ID: 1178155889

View in Genome Browser
Species Human (GRCh38)
Location 21:29853909-29853931
Sequence TGCTGTGTAAGCAGCATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178155889 Original CRISPR TGCTGTGTAAGCAGCATGGG TGG Intronic
900364823 1:2306845-2306867 TGCTGTGTGGGCTGCAGGGGCGG - Exonic
901327241 1:8374588-8374610 TGGTCTGTGTGCAGCATGGGAGG - Intronic
902707164 1:18213503-18213525 GGGTGTGCAGGCAGCATGGGAGG + Intronic
906810626 1:48823606-48823628 TGCTGTGTGAGCAGCAAGGAAGG - Intronic
906921933 1:50073990-50074012 TGCTGAGTCATCAGCATGGTAGG + Intronic
907231683 1:53005014-53005036 TGCTGTGCTAGCAGCAAGCGAGG - Intronic
907517368 1:55001033-55001055 TGCTGTGGAGGCAGCGTGGTGGG + Intronic
907665782 1:56432894-56432916 CGCTGAGCAAACAGCATGGGAGG - Intergenic
908025880 1:59951062-59951084 ACCTTTGTAAGGAGCATGGGAGG + Intergenic
909710806 1:78647226-78647248 AGCTGTGAAAGCAGCTTGGGTGG - Intergenic
915003257 1:152613118-152613140 TGTTGTGAAAGCAGCATGCCTGG + Intergenic
915338212 1:155160413-155160435 TGCTGGTTAAGCAACATGGTGGG + Intergenic
917109204 1:171527821-171527843 TGCTGTGCAAGCAACTTTGGAGG - Exonic
919302625 1:195790577-195790599 TGCAGTGGAAGCAGCAAGGCTGG + Intergenic
922187650 1:223289915-223289937 TGATGAGTAAGCAGCCTGGCTGG - Intronic
922220589 1:223555426-223555448 TTCTATGTAAACAGCATGGTAGG - Intronic
923822124 1:237456730-237456752 TGCTGGGTAAGAAGCATGATTGG + Exonic
924571515 1:245241455-245241477 TGCTGTGTTCAGAGCATGGGAGG + Intronic
1065483276 10:26215109-26215131 TGCTTTGTTAGCAGCTTTGGTGG + Intergenic
1066063132 10:31741925-31741947 AGCTGTATAAGAAGCATGGTTGG - Intergenic
1067439113 10:46298467-46298489 TGCTGTGTAATATGCATGTGGGG + Intronic
1067808602 10:49410016-49410038 GGCTGTGTCAGCAGCAGAGGAGG + Intergenic
1069239102 10:66116729-66116751 GGCTGTGTAAGAGGCATGGCTGG + Intronic
1069917560 10:71796898-71796920 TGCTTAGTAAGCATCATGGGAGG + Intronic
1069924957 10:71843013-71843035 TGCTGTGTCTGCAGCATGTGCGG - Intronic
1070752914 10:78974319-78974341 TCCTGTGAAAACAGCCTGGGAGG + Intergenic
1071661134 10:87504492-87504514 TGCTGTTTTGGCAGCCTGGGAGG + Intergenic
1073207695 10:101777244-101777266 TTCTGTGGGAGCAGCCTGGGTGG + Intronic
1073345248 10:102777959-102777981 TGCTGTGTCAGCAGGCTGGTAGG + Intronic
1076901251 10:133339156-133339178 TGGTGTGTAAGCAGTATGTGGGG - Intronic
1077525703 11:3063268-3063290 TGCTGTGAAAGCAGCCAGGAGGG + Intergenic
1077655681 11:4016827-4016849 TGCTGTGCTAGCAGCAAGGAAGG + Intronic
1078300012 11:10119821-10119843 TGCTGTGGAATCAACCTGGGAGG + Intronic
1078847190 11:15128854-15128876 TGCTGTGTTAGCAGGGTGGTGGG + Intronic
1079145924 11:17851858-17851880 TTCTGTGTAAGCAGTGGGGGTGG - Intronic
1084576049 11:69988655-69988677 TGCTAAGTAGGCAGAATGGGAGG - Intergenic
