ID: 1178155518

View in Genome Browser
Species Human (GRCh38)
Location 21:29849320-29849342
Sequence AACAATATTAAGTTATTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178155518 Original CRISPR AACAATATTAAGTTATTGCC AGG Intronic
905071626 1:35230897-35230919 AAAAATATTATGTCAATGCCTGG + Intergenic
906604901 1:47161648-47161670 AACCATGTAAAGTTTTTGCCTGG + Intergenic
907878129 1:58515181-58515203 AGCAATTTTAAATTATTTCCTGG - Intronic
908120312 1:60980082-60980104 AAAAATATTAAGTTTAGGCCGGG - Intronic
908126921 1:61041565-61041587 AGAAATATTAAATTATTGGCCGG + Intronic
908288713 1:62639723-62639745 AATATTATAAAGTTATTGGCCGG - Intronic
908497519 1:64709496-64709518 AACAATTTTAAATGATTGCAAGG - Intergenic
909132311 1:71753171-71753193 AAGAAAATTAATATATTGCCTGG + Intronic
909895016 1:81057946-81057968 AACTATATGAAGATATTTCCAGG - Intergenic
916322452 1:163520098-163520120 AAAAAAATTAAATTATGGCCGGG - Intergenic
916764088 1:167843616-167843638 AACCATTTTAAGTTCTTCCCAGG - Intronic
917553110 1:176056656-176056678 AAAAATATTTTCTTATTGCCAGG + Intronic
918686798 1:187427297-187427319 AACAGTACCAAGTCATTGCCTGG - Intergenic
919148275 1:193662463-193662485 AACTATATCAAGTCTTTGCCAGG + Intergenic
919394496 1:197027665-197027687 AACAATATTAAATTATTAACAGG + Intergenic
921274351 1:213504097-213504119 CATAATATTATGTTAATGCCAGG + Intergenic
922625617 1:227038496-227038518 AACAAGATTAATTTTTTCCCTGG - Intronic
923395903 1:233562489-233562511 AGCAATATTGTGTTATTGGCTGG - Intergenic
923717042 1:236433912-236433934 AACAATATCAAATTATTTGCAGG - Intronic
924899004 1:248374110-248374132 AGCAATATAAAGTTAAGGCCAGG + Intergenic
1064525891 10:16256276-16256298 AACAAGATTATGTTATTAGCTGG - Intergenic
1064882379 10:20070541-20070563 AACAAAATTAATTAAATGCCTGG - Intronic
1066217969 10:33306507-33306529 TACCATATTAAGTCGTTGCCTGG - Intronic
1066492262 10:35905156-35905178 AATCATATTATGTTATTGACTGG + Intergenic
1067112847 10:43412730-43412752 AAAACTATTAAGTTTTTGGCTGG - Intergenic
1067986640 10:51154717-51154739 AACAATATAAAATTCTTCCCAGG + Intronic
1068447804 10:57146048-57146070 AAAAATATAAAGTTAAAGCCAGG - Intergenic
1070062401 10:72996913-72996935 AATAATATTCCATTATTGCCCGG + Intergenic
1071123862 10:82312081-82312103 ACCAATATTTAGTGAGTGCCTGG - Intronic
1075329678 10:121564486-121564508 AACAAGAGTAAGTAACTGCCCGG - Exonic
1075529302 10:123214222-123214244 AAAAATATCAAGCTATGGCCAGG - Intergenic
1077512018 11:2971683-2971705 AAAAATATTAAATGATTCCCTGG + Intronic
1077729553 11:4715210-4715232 AACAAAATTAAGTTACTGGAAGG - Intronic
1079122202 11:17694260-17694282 AACATTATCAAGGTATTCCCAGG + Intergenic
1080721136 11:34849687-34849709 CATAATATTAAGCTATTACCTGG + Intergenic
