ID: 1178162805

View in Genome Browser
Species Human (GRCh38)
Location 21:29939101-29939123
Sequence GGATCCAGGTTCGCAGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178162805_1178162812 1 Left 1178162805 21:29939101-29939123 CCGGTCCCTGCGAACCTGGATCC 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1178162812 21:29939125-29939147 CGCACTCTAGCCCGCGTTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178162805 Original CRISPR GGATCCAGGTTCGCAGGGAC CGG (reversed) Intronic
900326604 1:2111326-2111348 GGTCCCAGGTTGACAGGGACAGG + Intronic
900767870 1:4517558-4517580 GGCTCCAGCCTGGCAGGGACAGG - Intergenic
902553081 1:17230672-17230694 GGATCCTGGTACGTAGCGACAGG + Exonic
903659363 1:24967327-24967349 GGACTCAGGTTCCCAGGGAGGGG - Intergenic
907835166 1:58101901-58101923 GGATCCAGGTTTGCAGGTCCTGG + Intronic
908555711 1:65254742-65254764 GCATCCAGGCTCCCAGGGCCGGG - Intronic
912467307 1:109882937-109882959 GGACCCAGGGAAGCAGGGACAGG + Intergenic
913378634 1:118184924-118184946 GGACCCAGGGTCCCAGGGACAGG - Intronic
914716597 1:150259450-150259472 GCAGCCAGGCTGGCAGGGACAGG - Intronic
916500428 1:165382587-165382609 GGCTTCAGGTTCACAGTGACAGG - Intergenic
917285926 1:173421433-173421455 GGAACCCGGTTCGGAGGGTCTGG - Intergenic
920990847 1:210937913-210937935 GGATGCAGCTTCCCAGGGAAAGG - Intronic
921919930 1:220656288-220656310 GCATCCAGGTAGGCAGGAACAGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1064619294 10:17198618-17198640 GAATCAAGGTTACCAGGGACTGG + Intronic
1069034294 10:63630783-63630805 GGATCCAGGATCTCCGGGTCGGG - Intergenic
1072211231 10:93248828-93248850 GGATCCAGGTTAGCAGAGGCCGG + Intergenic
1076340662 10:129742810-129742832 AGAGCCAGGTTCTCAGGGCCGGG + Intronic
1077091924 11:782509-782531 GTGTCCAGGTGCTCAGGGACTGG + Intronic
1077236735 11:1485534-1485556 GGAGCCGGGTGCCCAGGGACAGG + Intronic
1080387627 11:31819139-31819161 GGATCAAGGCGCGCAGGGACTGG - Intronic
1080770016 11:35331979-35332001 GGACCCAAGTCTGCAGGGACTGG + Intronic
1084185606 11:67469275-67469297 GGAGCCAGGGTCGGAGGGGCGGG - Intergenic
1089362729 11:117901767-117901789 GGATGCAGCTTCCCAGGGCCTGG - Intronic
1089715179 11:120352740-120352762 GGAACCAGTTTCCCAGGGCCTGG + Intronic
1090262404 11:125331015-125331037 GGAGCCAGGATGGCAGGGTCGGG - Intronic
1090784976 11:130040816-130040838 GGGGCCAGGTTCGCAGGGGCCGG + Intergenic
1091229188 11:133976913-133976935 GGACTCAGGTGTGCAGGGACTGG - Intergenic
1091279690 11:134374854-134374876 GGAACCAGGCTGGAAGGGACAGG - Intronic
1091354025 11:134921886-134921908 GGATCCAAGTTCTCAGGGCAGGG + Intergenic
1101153609 12:101906995-101907017 GGTTACAGGATGGCAGGGACAGG + Intronic
1118318628 14:64740676-64740698 GGCCCCAGGTTCCCAGGGGCTGG - Intronic
1119422308 14:74514662-74514684 GACTCCAGGTTCCCACGGACAGG - Intronic
1121340153 14:93100213-93100235 TGCTCCAGGTCCACAGGGACAGG - Intronic
1129227504 15:74178667-74178689 GAATCCAGGTTCCCAGAGAAAGG - Intergenic
