ID: 1178158553

View in Genome Browser
Species Human (GRCh38)
Location 21:29883678-29883700
Sequence TGTGACATTCTGAATGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178158553 Original CRISPR TGTGACATTCTGAATGGGAA TGG Intronic
901254104 1:7806158-7806180 TGTGACAGTTGAAATGGGAAGGG + Intronic
903102920 1:21048761-21048783 TGTGGCTTTCTGAATGGGAGTGG - Intronic
905691438 1:39946095-39946117 AGTCACCTTCTGAATGCGAAAGG + Intergenic
906750391 1:48253450-48253472 GAGGACATTCTGAATGTGAAGGG - Intergenic
907748342 1:57237477-57237499 AGTGACATTCTGAGAGAGAAAGG - Intronic
908007726 1:59743935-59743957 TGTGACATGCTGCCTGGGCAGGG - Intronic
913323122 1:117604517-117604539 TGTCGGATACTGAATGGGAAGGG + Intergenic
914852622 1:151326495-151326517 TTGGAAATCCTGAATGGGAAGGG + Intronic
916573202 1:166045223-166045245 TGTTACCTTCTCAATGGGACTGG - Intergenic
916808512 1:168283758-168283780 GGTGACATTATGAATGAAAAAGG - Intronic
917879999 1:179325702-179325724 TTTGTGATTCTGTATGGGAAAGG - Intronic
918270313 1:182891930-182891952 AGTATCATACTGAATGGGAAAGG + Intergenic
919254452 1:195103618-195103640 TGTGACAATCTGAATGGACCTGG - Intergenic
919303215 1:195796732-195796754 TGGGACTTTGAGAATGGGAATGG - Intergenic
919557023 1:199070261-199070283 TGTAATATTCTGAATTGGGAGGG - Intergenic
920758885 1:208762529-208762551 GGTGACATACTGAATGGTCAAGG - Intergenic
921096488 1:211891037-211891059 TATGGCATTCTGAATGAGTATGG - Intergenic
923085466 1:230700279-230700301 TATGACATCCTGGGTGGGAAAGG + Intergenic
923890689 1:238212255-238212277 AGTGCCATACTGGATGGGAAAGG - Intergenic
924850902 1:247829515-247829537 TGTGACAACATGGATGGGAATGG + Intergenic
1063826494 10:9904373-9904395 TGTGTGATTCTGAAGGGGAGAGG - Intergenic
1063911846 10:10838039-10838061 TGTGACATCCTGGATGGAATCGG - Intergenic
1064579665 10:16781188-16781210 TGAGTCATTAGGAATGGGAAAGG + Intronic
1065276165 10:24088046-24088068 TGTGAGATGTGGAATGGGAATGG - Intronic
1065490305 10:26275853-26275875 TGTGCCATTTTGTATGAGAATGG - Intronic
1067065338 10:43101225-43101247 TGTGACATTGGTAATGGGAGGGG + Intronic
1067773638 10:49145423-49145445 AGTGACTTTCTAAATGGGCATGG - Intergenic
1068579244 10:58720556-58720578 TGGGGCATTCTGTGTGGGAAAGG + Intronic
1068606510 10:59010894-59010916 TGTGACATACTGCTTGGAAAAGG + Intergenic
1069645700 10:69994611-69994633 TTTGACAATCTGACTGGAAATGG - Intergenic
1071577458 10:86739755-86739777 GGAGAGATCCTGAATGGGAACGG - Intergenic
1073247605 10:102102614-102102636 TGTGGGAAGCTGAATGGGAATGG - Intergenic
1074018614 10:109561457-109561479 TGAGACAGACTGATTGGGAAGGG + Intergenic
1074248877 10:111723817-111723839 TGTGAGAGTGTGAATAGGAAAGG + Intergenic
1074253412 10:111776714-111776736 TGATACATTCTGCATGGGGACGG - Intergenic
1074991749 10:118714801-118714823 TGGGACATTCTTAATGAAAATGG + Intronic
1077772898 11:5240097-5240119 AGTGACATTCAGAAGGGCAAGGG + Intergenic
1078303995 11:10164129-10164151 GGTGACAATATGAGTGGGAATGG - Intronic
1080548360 11:33344915-33344937 TGACACATTCTGAAGGGAAAGGG - Intronic