1082044815 11:47716218-47716240 AACCATATTACATCATTGCCAGG + Intergenic
1085860166 11:80223862-80223884 AAGAATATTAAGTTATCATCTGG + Intergenic
1086094283 11:83035021-83035043 AAAAATATTAGCTTAGTGCCTGG - Intronic
1086254918 11:84864254-84864276 AACATTAATAAATTCTTGCCTGG - Intronic
1086838347 11:91653685-91653707 AGCAATATTAAGTTAAAACCAGG + Intergenic
1087457698 11:98408048-98408070 AAAAATATTTAGGTATGGCCGGG + Intergenic
1087503169 11:98985574-98985596 AACAATGTTAAGTTCTTATCAGG + Intergenic
1088021379 11:105124031-105124053 AACAATATTAATTTATTACATGG + Intergenic
1088863669 11:113825803-113825825 AAAAACATTAAGTGGTTGCCAGG + Intronic
1090324237 11:125870993-125871015 AACAATAATATTTTATGGCCGGG + Intergenic
1091580767 12:1787461-1787483 TACAATGGTATGTTATTGCCAGG + Exonic
1092507351 12:9117226-9117248 AACAATATTAAGGTATTCAGAGG + Intergenic
1093362130 12:18242330-18242352 AACAATAATAAACTATTGCTTGG - Intronic
1096024080 12:48346197-48346219 AAAAATATAAAGATATGGCCAGG - Intronic
1097047284 12:56196525-56196547 GATAATACTAAGTTATTGCTGGG - Intergenic
1097327514 12:58295196-58295218 AAGAATATTAAGTTATTGAGTGG + Intergenic
1099232436 12:80042795-80042817 AACAATACTAAGATATTATCTGG - Intergenic
1099403258 12:82226148-82226170 AACAATATGAAGTTAATTGCTGG - Intronic
1099698293 12:86050246-86050268 AACAGTATAAATTCATTGCCTGG + Intronic
1100093068 12:90995598-90995620 TACAATATTACCTTATTTCCAGG + Intronic
1102898318 12:116616279-116616301 AACAATAGTAATTGATTGCTGGG - Intergenic
1103189137 12:118985694-118985716 AAGAGAATTAAGTTAATGCCAGG - Intronic
1103394304 12:120596293-120596315 AAAAAAATTGAGTTATGGCCGGG + Intergenic
1103576400 12:121880785-121880807 AACAATAATAAGATACTGCCTGG - Intergenic
1105585063 13:21736108-21736130 AACAAAAGTAGGTTATTGACTGG - Intergenic
1105729570 13:23199498-23199520 CACTATATTAAATTTTTGCCAGG - Intronic
1106866161 13:33966521-33966543 AACAATATCATTTTATTGCAGGG - Intronic
1108728467 13:53206733-53206755 AACAATATTCAGTTGTTCCCGGG - Intergenic
1108879167 13:55087783-55087805 AGCAATATGAAGTTATAACCAGG + Intergenic
1110582770 13:77151252-77151274 ATCTACATTAAGTTATTGCAGGG + Intronic
1110792491 13:79600850-79600872 AATAATAATAAGTTATTTCTGGG + Intergenic
1110980082 13:81886424-81886446 AACAGTGTTAAGTTGTTACCAGG + Intergenic
1111073090 13:83195566-83195588 AGCAAAATTAGGTTATTGCTTGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112566804 13:100558939-100558961 AACAAAAACAAGTAATTGCCTGG + Intronic
1112743763 13:102504753-102504775 AATAATATTCACTTATTGCAGGG - Intergenic
1112795567 13:103052896-103052918 AATAATATTAAATTATTTACTGG - Intronic
1114373564 14:22117558-22117580 AACAATATTAAGTACTAGCAAGG - Intergenic
