ID: 1178175273

View in Genome Browser
Species Human (GRCh38)
Location 21:30089893-30089915
Sequence GCTGTAGCCAAGCCGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178175273 Original CRISPR GCTGTAGCCAAGCCGGAAGC TGG (reversed) Intergenic
901197534 1:7448456-7448478 GCTGTGTCCAAGCTGGGAGCTGG + Intronic
905397938 1:37679403-37679425 GCTGTAGTCAAGCTGTCAGCAGG + Intergenic
911475327 1:98366603-98366625 GCTTTATGCAAGCCTGAAGCTGG + Intergenic
916432595 1:164745653-164745675 GCTTTAGCCCAGCCTGTAGCTGG - Intronic
923191928 1:231627500-231627522 ACTGTAGCCAAGTAGGAAGTGGG - Intronic
1063450150 10:6145446-6145468 GCTGGAGCGCAGCGGGAAGCGGG - Intronic
1065795901 10:29308207-29308229 CCTGAAGCCAATCCTGAAGCAGG - Intronic
1065947064 10:30614459-30614481 CCTGAAGCCAATCCTGAAGCAGG + Intronic
1066560808 10:36668015-36668037 ACTGTATCCAAGCCAGAAGGTGG + Intergenic
1067433984 10:46264538-46264560 GCTGCAGGAAAGCAGGAAGCAGG - Intergenic
1067781261 10:49209107-49209129 GCTGTAGCCAACCCTGGTGCAGG - Intergenic
1070549497 10:77480060-77480082 CCTGCAGCCAAGACAGAAGCTGG + Intronic
1073063594 10:100745924-100745946 GCTGCAGCCAGGGCTGAAGCTGG - Exonic
1073340896 10:102743917-102743939 GGTGGAGCAGAGCCGGAAGCGGG + Intergenic
1075730317 10:124631845-124631867 GCAGCAGCCACTCCGGAAGCAGG + Intronic
1076873623 10:133205391-133205413 GCTGTCGCCATGAGGGAAGCAGG - Intronic
1077137149 11:1006185-1006207 GCTGTAGCCCAGCCTGCAGACGG + Intronic
1077474227 11:2778845-2778867 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1077474379 11:2779453-2779475 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1083299498 11:61732898-61732920 GCTAGGGCCAAGCCAGAAGCAGG - Intronic
1085032647 11:73282005-73282027 GCTGTAGCCCTGCAGGGAGCTGG - Intronic
1085229013 11:74948927-74948949 GCTGAAGCGACGCCGGAGGCAGG - Exonic
1085505823 11:77058242-77058264 ACTGGAGCCAAGCCGGCACCTGG - Intergenic
1090618037 11:128533987-128534009 TCTGTAGCGAAGCTGGAAGTAGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095038459 12:37419249-37419271 GCTGCAGCCGAGGCGGCAGCTGG + Intergenic
1096616554 12:52836363-52836385 GCTGTCTCCAAGCAGCAAGCCGG - Intergenic
1100820349 12:98423648-98423670 GCTGTAGCCAAGCAGGCATAGGG + Intergenic
1101467543 12:104963007-104963029 GCGGAAGCCAGGGCGGAAGCAGG + Intergenic
1105014483 12:132777780-132777802 GCTGCTGCCAAGGTGGAAGCCGG - Exonic
1110746099 13:79054940-79054962 GCTGTTGCCAGGCCTGCAGCAGG - Intergenic
1113487485 13:110664954-110664976 GCTATAGCCAAACTGAAAGCGGG - Intronic
1114316072 14:21511139-21511161 GCTGCAGCGGAGGCGGAAGCAGG - Exonic
1116045741 14:39740516-39740538 ACTGTAGCCAAGCTGGTACCTGG - Intergenic
1124634062 15:31353763-31353785 GCTGTGGCCAAGCCTGGGGCAGG + Intronic
1127353546 15:58176018-58176040 GCTGAAGCCACGCAGGAAGTTGG - Intronic
1129592537 15:76930342-76930364 ACTGGAGTCACGCCGGAAGCTGG + Intergenic
1131056379 15:89377737-89377759 GCGGTAGCCAAGCGGGTGGCTGG + Intergenic
1131250084 15:90824717-90824739 GGTGTAGCCATGCCTGAAGAAGG - Intergenic
1132748302 16:1446004-1446026 TGTGTACCCAAGCCGGATGCAGG + Exonic
1134616857 16:15658183-15658205 GCTGGAGGTAAGCCTGAAGCCGG - Intronic
1136895337 16:33993009-33993031 GCTGTAGCCCAGTCGGGGGCAGG - Intergenic
1139508554 16:67412647-67412669 GCTGTGGCCAAGGATGAAGCAGG - Intronic
1141767921 16:86070881-86070903 GCTGTAGCTAGGCAGGAAACTGG - Intergenic
1203077696 16_KI270728v1_random:1130612-1130634 GCTGTAGCCCAGTCGGGGGCAGG + Intergenic
1143423442 17:6814128-6814150 GCTGTAGTCAAGCCAGCTGCTGG - Intronic
1149494186 17:57106695-57106717 GCTGTTGCCCCGCCGGATGCTGG + Exonic
1152738423 17:82008628-82008650 GCTGTGGCCAAGAGGGCAGCGGG + Intronic
1153615646 18:6930512-6930534 GCTGTAACCAAACCATAAGCTGG - Intergenic