1084726297 11:70944429-70944451 TCCTGAGAAAGCAGCATAGGAGG + Intronic
1084756524 11:71242535-71242557 TGCTGTTTTAGCAGGATGGTCGG - Intronic
1091388252 12:108909-108931 TGCTGGGTCACCAGCAGGGGTGG - Intronic
1092859147 12:12704742-12704764 TGCTGTTTAAACAGCACAGGAGG - Intergenic
1095978515 12:47956470-47956492 GGCTGTGCAGGAAGCATGGGTGG - Intergenic
1097177005 12:57149144-57149166 TGCTTTGTAGGCAGGGTGGGAGG - Intronic
1097603448 12:61723469-61723491 TTCTCTGTAAACAGCAAGGGGGG + Intronic
1098144747 12:67487176-67487198 TGCTGTGGAAGCAGGATCTGTGG - Intergenic
1101816128 12:108147467-108147489 TGCTGTGTAGGGAACAGGGGAGG + Intronic
1103052176 12:117789826-117789848 TGCTGTGTACTCAGCAGGGATGG - Intronic
1104370727 12:128221755-128221777 GGCTGTATAAGAAGCATGGCTGG - Intergenic
1104692884 12:130839617-130839639 TGCTCCGTAAGCATCATGTGTGG - Intergenic
1105828840 13:24146092-24146114 TGCTGATTAAGCAGGAGGGGAGG + Intronic
1107043810 13:35975134-35975156 TGCTGTTTCTGCAGCATGGATGG - Intronic
1110394773 13:75016698-75016720 TGGTTTGTAGGCTGCATGGGAGG + Intergenic
1110450247 13:75632663-75632685 TGCTGTGTAACTAGCTTTGGGGG - Intronic
1111317955 13:86585626-86585648 GGCTGTATAAGAAGCATGGCTGG - Intergenic
1111643780 13:91004409-91004431 TGCTGTGTGATCAGCATGGTTGG + Intergenic
1112388912 13:98964888-98964910 TGCAGAGGAAGCAGGATGGGAGG - Intronic
1114527959 14:23378124-23378146 TGCTGGGTGAGCAGAGTGGGAGG + Intronic
1117066376 14:52016138-52016160 CACTGTGGAAGCAGCCTGGGAGG - Intronic
1117457419 14:55912224-55912246 TGCTGTCTACCCAGCAGGGGTGG - Intergenic
1119048600 14:71343752-71343774 TGCTGTGGAAGCAGCATCTTGGG + Intronic
1120377538 14:83729306-83729328 TCCTGTGAAAGCAGCAGTGGGGG - Intergenic
1120391036 14:83909108-83909130 TGCTGTGAAAGCAACAAGAGCGG + Intergenic
1121130014 14:91437599-91437621 GGCTGTATAAGAAGCATGGCTGG - Intergenic
1122440991 14:101731706-101731728 TCCTCTGAAAGCAGCCTGGGAGG + Intronic
1124081887 15:26506779-26506801 GGCTGTGTAGGAAGCATGGCTGG - Intergenic
1127848610 15:62893901-62893923 TGCTGTATAGGAAGCATGGCTGG + Intergenic
1127981404 15:64037880-64037902 AGGTGAGTAAGCAGCAGGGGAGG - Intronic
1128242536 15:66110805-66110827 ATATGTGTAAGCAGCATGGTGGG - Intronic
1128679283 15:69636185-69636207 TGCTGTGTGTGCATCTTGGGAGG + Intergenic
1129441209 15:75582048-75582070 CGCTGTGTAAGCAGCAGGCAAGG + Intergenic
1129444163 15:75604832-75604854 TGCAGTGTACGCTGCTTGGGTGG - Intronic
1130015727 15:80184913-80184935 TGCTGAGCGAGCAGCATGGAGGG - Intronic
1132622540 16:874596-874618 AGCTGTGTAAACTGCGTGGGAGG + Intronic
1132745197 16:1433538-1433560 TGCAGTGGGAGCAGCAAGGGTGG + Intergenic
1136579346 16:31142464-31142486 TGCTGGGTAAGCGGCGGGGGCGG - Exonic