1115014416 14:28592893-28592915 AACAATATAATGTTATTGATAGG + Intergenic
1115117876 14:29904792-29904814 AATAATATTAAGTTGTTTTCAGG - Intronic
1117223351 14:53630197-53630219 AACAATATTTAAATATTTCCTGG - Intergenic
1117313875 14:54555221-54555243 AAAAATATTAAATAATTGGCCGG - Intergenic
1119364641 14:74081324-74081346 AACAATATCAAATGATTGCTTGG - Intronic
1119887388 14:78154247-78154269 AATAACATTATGTTACTGCCAGG - Intergenic
1119914716 14:78387074-78387096 AACAATATTAAGTATAGGCCGGG - Intronic
1120697302 14:87658908-87658930 AGCAATATGAAGTTAAAGCCAGG - Intergenic
1121973566 14:98381975-98381997 AACAATAATAATTTATTCTCAGG + Intergenic
1122336692 14:100994386-100994408 AAAAATATTCAGTTATCGGCTGG + Intergenic
1126015548 15:44347283-44347305 AACAATATTAAGTTAAAACCAGG - Intronic
1127143414 15:56000053-56000075 AGCAAATTTAGGTTATTGCCTGG + Intergenic
1127926351 15:63547432-63547454 AATAAAATTGAGTTATGGCCGGG + Intronic
1130082450 15:80746086-80746108 AACAATATTAAGTGTTGGCAAGG - Intronic
1131238852 15:90720891-90720913 TTCAATATTAAATTATTTCCTGG + Intronic
1134565051 16:15244295-15244317 AACAATATGTAGTTTTGGCCAGG + Intergenic
1134737445 16:16512401-16512423 AACAATATGTAGTTTTGGCCAGG - Intergenic
1134930065 16:18199757-18199779 AACAATATGTAGTTTTGGCCAGG + Intergenic
1135192044 16:20362350-20362372 AACAATGTTATGTTATTATCAGG - Intronic
1135889459 16:26344286-26344308 AACCATCTTAAGTAAGTGCCTGG - Intergenic
1137480182 16:48846044-48846066 CACAATATTGAGTTGTTCCCGGG - Intergenic
1139297447 16:65915085-65915107 AACCAGATAAAGATATTGCCAGG - Intergenic
1140709203 16:77660870-77660892 AACAAAAATCAGTGATTGCCAGG + Intergenic
1145388513 17:22436034-22436056 AACAAAGTTAAGTAATTTCCAGG + Intergenic
1147865911 17:43552113-43552135 AAAAATATTAAGATGTGGCCGGG - Intronic
1148048134 17:44756630-44756652 AAAAATAGTAAGTTCTAGCCGGG + Intergenic
1148062947 17:44849070-44849092 TAGAATATTGAGTTGTTGCCGGG - Intronic
1150559229 17:66280696-66280718 AAGAATATTAATTTTTGGCCAGG - Intergenic
1151470984 17:74317534-74317556 AACAAAATTAAGTGTTTCCCGGG + Intergenic
1153249467 18:3106835-3106857 AACAAACTTAAGTAATTGCTAGG + Intronic
1153315965 18:3722623-3722645 ATAAATATTCAGATATTGCCTGG - Intronic
1156397681 18:36714238-36714260 AAAAATATTACCTGATTGCCTGG + Intronic
1156899188 18:42280755-42280777 AACATTATTAAGTACTTGCTGGG - Intergenic
1158051932 18:53232760-53232782 AACAAGATTAAAATATGGCCTGG - Intronic
1158816608 18:61105345-61105367 AGAAATAATAAGTTAATGCCTGG - Intergenic
1160088844 18:75807026-75807048 ACCAATATTAATTAAATGCCTGG - Intergenic
1167537397 19:50063164-50063186 AAAAATATTGAGTTGTGGCCAGG - Intergenic
925035704 2:683912-683934 AACATTATTAAGACATTGACAGG + Intergenic