1080867820 11:36211192-36211214 TGATACATAATGAATGGGAATGG + Intronic
1081021073 11:37948201-37948223 TGTGTTATTCTGAATGGTGAAGG + Intergenic
1082993103 11:59225807-59225829 TGAGACATACTGAAAGAGAATGG + Intergenic
1083582240 11:63832441-63832463 TGTGGGAGTGTGAATGGGAATGG + Intergenic
1084661996 11:70551430-70551452 TGTGACATTCTGCATGTGGTAGG - Intronic
1086262013 11:84951180-84951202 TGAGACATTCTAAATGGTATGGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087730561 11:101773828-101773850 GATGACATTCTTAATGGGACAGG + Intronic
1087767976 11:102177022-102177044 AGTGACATTCAGAGTGGGAAGGG + Intronic
1090903802 11:131055977-131055999 TGTGAAATTCAGAACGGGACAGG - Intergenic
1091937301 12:4444022-4444044 AGTGACTATCTAAATGGGAAAGG - Intronic
1092835863 12:12487737-12487759 TCTGACATTTTGAATGTGAAGGG - Intronic
1093725512 12:22503800-22503822 TATCACATTCTGACTGGGCACGG - Intronic
1095519794 12:43050035-43050057 TGTGCCCTTCTCAAAGGGAATGG + Intergenic
1101098384 12:101367411-101367433 GGTGACTTTCTAGATGGGAAGGG - Intronic
1106726459 13:32491132-32491154 TCTGAGATTCTGAAGGGAAAAGG + Intronic
1107810770 13:44197759-44197781 TGTGGAATTCTGACTAGGAAGGG - Intergenic
1108453183 13:50587660-50587682 TTTGACATTGTGTTTGGGAAAGG + Intronic
1108924587 13:55724962-55724984 TCTGACATTCTTAAGAGGAAAGG - Intergenic
1109907336 13:68862049-68862071 AATGTCATTCTGAATGGGAAAGG - Intergenic
1111442111 13:88293350-88293372 TGTGAAATTCTTAATAGGCAGGG - Intergenic
1111970678 13:94912037-94912059 TGTTCCATTCTCAAGGGGAATGG - Intergenic
1112108789 13:96271580-96271602 TTAGATATTCTGAATGGAAAGGG + Intronic
1112222179 13:97502130-97502152 GGTGATATGCTGAACGGGAATGG + Intergenic
1112392337 13:98997014-98997036 TCTCACAACCTGAATGGGAAAGG + Intronic
1116592121 14:46790780-46790802 TCTGATATTTTGAATGAGAAAGG + Intergenic
1119128805 14:72153099-72153121 TGTCTCATTATGAATGGGACAGG + Intronic
1119193716 14:72701986-72702008 TGTGAGATTCTGCATGGGAATGG - Intronic
1121055335 14:90847146-90847168 TGTGAAATACTGAATGGTTATGG + Intergenic
1122821614 14:104349170-104349192 TCTCAGATTCTGTATGGGAAGGG + Intergenic
1123005081 14:105317309-105317331 TGTGTCTTTCTGGATGGGCAGGG + Intronic
1123387987 15:19838528-19838550 TATGAGGTTCTGAATGGAAAAGG - Intergenic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1125016327 15:34939453-34939475 TGTGAGATTTTTAATGGTAAGGG - Intronic
1126917367 15:53481072-53481094 TGTGACTTTGAGAATAGGAATGG + Intergenic
1127620039 15:60725138-60725160 TGCCACATTCAGAATTGGAATGG + Intronic
1127960637 15:63887880-63887902 TGTGGCTTTCTGAATGACAAGGG - Intergenic
1130215039 15:81960033-81960055 TCTGACATTTTGGATGGTAATGG - Intergenic
1130351749 15:83098796-83098818 TTTGACATTCTGTATGGAAAAGG - Intergenic
1130869560 15:87959798-87959820 TGTGACTCTCTTCATGGGAACGG + Intronic
1130983774 15:88831363-88831385 TGAGACTTACTGAATGTGAAGGG + Intronic
1131317489 15:91352762-91352784 TGGTACATTTTGAATGGGGATGG + Intergenic