1137362566 16:47832363-47832385 TGCTCTGGAAACAGCTTGGGAGG + Intergenic
1140807179 16:78543498-78543520 TTCTGTGTAAGGTGCATGGGTGG - Intronic
1142096348 16:88241962-88241984 TGCTGTGCAGACAGGATGGGAGG + Intergenic
1142160832 16:88556566-88556588 GGCTGTGTAGGAAGCATGGCTGG - Intergenic
1143270014 17:5668510-5668532 AGCCCTGGAAGCAGCATGGGTGG - Intergenic
1144317035 17:14071465-14071487 TGATGGGGAAGCAGCATGGTGGG + Intronic
1146404183 17:32523113-32523135 TGCTGTCTAAGAGGCATGGGGGG - Intronic
1151072178 17:71227241-71227263 TGCTATTTAATCTGCATGGGAGG - Intergenic
1152062076 17:78084463-78084485 TTTTCTGTAAGCAGCAGGGGAGG + Intronic
1152215146 17:79027666-79027688 TGCGGTGTGAGCAGGAAGGGAGG + Intronic
1152267539 17:79305058-79305080 TGCTGTTTCAGCAGGGTGGGTGG + Intronic
1153235705 18:2984985-2985007 TGTTGTGTAAGCTGCATTGTAGG - Intronic
1153721303 18:7906139-7906161 TGGTGGGTAAGCTGCTTGGGTGG - Intronic
1159124115 18:64203117-64203139 TGCTGTGTGGGCTGCTTGGGTGG - Intergenic
1159292002 18:66435043-66435065 GTCTTTGTAAGCAGCATGGCAGG - Intergenic
1159801311 18:72903390-72903412 TTCTGTAAAAGCAACATGGGTGG - Intergenic
1159902401 18:74059956-74059978 GGCTATGTAAGCAGCATGCATGG + Intergenic
1160785750 19:899615-899637 TGCTGTGTACACGGCCTGGGGGG + Exonic
1160859179 19:1230537-1230559 TGCTGGTTATCCAGCATGGGTGG - Exonic
1161094819 19:2384201-2384223 TGCTGTGTCTGCTGCGTGGGCGG - Intergenic
1161389689 19:4014690-4014712 TGCTGGGTCAGCAGGGTGGGAGG - Intronic
1161762908 19:6187554-6187576 TGCTGGTCAAGGAGCATGGGTGG + Intronic
1162860696 19:13504523-13504545 TGCTGTTTGAGGAGCATGGCGGG - Intronic
1163223419 19:15937814-15937836 TGCTGTGTAAGCTGCATATGGGG + Intergenic
1163225171 19:15955539-15955561 TGCTGTGTAAGCTGGATATGGGG + Intergenic
1164451247 19:28367076-28367098 TGAGCTGTGAGCAGCATGGGTGG + Intergenic
1164769487 19:30797241-30797263 TTCTGTGTTGGCAGCATGTGGGG + Intergenic
1166071343 19:40389969-40389991 TGCTGTGTCAGCAGCCAGGCGGG - Exonic
1167079429 19:47269287-47269309 TGCAGAGTAAGCAGCCAGGGTGG + Intronic
925422947 2:3726493-3726515 TGCTGTGAATGCAGCCTGAGAGG - Intronic
926156775 2:10459724-10459746 TGCTGTGTGAGCTGCAGGGTGGG + Intergenic
927883327 2:26704124-26704146 TGCTGGGTGAGCAGGGTGGGCGG - Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928822061 2:35373182-35373204 GCCTGTGAAAGCAGCATAGGGGG + Intergenic
929291155 2:40193463-40193485 TGCTGTGTGAGCACAGTGGGTGG + Intronic
931269598 2:60689722-60689744 GGCTGTATAGGCAGCATGGCTGG - Intergenic
936264011 2:110986469-110986491 TGCTGTGGCAGCAGCATGTCGGG + Intronic
937735822 2:125287544-125287566 TGCTGGGGAAGCTGCATGGAGGG + Intergenic
938641887 2:133289803-133289825 GGCTGTATAGGAAGCATGGGTGG + Intronic
940740475 2:157502223-157502245 GGCTGTATAAGAAGCATGAGTGG + Intergenic