925090709 2:1153644-1153666 AACACGAACAAGTTATTGCCAGG - Intronic
927618876 2:24630138-24630160 AACATTAATAAGTTACGGCCGGG - Intronic
930199941 2:48543268-48543290 AAAAATATCAAGATATGGCCGGG - Intronic
930453797 2:51580083-51580105 AACAATTTAAAGATATTGGCTGG + Intergenic
930676722 2:54209492-54209514 AACAATATTAAGACATTGTTTGG + Intronic
931986929 2:67751237-67751259 AACAAAATTAAGTAATTACAGGG + Intergenic
932041176 2:68301594-68301616 AAAAATACTAAGCAATTGCCTGG + Intronic
932217113 2:69974040-69974062 TAAAATATAAAATTATTGCCAGG + Intergenic
932248061 2:70214207-70214229 AACAATTTTAAGTTCTTTCAAGG + Intronic
932426422 2:71638506-71638528 AAAAATATTTAGTGGTTGCCAGG - Intronic
933804705 2:85989649-85989671 AAAAATATTAAGTATTTGCTGGG - Intergenic
935356374 2:102205085-102205107 AACAATATTAAGTTGTTATCCGG - Intronic
937560440 2:123218184-123218206 AACAATATGAAGTTAATACCAGG - Intergenic
938941554 2:136174007-136174029 AACAATGGTAAGATATTGACAGG - Intergenic
940347954 2:152646754-152646776 AACAATACTAAGTTAATGAAAGG + Intronic
940594936 2:155779157-155779179 AACAAAATGAAGGTATTCCCTGG - Intergenic
941504432 2:166324104-166324126 AATAAGATTAAGTTATTTACAGG - Intronic
942845507 2:180419777-180419799 AAAAATATGAAATGATTGCCTGG - Intergenic
943269032 2:185774356-185774378 CACCATAGTATGTTATTGCCTGG + Intronic
944489778 2:200246331-200246353 AAAAATATCAAATTATGGCCAGG - Intergenic
944552130 2:200854238-200854260 AAAAAAATTAAGTTCTGGCCAGG + Intronic
945130132 2:206562353-206562375 AAAAATATTTATTTATTGACTGG - Intronic
945221994 2:207493074-207493096 AAGAATATAAAGTTATTGCAGGG - Intergenic
945711862 2:213306889-213306911 AGCAATATGAAGTTAAAGCCTGG + Intronic
1169218874 20:3809303-3809325 AAAAATATTTATTTATGGCCAGG + Intergenic
1170796959 20:19556162-19556184 AACAATATGAAGGTATTGGGAGG - Intronic
1171152123 20:22836331-22836353 TACAACATTTAGTTATTGGCTGG + Intergenic
1172041136 20:32046861-32046883 AACAATAAGAATTTATTGGCAGG + Intergenic
1172076943 20:32306097-32306119 AAAAAAAGAAAGTTATTGCCGGG + Intronic
1177506208 21:22020925-22020947 AAAAATATTAATTTATTCCTTGG - Intergenic
1178155518 21:29849320-29849342 AACAATATTAAGTTATTGCCAGG + Intronic
1178539329 21:33436060-33436082 AACAATAAAAAATTGTTGCCGGG + Intronic
1182410943 22:30185533-30185555 AACAATAGTAAGTTATTGAAAGG - Intergenic
1184012629 22:41760528-41760550 AATAATAATAATTTATTGGCTGG + Intronic
950891304 3:16407129-16407151 AACCAAATTAGGTTATTGCATGG - Intronic
957187529 3:76962037-76962059 AACAATTTTAAAAGATTGCCAGG + Intronic
957562565 3:81841999-81842021 AACAGTATTAAGTAAGTGCTAGG - Intergenic
957645370 3:82915141-82915163 AAAAATATAAAGATATAGCCAGG + Intergenic
957997743 3:87711707-87711729 AACAATATACAGTTCTTTCCTGG + Intergenic