1131882979 15:96878278-96878300 GGTGACATTCCCAAGGGGAAGGG - Intergenic
1132116413 15:99139258-99139280 CTTGAGATTCTGAATGGAAAGGG + Intronic
1132269136 15:100507681-100507703 TTTGGCATTCACAATGGGAAAGG - Intronic
1132940656 16:2506253-2506275 TTTGAAATTTTGAATGAGAAAGG - Intronic
1135253708 16:20923179-20923201 TGTGTCAATCTGATTGGCAATGG - Intronic
1135652025 16:24214531-24214553 TCTGAGTTTCTGAAAGGGAAGGG + Intronic
1135657050 16:24259433-24259455 TAAGAAATACTGAATGGGAAAGG - Intronic
1138375871 16:56563577-56563599 TTTGCCTTTCTGAATGGCAACGG + Intergenic
1138736548 16:59257638-59257660 TGTGGAATTCTGAAAGGCAAAGG - Intergenic
1139049747 16:63109679-63109701 TATGGCTTTCTGAATTGGAAAGG - Intergenic
1140999746 16:80297297-80297319 AGTGACATTCTGAGTAGCAATGG - Intergenic
1142609290 17:1099724-1099746 TGTGAGAGTCTGATTGGGAGGGG - Intronic
1143900465 17:10170569-10170591 TGTGTCATTTTAAATGGGATGGG - Intronic
1144198079 17:12914950-12914972 TGTGAAAATCTGAACAGGAAAGG + Intronic
1144725243 17:17498564-17498586 TGGGGCATTCAGAATGGGAATGG - Intergenic
1145289834 17:21534390-21534412 TGTGTCATGCAGAAAGGGAAAGG - Exonic
1146082804 17:29797278-29797300 TGCCACATTTTGACTGGGAATGG - Intronic
1146265323 17:31449103-31449125 GGTGACTTTGGGAATGGGAAGGG - Intronic
1146427747 17:32758964-32758986 TTTGATATTCTGATTGTGAAAGG + Intronic
1146470387 17:33119835-33119857 TGTGGCCTCCTGATTGGGAAGGG - Intronic
1146582518 17:34051565-34051587 GGTGCCCTTCTGAATGGGCATGG + Intronic
1150049197 17:61942515-61942537 TGTGTCATTATAAATGGAAAGGG - Intergenic
1151587773 17:75021270-75021292 TGAAGCATTCTGAATGAGAAGGG - Intergenic
1153027665 18:686379-686401 TGTGATAGACTGAATGGAAAGGG + Intronic
1153713122 18:7819879-7819901 TGTTTCATTTTGAAGGGGAAGGG + Intronic
1155218911 18:23666982-23667004 ACTGACATTCTGATAGGGAAAGG - Intergenic
1155686771 18:28563047-28563069 TGTATCATGCAGAATGGGAAGGG - Intergenic
1156556106 18:38069934-38069956 TGGGACATTGTGAATGGCAAGGG - Intergenic
1156734762 18:40241806-40241828 TGTGACATTCTGAGAGGCACTGG - Intergenic
1158374719 18:56849965-56849987 TGTGTCATGGTGAATGTGAAGGG - Intronic
1158613377 18:58963338-58963360 AGTGAATTTCAGAATGGGAAAGG - Intronic
1159163229 18:64671108-64671130 TGTTTCAATCAGAATGGGAATGG - Intergenic
1160307600 18:77754593-77754615 TGTGACACTATGGATGGGCAAGG - Intergenic
1163299686 19:16436267-16436289 TGTGACAGTCTGAAAGTGAAGGG + Intronic
1164748485 19:30633672-30633694 TGTGACAATCTGGATGGAATTGG - Intronic
1164941792 19:32256525-32256547 TCTGAAATACTGAATGGCAAAGG - Intergenic
1166411801 19:42560518-42560540 GGTGACATTCTGAATCAGCAGGG + Intronic
1166452801 19:42916216-42916238 TGTGACATTCTGGATCAGCAGGG + Exonic
1168394918 19:56039510-56039532 TGTCATATTCTCAAGGGGAAGGG + Intronic
1168445147 19:56405304-56405326 TGTGACAGTGTGACTGAGAATGG + Intronic
925687215 2:6484430-6484452 TGTGAGTTACTGATTGGGAATGG + Intergenic
927032975 2:19141555-19141577 TGTGGCATTATGAATGGCAAGGG + Intergenic
928058308 2:28081786-28081808 TTTGACCTTCTGAAAGGTAATGG - Intronic