1130846610 15:87753635-87753657 GAATCCAGGATAGCAGGGACAGG + Intergenic
1131588064 15:93717520-93717542 GGATCCAGGTAAGCTGGGCCTGG + Intergenic
1133502375 16:6378338-6378360 GGCACCAGGATCGCAGGGTCTGG - Intronic
1134551528 16:15141082-15141104 GGATGGAGGGTGGCAGGGACTGG - Intergenic
1134824787 16:17275749-17275771 CGATCCAGGTCCTCTGGGACGGG + Intronic
1136083386 16:27867664-27867686 GGATCCAGCTCCCCAGGGAGTGG - Intronic
1139664618 16:68447464-68447486 GGATCCAGGTAGGGAGGGCCTGG + Intronic
1142051933 16:87964739-87964761 GGGTCCAGGTTGGGAGTGACAGG + Intronic
1142361815 16:89630954-89630976 GGATGAAGGTCTGCAGGGACTGG + Intronic
1142412460 16:89923544-89923566 TGTTGCAGGTTCGCAGGGGCGGG - Intronic
1146846413 17:36184057-36184079 AAATCCAGCTTTGCAGGGACGGG + Intronic
1148253086 17:46103120-46103142 GGATACAGGTAGGCAGGGCCAGG + Intronic
1148369569 17:47087331-47087353 GGATACAGGTAGGCAGGGCCAGG + Intergenic
1149849767 17:60027472-60027494 GAATCCAGCTTTGCAGGGACGGG + Intergenic
1149860401 17:60119052-60119074 GAATCCAGCTTTGCAGGGACGGG - Intergenic
1151319400 17:73343496-73343518 GAATGCAGCTTCCCAGGGACCGG + Intronic
1152108091 17:78342271-78342293 CGAGCCAGGTTGGCATGGACTGG + Intergenic
1152209366 17:78994953-78994975 GGAAGCAGGTTCCCAGCGACTGG + Intronic
1152656577 17:81522671-81522693 AGATGCAGGTTCGCAGGGGCTGG + Intronic
1152759844 17:82102072-82102094 GGGTCCTGCTTGGCAGGGACTGG + Intronic
1152888112 17:82864611-82864633 GGATCTTGGTTCACAGGCACAGG + Intronic
1155543644 18:26891455-26891477 GGATCCAGGGTGGCAGAGGCAGG - Intergenic
1159040213 18:63318099-63318121 GGATCCAGGTGTGCAGGTGCCGG + Exonic
1160367314 18:78337508-78337530 GGATGCAGGTGCGCTGGAACTGG - Intergenic
1160581752 18:79887211-79887233 GGATATAGGGTCACAGGGACAGG + Intronic
1160828002 19:1089683-1089705 TGACCCAGGTTCCCAGGGAGCGG - Intronic
1165137979 19:33682569-33682591 GAATGCAGGTTACCAGGGACTGG - Intronic
926801653 2:16665325-16665347 GGGTCCAGGTGTGCAGGGGCTGG + Intronic
927515285 2:23668656-23668678 GGATCCACCTTTGCCGGGACAGG + Intronic
929775354 2:44928146-44928168 CGATCCAGGCGCGCAGGGCCCGG + Intergenic
933876181 2:86623551-86623573 GGCTCCAGGTTCGCTCGGGCCGG + Exonic
935351507 2:102155038-102155060 GGAACAAGGTTCCCAGGGCCTGG - Intronic
938547485 2:132347741-132347763 GGATCCTACATCGCAGGGACTGG + Intergenic
948841459 2:240651868-240651890 GGATCCAGATCCCCAGGAACTGG + Intergenic
1168754842 20:309188-309210 GGATACAGGTTCCAGGGGACAGG + Intergenic
1168878226 20:1185450-1185472 GGATCCGGGGACGGAGGGACGGG + Intronic
1169427788 20:5509960-5509982 GGATCCAGGTTAGCCGGGGAGGG + Intergenic
1175292450 20:57885271-57885293 GGGACCAGGGTCGCAGGTACTGG - Intergenic
1178162805 21:29939101-29939123 GGATCCAGGTTCGCAGGGACCGG - Intronic
1178662932 21:34522081-34522103 GGACACAGCTTCTCAGGGACAGG + Intronic
1182900425 22:33894021-33894043 GCATCCAGGTCTGCAGGGCCGGG - Intronic