958493940 3:94818005-94818027 AACAATATGAAGTTGGGGCCAGG + Intergenic
958538152 3:95431249-95431271 AACAATGTTAAAGTATTGCCAGG - Intergenic
959001902 3:100974106-100974128 AACAATATCAAGTTCTGGCAAGG + Intronic
959267773 3:104166098-104166120 ATAAATATTAAGTTATTTTCCGG + Intergenic
959762192 3:109978323-109978345 AGCAATATTAAGTTAAAACCAGG + Intergenic
960321717 3:116244813-116244835 AACAAAATTCAGTTACTGACTGG - Intronic
964589596 3:158345449-158345471 AACATTACTAAGTTTTAGCCTGG - Intronic
964952640 3:162315775-162315797 AACAATATAAAGTTCTTCTCAGG - Intergenic
965248630 3:166310542-166310564 AATAAAATGGAGTTATTGCCTGG - Intergenic
965380500 3:167982495-167982517 AGCAATATGAAGTTAAAGCCAGG - Intergenic
965905917 3:173706080-173706102 AACACTATTGACTTATTGCAAGG - Intronic
966152113 3:176876613-176876635 AACAATATTTATTTATATCCTGG + Intergenic
966312736 3:178612973-178612995 AACAGTATTAAGTTATTATCAGG - Intronic
968259935 3:197312820-197312842 AAATATATGAAGTTATTTCCAGG + Intergenic
970070494 4:12154296-12154318 AACAATGTTAAGTTATTATCAGG - Intergenic
970932753 4:21531773-21531795 AAAAGTAAAAAGTTATTGCCTGG + Intronic
971083085 4:23238062-23238084 ACTAATATTAAATCATTGCCAGG - Intergenic
971702275 4:29993975-29993997 AACAATATTGAGTTGTTTACAGG + Intergenic
972033561 4:34493245-34493267 AAAAATGTTCAGTTATGGCCAGG + Intergenic
972423764 4:38913683-38913705 AAGAATATTAACTTAGGGCCAGG - Intronic
972533683 4:39981904-39981926 ACAAATATTAACTTATGGCCAGG - Intergenic
972706623 4:41550804-41550826 AAAAATATTAAGTTATAGTTGGG + Intronic
975358357 4:73435192-73435214 TACCATATTAATTTATTTCCTGG + Intronic
975572271 4:75830052-75830074 AACACTATGAAGTTTTTGCTTGG + Intergenic
975769220 4:77703285-77703307 AACAATATTAAGTATTTGAAGGG + Intergenic
975786698 4:77897467-77897489 TACCATACTAAGTTATTGTCAGG + Intronic
975795357 4:78001023-78001045 AAAAAAATTAAAATATTGCCAGG + Intergenic
976162946 4:82222278-82222300 AAAAATATTAAGAAATTGCTTGG - Intergenic
978698445 4:111613046-111613068 AAGAATTTTAAGTAATTGCAAGG - Intergenic
979864898 4:125742015-125742037 TAGAATATTAAATTATTGCTGGG - Intergenic
979885869 4:126026683-126026705 AACAATATTATAGTATTGCTTGG + Intergenic
980031305 4:127835404-127835426 AAAATTATTAAGTTTTGGCCAGG + Exonic
980687446 4:136247641-136247663 AAAAATAGTAAGTTATTTTCAGG + Intergenic
981323170 4:143416473-143416495 AACTATATTAGATTATGGCCGGG + Intronic
983165364 4:164470082-164470104 ATCAATATTTATTTATTGCCAGG - Intergenic
983252641 4:165362224-165362246 AAGAATATTAATTTCTAGCCGGG + Intronic
985993571 5:3583786-3583808 AACAACAGAAACTTATTGCCTGG - Intergenic
988057545 5:26119099-26119121 AATAAAATTAAATAATTGCCAGG - Intergenic
988119139 5:26937786-26937808 TACAATGTTCAGTGATTGCCAGG + Intronic