929134719 2:38612767-38612789 TGTGGCATTCTGAATGGCTGCGG + Intergenic
930415932 2:51091447-51091469 TGGCAGGTTCTGAATGGGAAAGG + Intergenic
932302967 2:70680490-70680512 TGTGAAATTCAGAATGGCTAGGG - Intronic
933498514 2:83082407-83082429 TGCCACATTTTGAATGGAAACGG - Intergenic
935362372 2:102257621-102257643 TGTGACTTTCTAAATGAGGATGG + Intergenic
936594776 2:113837440-113837462 TGGTACAATCTGATTGGGAAGGG + Intergenic
938532996 2:132208807-132208829 TATGAGGTTCTGAATGGAAAAGG + Intronic
938820662 2:134955658-134955680 GGTGTCATTCTGAATGCTAAAGG - Exonic
939593112 2:144090792-144090814 TCTGAGATTTTGAATGGGATTGG - Intronic
939596310 2:144127650-144127672 TGTGACCTTATACATGGGAAGGG + Intronic
940263240 2:151807476-151807498 TGTGGAATCCTGATTGGGAAAGG - Intronic
941205435 2:162566722-162566744 TCTGACATTCTGATTAGCAAAGG + Intronic
941425503 2:165339758-165339780 TGTGACATTTTTACTGGGATTGG - Intronic
943643173 2:190381149-190381171 TGTAACATTCTGACAGGGAAGGG - Intergenic
947339715 2:229125220-229125242 TATGACATTCTAAATGGAAGAGG + Intronic
948337389 2:237221090-237221112 TGTTAATTTCAGAATGGGAAAGG - Intergenic
1169554664 20:6736438-6736460 TCTGTCATTCTAAGTGGGAAGGG + Intergenic
1170432876 20:16293408-16293430 TTTGAAATTCTGAATGAAAATGG + Intronic
1172860599 20:38047305-38047327 TGAGACATTCTGACTGGGCTAGG + Intronic
1174505934 20:51017649-51017671 TCAGACATTCCGACTGGGAAGGG - Intronic
1174539189 20:51275795-51275817 TGGGTCATTCTGGAAGGGAAGGG - Intergenic
1176360132 21:5988264-5988286 TGTGACATGGAGAATAGGAAGGG + Intergenic
1176908123 21:14529043-14529065 TGTGTGATTCTGTATGGTAATGG + Intronic
1178158553 21:29883678-29883700 TGTGACATTCTGAATGGGAATGG + Intronic
1178545345 21:33488723-33488745 TTTGACAATCTCAGTGGGAAAGG - Exonic
1179076907 21:38130730-38130752 TATGATATTCTGAATGGTGACGG + Intronic
1179763386 21:43550286-43550308 TGTGACATGGAGAATAGGAAGGG - Intronic
1181798951 22:25331606-25331628 TTTGACCTCCTGAATGGAAAAGG + Intergenic
1183125333 22:35774169-35774191 TGGGACATTCTGAGAGAGAAAGG + Intronic
1183764213 22:39855964-39855986 GGGGACATTCTTAATGGGACAGG - Intronic
949193207 3:1274779-1274801 TATGACATTCTGAGTGGTTAGGG - Intronic
949797663 3:7868347-7868369 TATAAGATTCTTAATGGGAAAGG - Intergenic
951500146 3:23376880-23376902 TGTGACATTCGCAAGGGGAGGGG + Intronic
953799054 3:46007732-46007754 TGTGACATTTTGGCTGGGCATGG + Intergenic
954461439 3:50629244-50629266 TGTGACCTGCTGAATTGGAGAGG + Intronic
955081601 3:55662898-55662920 TGAGACATGCTGAATGAGAGAGG + Intronic
957590383 3:82189536-82189558 TGTTTCATTCTGAATAGAAATGG - Intergenic
959025181 3:101232793-101232815 TGTGACATTATGCCTGGGCACGG - Exonic
959340151 3:105118538-105118560 GGAGACATTAAGAATGGGAAGGG - Intergenic
959477371 3:106827428-106827450 TGAGACAATTTAAATGGGAAGGG - Intergenic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
964601325 3:158503898-158503920 TGTAACAATTTGAATGGGATGGG - Intronic
966068640 3:175847375-175847397 GGTGTAATTCTGAAAGGGAAGGG - Intergenic
