAATGAAGATAATGAGAGGGG + Intergenic
1029997673 7:105024058-105024080 CAAAATGTTGGTAGTGAATTTGG + Intronic
1030276725 7:107728961-107728983 CAAAATATATATAGGTAGATAGG - Intergenic
1030419314 7:109287666-109287688 GATAATTTAGATAATGAGATTGG - Intergenic
1030619218 7:111771192-111771214 GAAAATGTGGATAGAGAGCTTGG - Intronic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032375088 7:131406056-131406078 CAAAATGTATAAAGTAAAATTGG - Intronic
1032553446 7:132806992-132807014 CAAAATGAGGCTGGTGAGATGGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034566165 7:151917454-151917476 CAAAAAGTAAAAAGAGAGATTGG - Intergenic
1035859724 8:3014754-3014776 CAAATTGTAAATAGTTAGCTGGG + Intronic
1036055988 8:5254297-5254319 CAAAATTTGGATTGTTAGATGGG - Intergenic
1036415546 8:8544435-8544457 CAAAACTTAAATAGAGAGATGGG - Intergenic
1036579500 8:10060738-10060760 CAAAATTTAGAGAGTGAAATCGG + Intronic
1037092589 8:14941188-14941210 CAAAATGTAGAAAGTTATATTGG - Intronic
1037160445 8:15764944-15764966 CAAAATGGATATAGTGGGTTAGG - Intronic
1037197866 8:16214016-16214038 CAAAAAATAGATAGTGAAATTGG - Intronic
1040667195 8:49648732-49648754 CAAAATGTATATATTGACTTTGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044421380 8:91999782-91999804 CAAATAGTAGATACTGAGTTAGG + Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045895755 8:107214595-107214617 GAAAAAGTAGAAAGTAAGATTGG - Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046722125 8:117632238-117632260 TAAAATATAGATTGTGAGAACGG + Intergenic
1047573360 8:126126795-126126817 TAAAATAGAGATAGTGAGAGTGG - Intergenic
1048496341 8:134939199-134939221 CAAATAGAAGATAGTGGGATGGG - Intergenic
1048569388 8:135638982-135639004 AAAGAAGTAGCTAGTGAGATAGG + Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1049054299 8:140222930-140222952 CAAATGGTAGAAAGTGAGGTTGG + Intronic
1049291007 8:141801902-141801924 CAAAATGTAAATAGGCACATAGG + Intergenic
1050039534 9:1474743-1474765 CAAAATGTAAACAGAGAGAGGGG + Intergenic
1050104769 9:2154142-2154164 CAAAATGCAGAGAGTAAGAGTGG + Intronic
1050305799 9:4305016-4305038 AAAAATGTAGATCATGAGCTTGG - Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1055989750 9:82092632-82092654 GAAAATTTAGATAGTAAGAAAGG + Intergenic
1056904546 9:90633854-90633876 TAAAACGTAGAAACTGAGATAGG + Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057438149 9:95061438-95061460 CAAAATGCAGAAAGTAAGTTTGG + Intronic
1058227524 9:102383684-102383706 CAGAAAGAAGATATTGAGATAGG - Intergenic
1058779687 9:108320420-108320442 CAAAATGAAGATAGCTATATTGG + Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186205563 X:7196741-7196763 CAAAATACAGATAGAGAGACAGG - Intergenic
1186323518 X:8454582-8454604 CAAAATGAAGATATTAACATTGG - Intergenic
1186343414 X:8666751-8666773 CAAAATGTGGACATTGACATCGG + Intronic
1187738714 X:22331488-22331510 CAATATGTAGTAAGTGACATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189974703 X:46449158-46449180 CAAAATGCAAATTGTGAGAAAGG + Intronic
1190619668 X:52272932-52272954 CAAAATGTCTATAGTTAAATTGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1191979034 X:66905336-66905358 CAATGTGTAGATAATGAGTTGGG - Intergenic
1192350664 X:70353908-70353930 CAAAATGTATATAGTATAATGGG + Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192960010 X:76119420-76119442 TAAAATGGAGATGGTGAGGTAGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193568759 X:83114609-83114631 GAAAATGGAGAGAGTGAGAAAGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194093148 X:89602742-89602764 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1194190546 X:90831055-90831077 TAAAATGTAGATGGTGATACTGG + Intergenic
1194241014 X:91448470-91448492 CAACATTAAGATAGTAAGATAGG - Intergenic
1194270731 X:91811427-91811449 TAAAATGTTAACAGTGAGATTGG + Intronic
1195622935 X:106975999-106976021 AAAAATGTCGAGAGGGAGATGGG - Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1200437487 Y:3169389-3169411 CAAAATGTACAAAGCAAGATTGG + Intergenic
1200445779 Y:3258845-3258867 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1200537206 Y:4413479-4413501 TAAAATGTAGATGGTGATACTGG + Intergenic
1200587964 Y:5032860-5032882 TAAAATGTTAACAGTGAGATTGG + Intronic
1200677416 Y:6166302-6166324 CAGGATGTTGATAGTGAGAGAGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201918750 Y:19211036-19211058 CAAAGGGTACATAGAGAGATTGG + Intergenic
1201940628 Y:19455162-19455184 CAGAAGGTAAAGAGTGAGATGGG + Intergenic