988858079 5:35248647-35248669 AATAATAGAAACTTATTGCCTGG + Intergenic
989800961 5:45538838-45538860 AACAATTTTAAAGTATTCCCTGG + Intronic
990901307 5:60752655-60752677 AAAAATATAAAATTATGGCCGGG + Exonic
991285185 5:64965902-64965924 TACAATATTAAGATATTATCAGG + Intronic
991522021 5:67510594-67510616 AAAAAGATTAAGTGGTTGCCAGG + Intergenic
993209184 5:84925971-84925993 AACAAGATTAAACTATTACCTGG + Intergenic
993238022 5:85341103-85341125 TACAATTTTAAGTTATTTTCAGG - Intergenic
993583771 5:89697925-89697947 AAAAAAATGAAGTTATTGCTTGG - Intergenic
993864836 5:93180428-93180450 AACAATATTAAGTAATAGCATGG + Intergenic
995778106 5:115746806-115746828 AACAATATGAAGTTAAAACCAGG + Intergenic
996192796 5:120566052-120566074 AGCAATATTAAGTTAGAGACAGG + Intronic
996863832 5:128095222-128095244 TACAATATTAAATTATTCACAGG - Intronic
996893542 5:128453071-128453093 AACCATATTAAATGATTGCTAGG - Intronic
998748287 5:145287003-145287025 AACAATAAGAAGTTCTGGCCAGG - Intergenic
1001786991 5:174422171-174422193 AAAAATATGAAGTTCTGGCCGGG - Intergenic
1003509459 6:6767472-6767494 AAAAAAATTAATTTATTGGCCGG - Intergenic
1005892086 6:30148246-30148268 AACAATAATAAATAAGTGCCAGG - Exonic
1006072080 6:31505561-31505583 ATCAATGTGAAGTTATTTCCAGG + Intronic
1006481051 6:34294429-34294451 AAAAAAATTTATTTATTGCCAGG + Intronic
1007002590 6:38328484-38328506 ATCAAGATCAAGGTATTGCCAGG - Intronic
1007466794 6:42058086-42058108 AAAAATATTTAGTAATGGCCGGG + Intronic
1007878725 6:45137905-45137927 AACAATATTAAGCTAATGAAAGG + Intronic
1007895736 6:45355866-45355888 ATAAATATTAATTGATTGCCAGG + Intronic
1008778481 6:55071032-55071054 AAGAATATTAAGTTATTTGCGGG + Intergenic
1008867534 6:56231377-56231399 CACAATATTCAGTTCTTTCCTGG + Intronic
1010132582 6:72512223-72512245 AAGTATATTTAGTTTTTGCCAGG + Intergenic
1010968695 6:82241404-82241426 AACAATATTAACACAGTGCCTGG - Intronic
1012836868 6:104280563-104280585 AACCATGTCAGGTTATTGCCAGG - Intergenic
1013216154 6:108029021-108029043 ACCAATATTAAGATTCTGCCTGG - Intergenic
1013590023 6:111612059-111612081 AAAAATACTAAGTGATTGGCTGG - Intergenic
1014692650 6:124580420-124580442 ATCAATATTAAGTTGTCACCAGG + Intronic
1015614046 6:135056355-135056377 AAAAATATTGTGTTATTGGCCGG + Intronic
1015977081 6:138801424-138801446 AACAAAATTAAGTAATTGGGAGG - Intronic
1016979161 6:149838350-149838372 AACAAAATTTAGTTATGGGCTGG + Intronic
1018167509 6:161112581-161112603 TACAATATTAATTTATTGCTTGG + Intronic
1019167436 6:170108106-170108128 ATCAATAATAAGTTATGTCCCGG - Intergenic
1021504191 7:21363155-21363177 AACAAAATTCAGCTATTGGCCGG - Intergenic
1022741270 7:33123679-33123701 AGCAATATTAAGTTAAAACCAGG + Intergenic