967369270 3:188725329-188725351 GGATACATTTTGAATGGGAACGG - Intronic
968329518 3:197854395-197854417 TGAGACCTTCTGGATGGGAAGGG - Exonic
970246071 4:14065125-14065147 TGTCCCATTATGAATGTGAATGG - Intergenic
970708096 4:18829711-18829733 TGTCATATTCTAAATGGGAAGGG + Intergenic
973958259 4:56085050-56085072 TGTGTGATTGTGAGTGGGAAGGG + Intergenic
976194714 4:82521624-82521646 TGTAAGATGCTGAAAGGGAATGG + Intronic
977458123 4:97288853-97288875 TGTGACAATCTGGATGGAAATGG - Intronic
977890939 4:102310383-102310405 TGTGTGATTCTCAATGAGAAGGG + Intronic
977989760 4:103426879-103426901 AGTGAAATTGAGAATGGGAATGG + Intergenic
979158567 4:117429492-117429514 AGTGGCATTCTGGAAGGGAAGGG + Intergenic
980670104 4:135994327-135994349 TCTGCCATTTGGAATGGGAATGG - Intergenic
980907386 4:138961693-138961715 TGTAAGATTCAGAATGGGGAGGG - Intergenic
981450419 4:144890709-144890731 TGGGACATTGTGACTTGGAATGG + Intergenic
981886536 4:149680765-149680787 TATGAAATTGTGAATGGAAAAGG - Intergenic
982581769 4:157187989-157188011 TGTGACAATGTTACTGGGAAGGG - Intergenic
983825689 4:172256563-172256585 TTTAGCATTCTGAGTGGGAAAGG - Intronic
986345221 5:6828564-6828586 AGTGACAATCAGAAGGGGAAAGG - Intergenic
986673126 5:10160644-10160666 TGTGACATTGTTACTGGAAAGGG - Intergenic
987621996 5:20346696-20346718 TGGTACGTTCTTAATGGGAAGGG - Intronic
988880873 5:35500630-35500652 TATGACATTCTGAGTGGCCAGGG + Intergenic
990779088 5:59337811-59337833 TGGGGTATTCTGAATGGGCATGG + Intronic
992567893 5:78019718-78019740 TTTGACATTGTGAATTGCAAAGG + Intronic
993194778 5:84727737-84727759 TATAACACTCAGAATGGGAAAGG + Intergenic
994958828 5:106571460-106571482 TGGGAGACTCTGAAAGGGAAGGG + Intergenic
995072758 5:107943248-107943270 TTTGGCATACTGAATGGAAAGGG - Intronic
998494840 5:142579449-142579471 TGTGACAGTCTGGCTGGGTATGG - Intergenic
1000418472 5:161009847-161009869 GGAGACATTAAGAATGGGAAAGG + Intergenic
1000599478 5:163254529-163254551 TGGGACTTTGTGAATGTGAATGG - Intergenic
1000698943 5:164423614-164423636 TGTGACATTCTGATTGTCCAAGG + Intergenic
1000724348 5:164751005-164751027 TATGAAATTCTTAATAGGAAGGG - Intergenic
1004738576 6:18433232-18433254 TGTAAGGATCTGAATGGGAAGGG + Intronic
1004839899 6:19570891-19570913 AGTGAAATTCTTGATGGGAAGGG + Intergenic
1006021840 6:31121951-31121973 AGTGACACTCAGAATGGGAGTGG + Intronic
1009564045 6:65287719-65287741 TGTGACTTTTTAAATGGCAAAGG - Intronic
1015218056 6:130772988-130773010 TGTGAGATGATGAATGGGAAGGG - Intergenic
1015329964 6:131965687-131965709 TCTAAAATTCTGAAAGGGAAAGG + Intergenic
1015571824 6:134629690-134629712 TGTCACATCCTGAAAAGGAATGG + Intergenic
1016009383 6:139123132-139123154 TGTGCCATTTTCAAAGGGAATGG + Intergenic
1017502644 6:155039600-155039622 TCTTACAATTTGAATGGGAATGG + Intronic
1018140036 6:160822480-160822502 TGTGACGTTTTAAATGGCAAAGG - Intergenic
1018928528 6:168223602-168223624 TGTCACATTAAAAATGGGAATGG + Intergenic
1018937332 6:168282357-168282379 TGTGACATTGGGAATGAGGAGGG + Intergenic
