ID: 1178172152

View in Genome Browser
Species Human (GRCh38)
Location 21:30053416-30053438
Sequence CATGACCACCTGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178172152_1178172161 30 Left 1178172152 21:30053416-30053438 CCTTCCTCCTCCAGGTGGTCATG No data
Right 1178172161 21:30053469-30053491 ACAGATAAGTGAGTCCTGATTGG No data
1178172152_1178172159 -9 Left 1178172152 21:30053416-30053438 CCTTCCTCCTCCAGGTGGTCATG No data
Right 1178172159 21:30053430-30053452 GTGGTCATGGGTCTCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178172152 Original CRISPR CATGACCACCTGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr