ID: 1178159456

View in Genome Browser
Species Human (GRCh38)
Location 21:29894799-29894821
Sequence CTCAAACAGAAGTGGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178159456_1178159460 15 Left 1178159456 21:29894799-29894821 CCCTGGATCCACTTCTGTTTGAG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1178159460 21:29894837-29894859 ACATATTCACCTGTTTAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178159456 Original CRISPR CTCAAACAGAAGTGGATCCA GGG (reversed) Intronic
901742164 1:11349289-11349311 CTCAAACAAGAGTGGGTCGAGGG + Intergenic
913118131 1:115715140-115715162 ATCAAACAGAATCGGATCCCTGG - Intronic
913332430 1:117678617-117678639 CTCAAGAAGAAGTGGTGCCAGGG - Intergenic
914442442 1:147719254-147719276 TTCAAACAATAGTGGCTCCAAGG - Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915419188 1:155766094-155766116 CTCAAAGAGAAGAGGAGTCAAGG - Exonic
917177682 1:172255435-172255457 GTCAAACAAAATTGAATCCATGG + Intronic
922593954 1:226799334-226799356 CTCAGACAGAAGAGGCTCCCAGG - Intergenic
1063046019 10:2393111-2393133 CCCACACAGAAGGGGAGCCAAGG - Intergenic
1063421699 10:5917321-5917343 CCCATACAGCAGTGGAGCCAGGG - Intronic
1067346487 10:45442137-45442159 CTCAGCCAGAAATGGATCCAGGG + Intronic
1067568452 10:47354488-47354510 CACACACAGAACTGGAGCCAGGG - Intronic
1067773847 10:49147070-49147092 CTCAAAAAGAAGTTGAGCCTGGG - Intergenic
1070612506 10:77943255-77943277 CTCTAACAGAGGTGGAAGCACGG - Intergenic
1071152377 10:82650630-82650652 CTTAAACTGATGTGGATGCATGG - Intronic
1074849750 10:117430195-117430217 ATAAAACACAAGTGGCTCCATGG - Intergenic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1081207702 11:40293902-40293924 TTCAAACCGAAGTGGATGGAAGG - Exonic
1081669740 11:44936402-44936424 TTCAAACAGAAGTGGCTCTGGGG + Intronic
1084015079 11:66373812-66373834 CTAAAACTGCAGTGAATCCACGG + Intergenic
1087468015 11:98534819-98534841 CTGAAACCAAAGTAGATCCATGG - Intergenic
1089443046 11:118531929-118531951 CCCAAACAGAAGTGCAGACAGGG - Intronic
1091121128 11:133058530-133058552 ATAAAACAGAAGTGGACACAGGG - Intronic
1092643835 12:10547631-10547653 CTCAAATAGAGGTGTTTCCAGGG - Intergenic
1093930412 12:24949927-24949949 CTCAAACAGAACTGGGCCCTTGG + Intergenic
1094116076 12:26914784-26914806 CTCAAACATAAATGCATTCATGG + Intronic
1095342604 12:41109454-41109476 CTTAATGAGAAGTGGATGCAGGG - Intergenic
1097134311 12:56838909-56838931 CTCAAACAGAAATAGTCCCAGGG + Intergenic
1097675816 12:62602292-62602314 CAAAAGCAGAAGTGGCTCCATGG + Exonic
1100739830 12:97579777-97579799 CTCTATCAGAAGAGGATACAAGG + Intergenic
1101829077 12:108243087-108243109 CTCAAACTCAAGTGTCTCCAGGG - Intronic
1103197655 12:119059115-119059137 CCCAAACAGAAGTGGTTACAGGG - Intronic
1104033942 12:125085413-125085435 ATGAAACAGACGTGGATGCAAGG - Intronic
1104138807 12:125966722-125966744 CTTAGTCAGAAGTGAATCCAAGG - Intergenic
1104356919 12:128095087-128095109 CAAAAACAGAATTGGAACCAAGG - Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108101576 13:46962458-46962480 CTCATGCAGAAGCTGATCCATGG + Intergenic
1108114528 13:47112284-47112306 CCCAAAGAGAACAGGATCCATGG - Intergenic
1108568947 13:51730447-51730469 CGTAAAGAGAAGGGGATCCAGGG - Intronic
1111718042 13:91905451-91905473 TACAAAAAGAAGTGGGTCCAAGG + Intronic
1113320467 13:109227765-109227787 CTGAAACAGAAGTCACTCCAGGG - Intergenic
1114145491 14:19972007-19972029 ATAAGACAGAAGTGGATTCAGGG - Intergenic
1114779354 14:25520785-25520807 CCCAAGCAGGAGTGGATCCTGGG + Intergenic
1115282121 14:31675910-31675932 ATGAAACAGAAGGGGACCCAAGG - Intronic
