ID: 1178159460

View in Genome Browser
Species Human (GRCh38)
Location 21:29894837-29894859
Sequence ACATATTCACCTGTTTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178159454_1178159460 17 Left 1178159454 21:29894797-29894819 CCCCCTGGATCCACTTCTGTTTG 0: 1
1: 0
2: 3
3: 14
4: 202
Right 1178159460 21:29894837-29894859 ACATATTCACCTGTTTAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 142
1178159456_1178159460 15 Left 1178159456 21:29894799-29894821 CCCTGGATCCACTTCTGTTTGAG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1178159460 21:29894837-29894859 ACATATTCACCTGTTTAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 142
1178159459_1178159460 7 Left 1178159459 21:29894807-29894829 CCACTTCTGTTTGAGTATATGGA 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1178159460 21:29894837-29894859 ACATATTCACCTGTTTAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 142
1178159455_1178159460 16 Left 1178159455 21:29894798-29894820 CCCCTGGATCCACTTCTGTTTGA 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1178159460 21:29894837-29894859 ACATATTCACCTGTTTAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 142
1178159457_1178159460 14 Left 1178159457 21:29894800-29894822 CCTGGATCCACTTCTGTTTGAGT 0: 1
1: 0
2: 0
3: 10
4: 162
Right 1178159460 21:29894837-29894859 ACATATTCACCTGTTTAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178159460 Original CRISPR ACATATTCACCTGTTTAACT TGG Intronic
904156958 1:28491933-28491955 ACATTTTGACTTGTTCAACTTGG - Intronic
907738639 1:57141188-57141210 TTATATTCCCCTTTTTAACTGGG - Intronic
909091820 1:71235217-71235239 GCATATTCACATAGTTAACTAGG + Intergenic
909634877 1:77806096-77806118 AAATATTCACCTAATTAATTAGG - Intronic
909941411 1:81615926-81615948 ACACTTTCACCTGATTAAATTGG + Intronic
911487788 1:98524309-98524331 ACATATTCAGATGTTTCACATGG - Intergenic
911863186 1:102981573-102981595 ATATATTCAACTGATTAATTGGG - Intronic
913237986 1:116801570-116801592 ACACAGTCACCTGCTTAGCTAGG + Intergenic
916302527 1:163292057-163292079 ACATGTTTACCTGTGTAACAAGG - Intronic
917014611 1:170515645-170515667 ACATTTTTTCCTGTTAAACTTGG + Intergenic
918798712 1:188941693-188941715 ATATATTCAGCAGTTTAAATTGG + Intergenic
921819502 1:219601185-219601207 ACTTATTCAACTGTCTATCTGGG - Intergenic
923118331 1:230965432-230965454 GCATATACACCATTTTAACTGGG - Intronic
923950881 1:238952180-238952202 ACACATTCAGCTGTTTAAACAGG - Intergenic
924445371 1:244124860-244124882 ACTTATTCAGCTTTTTAAATTGG - Intergenic
1066182006 10:32971703-32971725 ACAGTTAGACCTGTTTAACTTGG + Intronic
1066929132 10:41734841-41734863 AGATATTCACTTTTTTCACTTGG - Intergenic
1069203953 10:65658473-65658495 ACATATTCTCATGTATAAGTGGG + Intergenic
1069737134 10:70664165-70664187 ACATATTCACCTGATGCAATGGG - Intergenic
1069930984 10:71881359-71881381 GCTTAGTCACCTATTTAACTAGG - Intergenic
1071901910 10:90129565-90129587 AGATATTCATCTGTTTATCCTGG + Intergenic
1074133084 10:110600534-110600556 ACATACACACCTGTTCTACTTGG - Exonic
1080072278 11:28104061-28104083 AAAAATTGACCTGTTCAACTTGG - Intronic