1022945161 7:35276212-35276234 AACATTATTATGTTATTAACTGG + Intergenic
1022957263 7:35392606-35392628 AGCAATAGTAATTTATTGCAGGG + Intergenic
1024498537 7:50074191-50074213 AACAATGTTAAGTTTTTATCAGG + Intronic
1024892043 7:54214164-54214186 AACAATTTTAAGTTGTTATCAGG + Intergenic
1024943204 7:54783240-54783262 AATAATAGTAAGCGATTGCCAGG - Intergenic
1027997955 7:85450295-85450317 ATCAATTTTAAGTTACTGCAAGG - Intergenic
1029604754 7:101591751-101591773 AACAAAATAAAGGTGTTGCCAGG + Intergenic
1030028238 7:105345557-105345579 AACAATTGTAAGTTATTACAGGG + Intronic
1030449108 7:109686754-109686776 ATCTATATTATGTTATTTCCAGG + Intergenic
1030600880 7:111590390-111590412 ACCAATATGATGTTTTTGCCTGG + Intergenic
1030858445 7:114591386-114591408 AATAAGATTAAGTTAGTGGCAGG + Intronic
1031142219 7:117955964-117955986 AACAGTATTAAGGTCTTGTCAGG - Intergenic
1031166970 7:118240856-118240878 AAGAATATATAGTTATTGGCCGG + Intronic
1031240599 7:119233571-119233593 AGCAATATTAAATTATTGTATGG + Intergenic
1032178170 7:129650129-129650151 TACCATGTTAAGTTATTGCTTGG + Intronic
1033395477 7:140970178-140970200 AATAATAATAAGCTATTGGCCGG - Intergenic
1033435090 7:141325897-141325919 AAAAATACTCAGTTATTCCCAGG - Intronic
1033711917 7:143955872-143955894 AACAACATTACCTTTTTGCCAGG - Intergenic
1035623094 8:1049518-1049540 AACAATATTTATCTATTGCAAGG - Intergenic
1035988403 8:4460044-4460066 AACAATATTCTGTTATTGGCTGG - Intronic
1036083166 8:5580378-5580400 AACAACATAAAGTTACTCCCTGG - Intergenic
1037576808 8:20213486-20213508 AAAAAAATTAAGATATTGGCTGG + Intronic
1037846184 8:22284332-22284354 GACAATATTCAGTTATTCCAGGG - Intronic
1037971477 8:23174655-23174677 GAAAATATTAAGAAATTGCCTGG - Intergenic
1038110052 8:24486580-24486602 AACAATAGAAAGTTATTTCTCGG + Intronic
1039120755 8:34143604-34143626 ACCAATATTTGGTTATTGCTGGG + Intergenic
1039975234 8:42358205-42358227 AAAAATATTAACTTTTGGCCAGG + Intronic
1040358667 8:46644040-46644062 AACAATCTTAACTTTTTGCTGGG - Intergenic
1040377833 8:46843527-46843549 CACAATCTTAACTTTTTGCCGGG - Intergenic
1040743256 8:50605678-50605700 AACAATATGAAGTTAAAGCCAGG + Intronic
1040816546 8:51513942-51513964 AACAATATTCATTTATGGTCAGG - Intronic
1041103910 8:54423190-54423212 AACAATTTTTAGATATTGCTGGG - Intergenic
1041869379 8:62615905-62615927 AGCAATATTAAGTTGAAGCCAGG + Intronic
1042656732 8:71106736-71106758 AACAAAATGAAGTTCTTTCCGGG + Intergenic
1043194161 8:77269185-77269207 AACAACATGAAGTTATTACTTGG - Intergenic
1043724424 8:83591286-83591308 AACTATATAAAGTTAAAGCCAGG + Intergenic
1043936888 8:86152740-86152762 AATAATATTAAGCTACTGACTGG - Intronic
1044021277 8:87109158-87109180 AACAATATAAAATTATTTCCCGG - Intronic
1044026299 8:87176157-87176179 AACAATATGAAGTTAAAACCAGG + Intronic