1183760849 22:39815649-39815671 GATTCCTGGTTCTCAGGGACAGG - Intronic
1185113259 22:48916227-48916249 GGATCTAGGTACGCAGGGTGTGG - Intergenic
952708652 3:36406480-36406502 GGCTGCAGGTTCGCAGTGAATGG - Intronic
960090462 3:113633265-113633287 GGATGCTGGTTCTCAGGGAAGGG + Intergenic
966300556 3:178475137-178475159 GGATGCAGATTCCCAGGAACAGG + Intronic
970565053 4:17323795-17323817 GGATCCAGGATCGTAGGAAAAGG + Intergenic
971026272 4:22591344-22591366 GGATCCAGGGTGGCAGAGGCAGG - Intergenic
972705112 4:41534770-41534792 TGATCCACATTGGCAGGGACTGG + Intronic
977658624 4:99555391-99555413 GGATCAAGTTCCTCAGGGACTGG + Intronic
979107348 4:116705278-116705300 GGTTCCAGTTTCTGAGGGACAGG - Intergenic
982183067 4:152766487-152766509 GGCTCCAGTTTGGTAGGGACTGG - Intronic
986431910 5:7689649-7689671 GCTTCCAGGTTCACAGGGTCAGG - Intronic
988796274 5:34656235-34656257 GGATCCAGGTCGGCGGGGGCCGG + Intronic
989259112 5:39399361-39399383 TTATCCTGGTTCTCAGGGACTGG + Intronic
990336486 5:54777374-54777396 GAATCCAGATTCTCATGGACTGG - Intergenic
991296777 5:65089996-65090018 GGATCCTAGGTGGCAGGGACTGG - Intergenic
991967356 5:72106866-72106888 GTAGCCAGGTTCTCAGGAACTGG - Intergenic
992856827 5:80870493-80870515 TTATCCAGGTTTGCAGGCACTGG + Intronic
995694831 5:114867026-114867048 GGATCCAAGTTCCCAGGCAGTGG + Intergenic
1002532845 5:179858942-179858964 GGATCCCAGTGCGCAGGGGCGGG - Intronic
1006101709 6:31689757-31689779 GGGTCCACGTTGGGAGGGACAGG - Intronic
1019125701 6:169838955-169838977 GGATGCCGGAGCGCAGGGACTGG + Intergenic
1019379197 7:712399-712421 GCATCCAGGTACGCGGGGCCGGG - Intronic
1023889782 7:44383860-44383882 GGAGCAAGGCGCGCAGGGACAGG + Exonic
1028777872 7:94701052-94701074 GGATCATGGTTACCAGGGACTGG + Intergenic
1033319208 7:140324632-140324654 GGCGGCAGGTTTGCAGGGACTGG + Intronic
1035063744 7:156090642-156090664 CCTTCCAGGTTCGCTGGGACCGG + Intergenic
1035296026 7:157867323-157867345 GTATCCAGGGTGTCAGGGACAGG - Intronic
1038636660 8:29292889-29292911 GGAAGAAGTTTCGCAGGGACAGG - Intergenic
1044627887 8:94252095-94252117 GAATCCAGCTCCGCAGGGCCCGG - Exonic
1047249031 8:123167578-123167600 GGAGCCAGGCACACAGGGACTGG + Intergenic
1047941730 8:129832965-129832987 GGATCCAGTATCTCAGGGAGGGG + Intergenic
1049083283 8:140458462-140458484 GCCTCCAGGATCGCAGGGCCCGG + Exonic
1049339116 8:142102520-142102542 GCATCCAGGTTGGCAGGGAAGGG - Intergenic
1051334970 9:16057845-16057867 GGCTGCAGGTTAGCAGGGGCTGG + Intronic
1058700622 9:107597223-107597245 AGATCAAGGTTGCCAGGGACTGG - Intergenic
1060281904 9:122220649-122220671 GGATCCAGGGACGCAAGGCCCGG - Intronic
1061391010 9:130316972-130316994 GGCTCCAGGTTAGCAGGGGGAGG + Intronic
1062726408 9:138076466-138076488 GGATCCAGGAGCCCAGGGAACGG - Intronic
1187127390 X:16466896-16466918 GGCTCCACCTTCCCAGGGACTGG + Intergenic
1188116841 X:26254783-26254805 GCATGCAGGTGCGCAGGTACCGG - Intergenic
1198084579 X:133270115-133270137 GCATGCAGGTGCTCAGGGACTGG - Intergenic