1082116053 11:48329343-48329365 ACATATTCACTTTTTACACTAGG + Intergenic
1086211101 11:84319963-84319985 ACATATTTATCTGTTTAAGTGGG - Intronic
1091567539 12:1660130-1660152 ACACATACACTTGTTTATCTGGG + Intergenic
1093294986 12:17378863-17378885 ACCTATACAACTGTTAAACTGGG + Intergenic
1094355000 12:29567594-29567616 ACATCTCCACCTGTTAAACCTGG + Intronic
1095331125 12:40965958-40965980 ACTTACACGCCTGTTTAACTTGG - Intronic
1096316331 12:50570053-50570075 AGAGATTCACTTGTTTGACTGGG + Intronic
1096856255 12:54486087-54486109 ACATATTCTCATGTTTAAGTGGG + Intergenic
1097258775 12:57700962-57700984 ACATTAACATCTGTTTAACTTGG - Intronic
1100954390 12:99890747-99890769 GCTTATTCAACTGTTTAATTGGG - Intronic
1103599546 12:122045655-122045677 ATATATCCACCTGCTGAACTTGG + Intronic
1107333106 13:39322917-39322939 ATCTATTCACTTGCTTAACTAGG + Intergenic
1108250325 13:48560458-48560480 AAATATTTACATGTTAAACTGGG + Intergenic
1108784869 13:53886061-53886083 GCATATTTACATTTTTAACTGGG + Intergenic
1108828377 13:54445183-54445205 ACATATTCTCATGTATAAGTGGG - Intergenic
1110024584 13:70519601-70519623 ACATACTCACCAGTTTTAATTGG - Intergenic
1110150749 13:72250305-72250327 ACATGTTAACATGTTCAACTAGG - Intergenic
1110730195 13:78871515-78871537 AGACATTCACATGTTTAAATAGG + Intergenic
1114352806 14:21872370-21872392 ACATATTCAACTGTTTCCTTAGG + Intergenic
1114977520 14:28120558-28120580 GCATATTTAGGTGTTTAACTAGG + Intergenic
1118836165 14:69479503-69479525 TCATATTCACCTTTCTCACTAGG - Intergenic
1120102364 14:80460209-80460231 ACATATACATATGTATAACTGGG - Intergenic
1120164880 14:81186992-81187014 ACATACACACCTGTGTAAGTAGG - Intronic
1125211841 15:37225857-37225879 ATATATTCAGATCTTTAACTTGG - Intergenic
1132235978 15:100222001-100222023 ACAAATCCACCTGGTTGACTGGG - Intronic
1135389454 16:22077734-22077756 ACTCATTAACCTGTTTGACTAGG - Intronic
1139076026 16:63449182-63449204 ACATTTTCTTCTCTTTAACTAGG + Intergenic
1145227721 17:21144492-21144514 AAATATTCACCATTTAAACTTGG - Intronic
1149161498 17:53699209-53699231 ACAAATTCGCATGTTTAACTAGG - Intergenic
1151564610 17:74890887-74890909 TCAGATTCACCTGTGGAACTTGG + Intronic
1156989901 18:43396694-43396716 ACATATTCCCCTGTTTCTTTAGG - Intergenic
1158769981 18:60504142-60504164 ACATATTCACCTAATCATCTAGG - Intergenic
1159062158 18:63527309-63527331 AGATATTGACCTGTTTGACCTGG + Intergenic
1162177620 19:8842970-8842992 AGAGATCCACCTGTGTAACTAGG - Exonic
1165636977 19:37348768-37348790 ACATAAGCACCCGTTTATCTAGG + Intronic
1166586989 19:43958148-43958170 GGATTTTAACCTGTTTAACTGGG - Intronic
1168626714 19:57924275-57924297 CCATTTTCACCTGATTAAATTGG + Intronic
926488627 2:13495781-13495803 ACATGTTCTCCTGTGTAAGTGGG + Intergenic
926529221 2:14021472-14021494 AATTATTAACCTGTTTTACTAGG + Intergenic
927483514 2:23472910-23472932 ACATATTCAAATGTGTAATTTGG + Intronic
927890775 2:26747271-26747293 TCATTTTCACCTGTTCAGCTGGG - Intergenic
929222724 2:39481660-39481682 ACATATGCACCTGTGTAAGTTGG + Intergenic
930346349 2:50187305-50187327 ATATATCCACCTTTTTACCTTGG - Intronic
933866780 2:86526377-86526399 ACCTTTTCACCTTTTTGACTTGG - Intronic