943627558 2:190216911-190216933 TGCTGGGTCACCAGCAGGGGTGG + Intronic
945427705 2:209727301-209727323 TGCTGTGTCAACAGCATGGCTGG + Intronic
945979911 2:216301131-216301153 GGCTGTGAAAGCATCATGGTAGG + Intronic
946153345 2:217790787-217790809 TGCTGTGTAAGGAGAAGGGAAGG - Intergenic
948516090 2:238504714-238504736 TGCTGTGTGGGAAGCAGGGGCGG + Intergenic
1168901683 20:1370337-1370359 TGTATTGTCAGCAGCATGGGTGG - Intronic
1169361127 20:4950261-4950283 TGAGCTGGAAGCAGCATGGGTGG - Intronic
1169920305 20:10727825-10727847 TGTTGTGAAAACAGAATGGGGGG - Intergenic
1173588199 20:44201173-44201195 TGCTGTGTAAGCATTGTGGTAGG + Intronic
1175136729 20:56829842-56829864 TCCTGTCTCAGCAGCATCGGCGG + Intergenic
1175974056 20:62701602-62701624 TGGTGTGTGAGCAGGAAGGGTGG - Intergenic
1176932758 21:14832675-14832697 TGCTGTATAGGAAGCATGGATGG + Intergenic
1178155889 21:29853909-29853931 TGCTGTGTAAGCAGCATGGGTGG + Intronic
1178538855 21:33432624-33432646 TGCTCTTTAAGCAGCATGGATGG + Intronic
1178713313 21:34940123-34940145 TGCTGTGCATGCCTCATGGGTGG + Intronic
1179077916 21:38141331-38141353 GGCTGTATAAGAAGCATGGCTGG - Intronic
1179524205 21:41965276-41965298 AACTGTGTAAACTGCATGGGTGG + Intergenic
1179572982 21:42288860-42288882 GGCTGTGTAAGAAGCATGGCCGG + Intronic
1179627312 21:42655986-42656008 TGCTGGGTGTGCAGCCTGGGAGG - Intronic
1180087952 21:45516458-45516480 CGCTGTCTCAGCACCATGGGGGG - Intronic
1181559710 22:23692950-23692972 TGCTCTGCCAGCAGCCTGGGAGG - Exonic
1181760395 22:25054450-25054472 TTCTGTGTATGCAGGGTGGGAGG + Intronic
1183737813 22:39653578-39653600 TGCAGGGGAGGCAGCATGGGGGG + Intronic
949344034 3:3060024-3060046 TGCTTTGTATGTAGCATGTGTGG - Intergenic
949606897 3:5663000-5663022 TGCTGAGAAAGCAGCCTTGGGGG - Intergenic
949818355 3:8087107-8087129 TACTGTGTAAGCAGCAAGCATGG - Intergenic
953149874 3:40315160-40315182 TGCTGGGTAAGGAACATTGGAGG - Intergenic
953522848 3:43659442-43659464 TGCTGTGTTAGCAGCAAGCAAGG - Intronic
954755789 3:52839011-52839033 TGCTGTGGAAACAGCAAGGTAGG - Exonic
955492893 3:59500834-59500856 TACTGGTTAAGCAGCAAGGGTGG + Intergenic
955918013 3:63925826-63925848 TGGTGTGGAAGCAGCTTGTGAGG + Intronic
956036747 3:65101628-65101650 GGCTGTTTCAACAGCATGGGAGG + Intergenic
956603053 3:71043689-71043711 TTCTGGGTCAGCTGCATGGGAGG + Intronic
960658647 3:120033876-120033898 GGCTGTATAGGAAGCATGGGTGG - Intronic
960962454 3:123081971-123081993 TGCTATGTTAGCAGATTGGGAGG + Intronic
963271368 3:143289141-143289163 GGCTCTGTAATTAGCATGGGTGG + Intronic
964783500 3:160367434-160367456 TGCTGCTTAAGCAGCATGTGAGG - Intronic
965424137 3:168499897-168499919 TGCAGAGGAAGGAGCATGGGAGG + Intergenic
967788201 3:193520044-193520066 TGCTGGGTAAACAACGTGGGAGG - Intronic