1153770585 18:8412428-8412450 GCTGTAGCCTAGGCAGCAGCAGG + Intergenic
1157357193 18:46946757-46946779 GCTCTAGCCAATCCGGAAAGGGG + Intronic
1159812073 18:73027626-73027648 GCAGTAGGCAAAGCGGAAGCAGG - Intergenic
1161428578 19:4217689-4217711 GCTGGAGCAGAGCCGGGAGCTGG + Exonic
1165477579 19:36040093-36040115 GCTGCAGCCAGGCCTGCAGCCGG + Exonic
1168096038 19:54115416-54115438 GCCGAAGCGAAGCCGGAAACAGG - Exonic
928614623 2:33024878-33024900 GCTGCAGCCAAGCAGTCAGCAGG + Intronic
935426646 2:102925968-102925990 GCTGTAGCCAAGCTGACAGCTGG + Intergenic
940002397 2:148979500-148979522 GCAGGAGCCAAGCCAGAGGCCGG - Intronic
944114662 2:196173233-196173255 GCTGGAGCTAAGGCAGAAGCAGG - Intronic
946188177 2:217993422-217993444 GATGAAGCCAAGCTGGGAGCAGG + Intronic
948597138 2:239087411-239087433 GCTGGAGCCAAGCCGGCATGCGG + Intronic
1169263460 20:4153827-4153849 GCTGTGGCCAAGCCTGAGGCGGG + Intronic
1171238825 20:23548766-23548788 GCTGTATCCAGGAGGGAAGCTGG + Intergenic
1171240847 20:23565938-23565960 GCTGTATCCAGGAGGGAAGCTGG + Intronic
1173906279 20:46632002-46632024 GCTGCAGCCCAGCAGGGAGCTGG - Intronic
1175769103 20:61611713-61611735 GCTGTAGCCAAGCCGCTTGGGGG + Intronic
1177719121 21:24881612-24881634 GCTTTAGCCAATCCCTAAGCAGG - Intergenic
1178175273 21:30089893-30089915 GCTGTAGCCAAGCCGGAAGCTGG - Intergenic
1182585976 22:31344631-31344653 GATGTAGCCCAGCTGGAGGCTGG + Exonic
1184491058 22:44809330-44809352 CCTGTACCAAAGCAGGAAGCAGG + Intronic
950306098 3:11916071-11916093 GATGTAGCCTAGCCTGAGGCGGG - Intergenic
951501814 3:23396848-23396870 GCTGTAGCCAAGCATTATGCAGG + Intronic
959961922 3:112307057-112307079 GCTGTGGCCACTCCGGAGGCTGG + Intergenic
963250310 3:143096459-143096481 GCTGTAGCCCTGCAGGGAGCCGG + Intergenic
969580332 4:8061113-8061135 GCTGTATCCATGCCGGGCGCTGG - Intronic
972225606 4:37007712-37007734 GCTGTACTCAAGCCGTCAGCTGG - Intergenic
976921777 4:90451571-90451593 GCTGGAACCCAGCTGGAAGCTGG + Intronic
978034043 4:103972553-103972575 GATGTAGCCAAGTGGGAAGTCGG - Intergenic
985808934 5:2069023-2069045 GCAGGGGCCAAGCCCGAAGCAGG - Intergenic
992186607 5:74250474-74250496 GCTGTGGCCAAGTCATAAGCTGG + Intergenic
998452980 5:142249233-142249255 GCTGAGGCCAAGCCACAAGCTGG - Intergenic
1002168521 5:177362605-177362627 GCAATGGCAAAGCCGGAAGCAGG + Intronic
1011442066 6:87397997-87398019 GCTGTAGCCAAGCAGGCATAGGG + Exonic
1011790016 6:90888211-90888233 ACTGTAGCAAGGCCTGAAGCTGG - Intergenic
1022977834 7:35575111-35575133 GCTATAGCCAAGCTGTCAGCAGG + Intergenic
1032158044 7:129486083-129486105 GTTGTAGCCAAGACTAAAGCAGG - Exonic
1032657188 7:133943827-133943849 GCAGTAGCCAAGCCTGAAACAGG - Intronic
1035607055 8:936635-936657 GCTGGAGCCTAGTTGGAAGCTGG + Intergenic
1038072202 8:24029528-24029550 GATCTAGCCATGCCTGAAGCTGG - Intergenic
1041384032 8:57279896-57279918 GCTGAACCCAAGGCGGAGGCTGG - Intergenic
1043601875 8:81949919-81949941 GTTGTAACCTAGCTGGAAGCAGG + Intergenic
1049467236 8:142757133-142757155 GCTGTGGCCAAGCCCGGGGCAGG + Intergenic
1050230057 9:3514503-3514525 GCTGTAGACAACCCGGAGCCTGG - Intronic
1052192668 9:25677667-25677689 GCTGTAGCCGAGGCCGCAGCCGG - Exonic
1054704299 9:68447145-68447167 GCTGGTGCCAAGCCGGAGGGAGG + Intronic
1056378337 9:86035548-86035570 GCAGGAGCCAGGCCGGGAGCAGG - Exonic
1057306450 9:93915071-93915093 GCTCTGGCCAAGCCTGAAGGTGG + Intergenic
1058022133 9:100099900-100099922 GCTGAAGCAAAGGCGGGAGCAGG - Intronic
1060219673 9:121757729-121757751 GCTGAGACCAAGCCGGGAGCAGG + Intronic
1062383265 9:136297948-136297970 GCTCTCGCCAAGCAGGGAGCAGG - Intronic
1062491292 9:136806295-136806317 GCTGCAGCCAGGCTGGGAGCTGG + Intronic
1192350859 X:70355171-70355193 GCTGGAACCAAGCCAGGAGCAGG + Intronic
1197342323 X:125288433-125288455 GCTGTAGCCTTGCAGGGAGCTGG + Intergenic