935075968 2:99744191-99744213 ACATGATCTCATGTTTAACTTGG - Intronic
937806170 2:126148190-126148212 ACATAATCACCTTTTGATCTTGG - Intergenic
938637701 2:133247622-133247644 ACATATTCATATTTTTAAGTGGG - Intronic
938826381 2:135009748-135009770 ACATATTAACCCATTTATCTCGG + Intronic
942262681 2:174185290-174185312 ACATATTCTCAAGGTTAACTGGG + Intronic
946539314 2:220666361-220666383 ACATATTCTCCTCTTTGTCTAGG + Intergenic
946770978 2:223088718-223088740 AAATACTAACCAGTTTAACTGGG + Intronic
1169702301 20:8460700-8460722 ACATATTCACATATTTTACTTGG + Intronic
1172261434 20:33569250-33569272 ACATATTATCCTTTTAAACTAGG - Intronic
1173320384 20:41982246-41982268 ACATTTACACCTGTATCACTAGG + Intergenic
1174716479 20:52764499-52764521 ACATACATACCTGTATAACTTGG - Intergenic
1178159460 21:29894837-29894859 ACATATTCACCTGTTTAACTTGG + Intronic
1181928731 22:26381655-26381677 ACACACTCACCGGTTTCACTGGG - Intronic
949960431 3:9307490-9307512 AAACATTCACCTGTATAGCTGGG - Intronic
957582240 3:82089289-82089311 ACATACTCAACTGCTCAACTGGG - Intergenic
959554888 3:107705274-107705296 CCATACTCTCCTGTTTCACTGGG + Intronic
960625865 3:119681640-119681662 ACATATTTACCTGTGGAAATTGG - Intergenic
963817786 3:149852310-149852332 ACATATACAACTGCTTAAATTGG - Intronic
964296827 3:155242306-155242328 ACATATTCACATGTATGATTTGG + Intergenic
965252426 3:166359483-166359505 TAATTTTCACCTGTTTCACTGGG - Intergenic
967752833 3:193133901-193133923 ACATCTTCACCAGTCTAATTTGG + Intergenic
968421955 4:492911-492933 ACTTATTCACCTTTTTAAAAAGG + Intronic
970841619 4:20478191-20478213 AATTATTCACTTGTTTAACTTGG + Intronic
971779770 4:31018272-31018294 AAATATTCACCAATGTAACTTGG + Intronic
972026894 4:34391361-34391383 ACACATTAATCTGTTTCACTGGG + Intergenic
973039596 4:45453777-45453799 AAATATTCACCAATTTGACTAGG - Intergenic
973668148 4:53184184-53184206 ACATAACCACCCGTTTAGCTTGG + Intronic
973928321 4:55762929-55762951 CCCTATTCAGCTATTTAACTGGG - Intergenic
974466491 4:62263414-62263436 ACATATTAACTGGTTTAAGTAGG + Intergenic
977796346 4:101169640-101169662 ACATATTCACCTATAGAACTGGG - Intronic
979731809 4:124032271-124032293 CCAAATTCTCCTGTTGAACTGGG + Intergenic
984072379 4:175131261-175131283 ACATATTCACCTGGGTTCCTCGG - Intergenic
985125397 4:186688777-186688799 ACAGATACACCTGTTTCATTTGG - Intronic
986858456 5:11900120-11900142 AAATATTCACCTGTCTCTCTTGG - Intronic
989626918 5:43438462-43438484 TTATTTTCACCTCTTTAACTCGG - Intergenic
990725722 5:58752508-58752530 ACTTATTCAAATGTTTAACACGG - Intronic
993462906 5:88207698-88207720 ACATGTTCACCTATTAAAATAGG + Intronic
994088920 5:95791267-95791289 ACTTAATGACCTATTTAACTGGG - Intronic
996262091 5:121484300-121484322 ACATATCCAACTGCTTACCTGGG + Intergenic
996548125 5:124702568-124702590 ACTGCTTCAGCTGTTTAACTAGG - Intronic
997982405 5:138476669-138476691 ACATTTTCACCTCTTGGACTGGG + Intergenic
1000782830 5:165504964-165504986 AGATATTTACCCTTTTAACTGGG + Intergenic
1000960083 5:167589686-167589708 AAATATTCACCTGTTTAAGTGGG - Intronic
1009566146 6:65313405-65313427 ACTTATTCAACTGTCTATCTGGG + Intronic