968121336 3:196128089-196128111 TGATGAGAAAGCAGCAGGGGAGG + Intergenic
968789906 4:2652464-2652486 GGCTGTGTAGGAAGCATGGCTGG + Intronic
969107858 4:4821406-4821428 TGCTGTGCAGGAAGCATGGCTGG - Intergenic
969375948 4:6763324-6763346 TCCTGTGTAGGCATCTTGGGAGG - Intergenic
969600532 4:8173581-8173603 TGCTGTGTGCCCAGCATAGGAGG - Intergenic
974506272 4:62776869-62776891 TTCTGTATAAGAAGCATGGTAGG - Intergenic
974925405 4:68292084-68292106 TGCTGTGAAAGCAGCAGGGAAGG - Intergenic
977477979 4:97537435-97537457 TGCTGTGCTAGCAACAAGGGAGG - Intronic
978870004 4:113564463-113564485 TGCTGTGAAAGCACAGTGGGTGG - Intronic
978960102 4:114666971-114666993 TGCTGTGTAAAGAGGAGGGGCGG - Intronic
978971489 4:114812617-114812639 TGCTAAGTAAGAAGCATGTGGGG - Intergenic
981009969 4:139915673-139915695 TGGTGGCTAAGCAGCATTGGCGG + Intronic
982490261 4:156021059-156021081 TGCTGTGCAGGAAGCATGGCTGG - Intergenic
984432389 4:179665324-179665346 TGTTGTGTTTGCAGCATGAGCGG - Intergenic
984551236 4:181161494-181161516 TGCTGTTCAAGCAGCAGGGCCGG - Intergenic
987284785 5:16445455-16445477 TGCTGTGTAACCACAATAGGAGG + Intergenic
989154136 5:38328119-38328141 GGCTGTGCAAGAAGCATGGCTGG + Intronic
989414752 5:41160585-41160607 TACTGTGAAGGAAGCATGGGAGG + Intronic
989770625 5:45140272-45140294 AGCTGTGTAAGAAGCATGGCTGG - Intergenic
992747141 5:79830685-79830707 CGCTGTGTTAGGAGAATGGGGGG + Intergenic
992756477 5:79911355-79911377 TGCTGTGTTAGCAGCAAGCAAGG - Intergenic
996520630 5:124421680-124421702 GGCTGTATAGGAAGCATGGGTGG + Intergenic
998616063 5:143741852-143741874 TGCTGTGTGAGTAGGAGGGGTGG + Intergenic
998966408 5:147545611-147545633 TGCTGAGAAAGCTGCCTGGGTGG + Intergenic
1001544808 5:172564338-172564360 TGCACGCTAAGCAGCATGGGTGG + Intergenic
1001689794 5:173624493-173624515 AGCTGAGTGGGCAGCATGGGAGG + Intergenic
1002983221 6:2162824-2162846 TCCTGTGGAAGCAGTGTGGGTGG - Intronic
1003484918 6:6567232-6567254 TGGTGCGTCAGCAGAATGGGTGG - Intergenic
1003981762 6:11396661-11396683 TGCTGGGTAGGTAGGATGGGTGG + Intergenic
1004252997 6:14037540-14037562 TGCTGTGTATGCCAGATGGGCGG + Intergenic
1007647737 6:43395864-43395886 TGCTGGGTCATCAGCAGGGGTGG + Intergenic
1008246299 6:49178259-49178281 GGCTGTGTAGGAAGCATGGCTGG + Intergenic
1008711021 6:54227202-54227224 GGCTGTACAAGAAGCATGGGTGG - Intronic
1010688325 6:78877881-78877903 TGCTGTGCTAGCAGCAAGAGAGG - Intronic
1011125910 6:84007663-84007685 TGAGGTGTAAGCAACATGGTTGG - Intergenic
1012553434 6:100484977-100484999 TGATGTGTGAGCAGAGTGGGAGG + Intergenic
1016027273 6:139300101-139300123 TGCTTTGTGATCAGCAGGGGAGG - Intergenic
1017350263 6:153432589-153432611 TGCTGTACAAGAAGCATGGCTGG - Intergenic
1018049933 6:160000243-160000265 GGCTGTGTAGGAAGCATGGCTGG + Intronic