1117437256 14:55728294-55728316 ACCTAACATAAGTGGATCCATGG - Intergenic
1120486140 14:85115285-85115307 TTCCCACAGAAGTGCATCCAAGG + Intergenic
1122281763 14:100627648-100627670 CTCAAAGAGAAGAGGAGGCAGGG - Intergenic
1125363581 15:38889950-38889972 GTCAAACAGAGGTGGACCTACGG - Intergenic
1126384761 15:48082853-48082875 CTCAAACAAAGGTGTCTCCAAGG - Intergenic
1137454413 16:48607532-48607554 CTCTAACACAAGTTGAACCAGGG + Intronic
1138241125 16:55427945-55427967 CCTAAACAGAAGTGGGTCAAAGG + Intronic
1143310904 17:5988096-5988118 CTCAACCAGAAGTAGATGCTTGG + Intronic
1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG + Intronic
1149075239 17:52589044-52589066 CTAACACAGAAGTGGATAAATGG - Intergenic
1152960656 18:78600-78622 ATGAAACAGAAGTTGATACAAGG - Intergenic
1155260711 18:24039366-24039388 CACAAAGAGAAGTGTATTCAAGG + Intronic
1156292046 18:35755806-35755828 CTCATCCAGAACTGGAACCAAGG - Intergenic
1158575216 18:58631481-58631503 CACAAACAGAACATGATCCAGGG + Intergenic
1161609137 19:5231350-5231372 CTCACACAGAGGTGGGACCAGGG - Exonic
1164912594 19:32025081-32025103 CTCAAAGAGAGATGGCTCCAAGG - Intergenic
926233360 2:11021447-11021469 CTCAGACAGAAGTCTATCCAGGG + Intergenic
927922544 2:26984507-26984529 CTCAGACAGCAGTGGCACCAGGG + Intronic
929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG + Intergenic
930472217 2:51831629-51831651 CTCAAACTTTAGTGGAACCACGG - Intergenic
934068752 2:88364479-88364501 TTAAAAAAGAAGAGGATCCAAGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
937810430 2:126193824-126193846 CTGAAACAGAAGTTGATCACTGG + Intergenic
943582008 2:189695224-189695246 CTCAAACAGATGTTTATCCTAGG + Intronic
945485785 2:210394376-210394398 CTGAAACAGAAATGGATTCATGG - Intergenic
947302924 2:228708394-228708416 CTCAAACAAAAATGGCTCAAGGG - Intergenic
948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG + Intergenic
1169180163 20:3557488-3557510 CTCAAACAAGAGTGAATTCAGGG + Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170532278 20:17306421-17306443 CTCAAACAGAAGATGGTCCCAGG + Intronic
1172331594 20:34079458-34079480 CTCAAACACTAGTGTTTCCAGGG + Intronic
1177344475 21:19852433-19852455 CTTACACAGAATTAGATCCAAGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178200209 21:30394579-30394601 TGCAAACAGCTGTGGATCCAGGG - Intronic
1179275843 21:39891067-39891089 TACAGACAGAAATGGATCCAAGG + Intronic
1179309107 21:40181147-40181169 CACAAACAGAAATGTATGCATGG - Intronic
1181938117 22:26453391-26453413 CTCCAACAGAAATGCCTCCACGG - Exonic
1184932379 22:47690828-47690850 CTTACACAGAAGTGGTTCCCAGG - Intergenic
949349458 3:3110763-3110785 ATCAAACAGAAATGGAACAAAGG - Intronic
951668729 3:25156372-25156394 CTCAAACAGATGGGATTCCAGGG - Intergenic
951930903 3:27966189-27966211 CTCAAACAGAGATAGATCAATGG + Intergenic
952934591 3:38386290-38386312 GGCAAACAGAAGTGGCTCAAGGG - Intronic
953199617 3:40767292-40767314 TTCAAACAGAAATGCATCCCAGG - Intergenic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
957034793 3:75283783-75283805 CTCAAAGAGAAGTGTAGCCCTGG + Intergenic
960507735 3:118513779-118513801 CTCAAGGACAATTGGATCCATGG - Intergenic
961078668 3:124005370-124005392 CTCAAACAGAAGTACAGCCCTGG + Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
964733190 3:159889441-159889463 CTCTAACAGAAGTGGCCACAGGG + Intronic
968147660 3:196312797-196312819 CTCAAACACAAAAGAATCCAGGG + Intronic
972245622 4:37243746-37243768 CTCCACCTGAAGTTGATCCAGGG - Intergenic