1011826491 6:91311959-91311981 ACACATTCACCCGTTTATTTTGG - Intergenic
1011963277 6:93118926-93118948 ATATATTCACCTTTTTCAATAGG - Intergenic
1012872213 6:104685664-104685686 ACATTTTCACTTGTTCACCTTGG + Intergenic
1013575536 6:111481449-111481471 TCATATTCACTAGTTTAAATAGG + Intronic
1014906204 6:127031499-127031521 AGAAATTCAACTGTTTAAGTAGG + Intergenic
1018358793 6:163044970-163044992 AAGCATTCAGCTGTTTAACTGGG + Intronic
1028692461 7:93668811-93668833 AAATATTCACCTTTTTAAATAGG - Intronic
1028810767 7:95083183-95083205 ACAGATTTACCTGTTTCTCTGGG - Intronic
1029893465 7:103956604-103956626 ACATCTTCTCCTTTTAAACTAGG - Intronic
1030438369 7:109553531-109553553 GAATATTGACCTGTCTAACTAGG - Intergenic
1031667047 7:124497219-124497241 TGACATTTACCTGTTTAACTAGG + Intergenic
1032629711 7:133635653-133635675 ACAATTCCACCTGTTTAACTGGG - Intronic
1036085114 8:5605178-5605200 ATCTATTCCCCTTTTTAACTTGG - Intergenic
1038187681 8:25290537-25290559 ACATATTAAACTGTTAATCTTGG - Intronic
1041269526 8:56097852-56097874 ACTTATTCTACTGTTTTACTGGG + Intergenic
1042283031 8:67075753-67075775 AAAAATTCACCTGCTTAACAGGG - Intronic
1042492376 8:69414277-69414299 ATATATTCACATTTTTAAATGGG + Intergenic
1043029084 8:75108417-75108439 ACATATTCAATTGTTTAATTAGG + Intergenic
1043711230 8:83421520-83421542 CCATATTCACTATTTTAACTGGG - Intergenic
1045767327 8:105689826-105689848 ACTTATTTTCCTTTTTAACTTGG + Intronic
1046255225 8:111687952-111687974 ACATATTCTCATGTATAAGTGGG - Intergenic
1046766095 8:118071946-118071968 ACCTACTCACCTGTGTAATTAGG - Intronic
1046864666 8:119133518-119133540 ATATATTCATCTGTTTAGCCAGG - Intergenic
1047141856 8:122150005-122150027 CCAAATTCACCTAATTAACTAGG + Intergenic
1048834564 8:138506165-138506187 ACATATTCATCCTTTTAAGTTGG + Intergenic
1050451495 9:5786397-5786419 AAATATTCCCCTTTTCAACTTGG + Exonic
1050679811 9:8097774-8097796 ACATATTCTCATGTATAAGTGGG - Intergenic
1057624684 9:96666818-96666840 ACCTATACACCAGATTAACTGGG + Intergenic
1058083694 9:100726180-100726202 ACATATATGACTGTTTAACTGGG + Intergenic
1059208616 9:112488868-112488890 TAATATTAATCTGTTTAACTGGG - Intronic
1059781822 9:117537520-117537542 ACATAGCCACCTGTTCTACTTGG - Intergenic
1060670190 9:125461934-125461956 AGATATCCACCTGTCTACCTTGG + Intronic
1062264666 9:135681541-135681563 AGATAGTCACCTTTTTAAGTTGG + Intergenic
1186082673 X:5950560-5950582 ACATATTAACCTGTTGAATTTGG - Intronic
1186099150 X:6136563-6136585 CCATATGCACCTGTTTAATATGG + Intronic
1186595275 X:10974550-10974572 ATATATGCACTTGTTTATCTTGG + Intergenic
1187625621 X:21109807-21109829 TAATATTCAACTGGTTAACTTGG - Intergenic
1190904071 X:54708699-54708721 CCATATTCATCTGTCTAAATGGG + Intergenic
1193342183 X:80362056-80362078 ACATATTCTCATATTTAAGTGGG - Intronic
1193585308 X:83314162-83314184 AGATATAAACCTTTTTAACTGGG - Intergenic
1194414760 X:93597321-93597343 ACTTATTCCCCTGTTTAAAATGG - Intergenic
1198316591 X:135473533-135473555 ACTTATTCACCTTATAAACTTGG - Intergenic
1199142339 X:144327938-144327960 ATATATTATCCTGTTTAAGTGGG - Intergenic
1201500950 Y:14642052-14642074 ACATTTGCACCTGTTCAACATGG - Intronic