1018086236 6:160303514-160303536 AGCTGTGAAAGCAGCAGGGAGGG - Intergenic
1023518518 7:41027525-41027547 TGCGGTGTAAGAAGCATGCCAGG + Intergenic
1024523801 7:50330870-50330892 TGCAGGGTGAGCAGCAGGGGCGG + Intronic
1027773657 7:82438586-82438608 TCCTGTGTAAGCTACATGGTTGG + Intronic
1028118787 7:87033110-87033132 TTCTGTGTAGGCAGAGTGGGAGG + Intronic
1029268798 7:99363794-99363816 TGCTGTCCCAGCAGCTTGGGAGG - Intronic
1029593169 7:101520728-101520750 TGCTGGGGAAGGAGCATGAGAGG - Intronic
1031576098 7:123417566-123417588 AGCTGTGTAAGCAGCCAGAGTGG - Intergenic
1033396329 7:140977209-140977231 TGCTTTATAAACAGGATGGGGGG + Intergenic
1034667546 7:152831647-152831669 TGCAGGGAATGCAGCATGGGAGG + Intronic
1035616279 8:1004294-1004316 TGCTGGTTAAGCTGCTTGGGAGG - Intergenic
1035927083 8:3740225-3740247 TGCAGTGTCAGCAACTTGGGAGG - Intronic
1036111158 8:5904598-5904620 TGCTGCGGAAGAAGCATGGGTGG + Intergenic
1036596955 8:10221918-10221940 TGGCGTGTAATCAGCAAGGGAGG + Intronic
1037221560 8:16528801-16528823 TGCTATGTAAGCATCATGCCTGG - Intronic
1039213085 8:35237216-35237238 GGCTTTGTAAGAAGCAGGGGAGG + Intronic
1039763137 8:40599783-40599805 TGCTGTGTAAGGAGAGTGGTGGG + Intronic
1042682268 8:71399045-71399067 TGCTGTGTTAGCAGTAAGTGAGG + Intergenic
1043687594 8:83107088-83107110 TGGTGTGTTAGCAGCTTGGTTGG - Intergenic
1045361860 8:101440395-101440417 TGCTTTGTCATCAGCATGGTGGG - Intergenic
1047510416 8:125511556-125511578 TGCTTCGTAAGCAGCATATGGGG - Intergenic
1048044736 8:130762913-130762935 TGCTGTGTAGACAGCAAGGGAGG + Intergenic
1048651710 8:136485465-136485487 GGCTGTGTAGGAAGCATGGCTGG + Intergenic
1049352800 8:142173031-142173053 TGCTGTGTAAGCCGCCCGGGCGG + Intergenic
1049408261 8:142461155-142461177 TGCTGTGCAGAGAGCATGGGCGG + Intronic
1051874631 9:21778194-21778216 TGGTGTGAAAGGAGCCTGGGAGG + Intergenic
1053174712 9:35914460-35914482 TGCTGTATAAGAAGCAGGAGGGG + Intergenic
1059560373 9:115328882-115328904 TGCTGAGTGAGCTGCATGGTGGG - Intronic
1059583474 9:115578388-115578410 TGCTTTCTAAGCAGCAGAGGAGG - Intergenic
1059673532 9:116514746-116514768 TGCTGTGCAAGCAGTAAGCGAGG + Intronic
1061374740 9:130217289-130217311 AACTGGGTAAACAGCATGGGGGG - Intronic
1186039767 X:5462955-5462977 GGCTGTGCAAGAAGCATGGCTGG - Intergenic
1189813261 X:44800360-44800382 TGCTCTGTAAGCAGCAAGAAGGG + Intergenic
1191749897 X:64530615-64530637 TGCAGTGTACACTGCATGGGTGG + Intergenic
1198339786 X:135702564-135702586 CGCTCTGCAAGGAGCATGGGAGG - Intergenic
1199271453 X:145888138-145888160 GGCTGTGTCAGTAGCAGGGGAGG - Intergenic
1199526806 X:148801901-148801923 AGCTGTTTCAGCAGCATGGTGGG - Intronic
1201503210 Y:14668727-14668749 TGCTGTATAGGAAGCATGGCTGG + Intronic
1201927013 Y:19298478-19298500 TTCTGTGTCAGCACCATGGGAGG - Intergenic