973248531 4:48036978-48037000 TTAAAACAGAAGTGAAACCACGG + Exonic
974060043 4:57024602-57024624 TTCAAATAGAAGTCGATCCATGG - Intronic
975484662 4:74922298-74922320 CTCAAGGACAAGTGGAACCAGGG + Intergenic
976663243 4:87562532-87562554 TTCAAACAGAAATGCTTCCATGG - Intergenic
976843692 4:89462109-89462131 GACAAATAGAAATGGATCCATGG - Intergenic
976868710 4:89764027-89764049 CAGAAACAGATGGGGATCCAAGG + Intronic
981667712 4:147248336-147248358 AGCAAACAGAAGTGGATGGAGGG - Intergenic
985017492 4:185651692-185651714 CTCAAACAGAAGGGGAAAAAAGG + Intronic
989609688 5:43279130-43279152 CTCAATAAGATGTGGATCTATGG - Intronic
993229159 5:85209885-85209907 TACAAACAGCAGTGGATCAAGGG + Intergenic
993620722 5:90164632-90164654 CTCAAACTGAAGTGCCTTCAGGG + Intergenic
995819514 5:116213275-116213297 CTCAAACAGATGTGAATACTAGG + Intronic
1001292966 5:170477943-170477965 CTCCAATAGAAGTGCCTCCAGGG + Intronic
1001743429 5:174071840-174071862 CTCAAATGGAAGGGGATCCCCGG + Intronic
1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG + Intergenic
1010624199 6:78116207-78116229 CTCACACATAAGTGGAAGCAAGG - Intergenic
1011162988 6:84413132-84413154 ATCCAACAGGACTGGATCCAGGG - Intergenic
1012777444 6:103515902-103515924 ATCAAATAGAAAAGGATCCATGG - Intergenic
1016042420 6:139444830-139444852 CTCAAACAGAAAGAGATCTAGGG - Intergenic
1016807950 6:148232049-148232071 GTCAAACAGAATTGGGTTCAAGG - Intergenic
1017948132 6:159113230-159113252 CTCTAACCGTAGAGGATCCACGG + Intergenic
1018198603 6:161376121-161376143 CTGAAGCAGCAGTGGCTCCAGGG - Intronic
1018941231 6:168309871-168309893 TCCAAACACCAGTGGATCCAGGG + Intronic
1023926789 7:44675321-44675343 CTAAGAAAGAAGTGGAGCCAGGG - Intronic
1024165044 7:46722635-46722657 CTCAGACAGACGTGGAGCCTTGG + Intronic
1024645799 7:51369344-51369366 TTCAGACAGAAGTGGTACCACGG - Intergenic
1025036657 7:55597461-55597483 TTCAGACAGAAGTGGTACCACGG - Intergenic
1026764619 7:73152720-73152742 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027041089 7:74962488-74962510 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027082548 7:75239885-75239907 CCCAAACAGAAATGCATTCAGGG + Intergenic
1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG + Intronic
1030742245 7:113123903-113123925 CACAGACAGTAGAGGATCCAGGG + Intergenic
1030979699 7:116171823-116171845 CTCAGACTCAGGTGGATCCAAGG + Intergenic
1032000410 7:128261546-128261568 CACACACAGAACTGGCTCCAGGG + Intergenic
1032679700 7:134168913-134168935 TTCCAAGAGAAGTGGCTCCATGG - Intronic
1033441678 7:141385794-141385816 CAGAAATAGAAGTGGACCCAAGG - Intronic
1037776288 8:21838120-21838142 CATAAATAGAAGTGGATTCAGGG - Intergenic
1038186084 8:25276204-25276226 CTTAAACTTAAGTGGATCCTGGG + Intronic
1049890471 9:65377-65399 GTCTAACAGAAGGGTATCCAGGG + Intergenic
1059299671 9:113302285-113302307 CTGAAACAGCAGTGGATCCCTGG - Intronic
1059671360 9:116495496-116495518 CTCAGACACAACTGGGTCCAGGG - Intronic
1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG + Intronic
1062737441 9:138145147-138145169 ATGAAACAGAAGTTGATACAAGG + Intergenic
1187797455 X:23019911-23019933 CTCAAACAGAAGGGGAAACAGGG + Intergenic
1189058626 X:37727881-37727903 CTGCACCAGAAGAGGATCCAGGG - Exonic
1189091489 X:38087701-38087723 ATCAAACAGAAGTTAATCAAAGG - Intronic
1190822793 X:53989813-53989835 CTCATACAGAGCTTGATCCATGG + Intronic
1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG + Intergenic
1196411522 X:115424966-115424988 CCCAGAGAGAAGTGGATGCAGGG + Intergenic
1199514188 X:148656871-148656893 ATCATACAGAACTGGATGCAAGG - Intronic