1044276532 8:90306757-90306779 AACAATTTTAAATTATTGGATGG + Intergenic
1044608968 8:94073355-94073377 AACATTATTGAGTTCTTCCCAGG + Intergenic
1045142366 8:99300926-99300948 AAAAATATTAACTTTTGGCCCGG + Intronic
1047730274 8:127722145-127722167 AACAATTTTTAGTTATTCACAGG - Intergenic
1048752116 8:137690402-137690424 AACAAAATAAAATTATTGGCAGG + Intergenic
1050028278 9:1358263-1358285 AACAATATTCAGCCATTACCTGG - Intergenic
1050570749 9:6935798-6935820 AACAGCATTAAGTTTTTGCGGGG + Intronic
1051461209 9:17318322-17318344 AAAAATATTCAGTTAGGGCCCGG - Intronic
1053525031 9:38820357-38820379 AACAATATTAAGTCTTTGGGAGG + Intergenic
1054197262 9:62044772-62044794 AACAATATTAAGTCTTTGGGAGG + Intergenic
1054641147 9:67543922-67543944 AACAATATTAAGTCTTTGGGAGG - Intergenic
1055494053 9:76837145-76837167 AAAAAAATGAAGTTATTGGCCGG + Intronic
1055566820 9:77577970-77577992 AACAAGATTAAGTCTTGGCCAGG + Intronic
1055649118 9:78389817-78389839 AAGTATATAGAGTTATTGCCAGG + Intergenic
1055882370 9:81016010-81016032 GACAATATTAAGTTCTTGCGAGG + Intergenic
1055886603 9:81070335-81070357 AGCAATATAAAGTTAAAGCCAGG + Intergenic
1055943507 9:81672312-81672334 AATAATAATAATTTATTGCAGGG - Intronic
1057621192 9:96636996-96637018 AGAAATATTTTGTTATTGCCGGG - Intergenic
1060967327 9:127718914-127718936 AAAAATATTCAGTTCTTGGCCGG + Intronic
1061735835 9:132657833-132657855 AAACATGTTAAGTTAGTGCCTGG - Intronic
1186140789 X:6571077-6571099 AACAACATTAAATTATTACAAGG + Intergenic
1188006924 X:25021913-25021935 AAGAAAATTCAGTTATTTCCAGG - Intergenic
1188168257 X:26889500-26889522 AATAATATTGAGTTATATCCTGG + Intergenic
1189586396 X:42466604-42466626 AACAATATGCAATTATTGCTGGG + Intergenic
1189881274 X:45495870-45495892 AACAGTGTTAAGTTTTTGTCAGG - Intergenic
1190374487 X:49775587-49775609 AGCAATATGAAGTTAAAGCCAGG + Intergenic
1191059458 X:56279098-56279120 AACAATATGAAGTTAAAACCAGG + Intronic
1192671535 X:73148516-73148538 AACAATATTAAGTAGTTATCAGG - Intergenic
1192842218 X:74868455-74868477 AACAAGATTATGTTATTTGCAGG + Intronic
1192908659 X:75579717-75579739 AACAATATGAAGTTAAATCCAGG + Intergenic
1193815606 X:86101711-86101733 AGCAATATAAAGTTATAACCAGG - Intergenic
1194372632 X:93092167-93092189 AACAATATGAAGTTAAAACCAGG + Intergenic
1194477098 X:94371672-94371694 AACAGTGTTAAGTTGTTACCAGG + Intergenic
1195743352 X:108089536-108089558 AAAAATAATAAGCTATGGCCGGG + Intronic
1196218426 X:113082948-113082970 AACAATGTTAAGTTCTTATCAGG + Intergenic
1197019247 X:121666964-121666986 AACTATAATAATTTTTTGCCTGG - Intergenic
1200030917 X:153294609-153294631 AACATTTTTTAGTTATTCCCAGG + Intergenic
1200895667 Y:8373685-8373707 TACAATATTAAATTTTTGCTGGG + Intergenic