1021243989 7:18239348-18239370 TCTGACATTCTGACTTGAAAAGG + Intronic
1022483888 7:30763025-30763047 TCTGTCACTCTGAATGGAAATGG + Intronic
1023577267 7:41641813-41641835 TGTTACAATGTGAATGGGAGGGG + Intergenic
1029433340 7:100546710-100546732 CCTGACATTCTGAAGGGGAAGGG + Intronic
1030225744 7:107148267-107148289 TCTGACAATCTGAATCTGAACGG - Intronic
1031847125 7:126819250-126819272 TGTGTCTGTCTGAATAGGAAGGG - Intronic
1033875607 7:145814035-145814057 TGTGACATACTCAATGAAAAAGG - Intergenic
1033881022 7:145884023-145884045 TGTGTGAATCTGAATTGGAAGGG + Intergenic
1034367307 7:150562304-150562326 AGTGACAATATGAATGGAAAGGG + Intergenic
1035061303 7:156071536-156071558 TGAGACATTCAGAAAGGAAATGG - Intergenic
1036076156 8:5503187-5503209 TGTGACAACATGAATGGAAATGG - Intergenic
1040560076 8:48515828-48515850 TGTGAGACTGTGAGTGGGAAGGG - Intergenic
1041199463 8:55437018-55437040 TGTTGAATTCTGAATAGGAACGG - Intronic
1042357073 8:67839910-67839932 AGAGACAGTCTGACTGGGAATGG + Intergenic
1042988087 8:74605428-74605450 TGTGACATTTAGAAGGGAAATGG + Intronic
1044101303 8:88143159-88143181 TGGGTCAATCTGAATAGGAAGGG + Intronic
1046128167 8:109936535-109936557 AGAGACATTCTGAATAAGAATGG + Intergenic
1046269020 8:111868735-111868757 TGTGACAATGTGGATGGAAATGG + Intergenic
1046378754 8:113424052-113424074 TGTGACTTACAGAATGTGAAAGG + Intronic
1046497074 8:115027823-115027845 AGTGAAACTCTGAATGTGAAAGG - Intergenic
1049607326 8:143535826-143535848 TGTGACACTCAGAAAGGGCAGGG + Intronic
1050196152 9:3086522-3086544 TGTTACATGCTAAATGAGAAGGG - Intergenic
1050642721 9:7685525-7685547 AGTGACATTCTAAATGAGATGGG + Intergenic
1050716337 9:8530746-8530768 AGAGAGATTCTGAATGTGAATGG + Intronic
1051329888 9:16013057-16013079 GGGGACATTTTGAGTGGGAAAGG - Intronic
1052363566 9:27586493-27586515 TGTAACATTTTAAATTGGAAAGG + Intergenic
1053936086 9:43153077-43153099 TATGAGGTTCTGAATGGAAAAGG + Intergenic
1055563307 9:77543255-77543277 AGGGTCATTCTCAATGGGAACGG + Intronic
1059037769 9:110776618-110776640 TGTTATAATCTGAAGGGGAAAGG - Exonic
1060232535 9:121836347-121836369 TGTGAGATTCTGAAGGGCATGGG + Intronic
1186921974 X:14292225-14292247 TGTGACTTTGTGAATGGATATGG + Intergenic
1187296551 X:18007164-18007186 TCTGACTTTCTGAATTGGCATGG - Intergenic
1188099051 X:26060116-26060138 TCTACCATTCGGAATGGGAAAGG - Intergenic
1188345421 X:29058411-29058433 TGTGACATTTTACCTGGGAATGG - Intronic
1191887564 X:65904371-65904393 TGTAAAATCCTGAATAGGAAGGG + Intergenic
1194076883 X:89406020-89406042 TATGACATTCTGGGTGGGAACGG - Intergenic
1196241681 X:113349574-113349596 TGTGACTTTCTCACTGGGCATGG + Intergenic
1196403802 X:115343685-115343707 TGTGACAACCTGGGTGGGAAGGG - Intergenic
1198152190 X:133922254-133922276 TGAGAGATTCTCAGTGGGAAAGG - Intronic
1198214832 X:134546108-134546130 GGTGGTATTCTGATTGGGAAGGG + Intergenic
1200429527 Y:3061549-3061571 TATGACATTCTGGGTGGGAACGG - Intergenic
1201689055 Y:16742417-16742439 TGTGAATTTCTGAATAGCAAAGG - Intergenic